All three strains were isolated from solar saltern samples collected from Marakkanam solar salterns, India (12°11′13.0272″N and 79°55′40.4220″E) using the dilution-plate technique on the Halovibrio agar medium as described previously (Verma et al., 2019). Briefly, on agar plates, the reddish-pink opaque convex colonies, 1–2 mm in diameter appeared in 7 days. The growth of wsp isolates were screened from 12 to 42°C, which suggested that they have optimum growth at 37°C. The positive growth was observed on media containing 3–5 M NaCl (Figure 1A), whereas no growth was observed on 0.3–2 M NaCl concentrations. Transmission electron microscopic images suggested that wsp1, wsp3, and wsp4 have pleomorphic morphology, and compared to wsp1, both wsp3, and wsp4 isolates are highly vacuolated (Figure 1B and Supplementary Figure S1).

Comparison of both 16S rRNA and whole-genome sequences suggested that all three isolates are novel strains that belong to Haloferax and Halogeometricum genera. These results were further confirmed by calculating ANI (Average nucleotide index) and digital DNA-DNA hybridization scores where the observed values were higher than the accepted cut-off values (for ANI > 95% and for DNA–DNA hybridization >91%) for novel species (Supplementary Tables S1, S2). The phylogenetic analysis based on 16S rRNA sequencing data suggested that wsp1 is closely related to Haloferax volcanii DS2 and Haloferax chudinovii RS75 strains sharing 99% sequence similarity. Both wsp3 and wsp4 are closely related to Halogeometricum borinquense DSM 11551 strain sharing >99% sequence identity (Figures 1C,D). The genus Haloferax was first described by Torreblanca et al. (1986) and currently comprises twelve species, namely H. sulfurifontis, H. mucosum, H. mediterranei, H. denitrificans, H. prahovense, H. larsenii, H. gibbonsii, H. elongans, H. alexandrinus, H. lucentense, H. volcanii, and H. massiliensis. On the other hand, genus Halogeometricum was first described by Montalvo-Rodriguez et al. (1998) and comprises four species, namely H. pallidum, H. borinquense, H. limi, and H. rufum. H. volcanii DS2, and H. borenquencis DSM 11551 are the type strains of Haloferax and Halogeometricum genus, respectively. The draft genome sequences of wsp1, wsp3, and wsp4 comprized of 37, 07,582 bp (3.7 Mb), 28, 18,554 bp (2.8 Mb) and 39, 97,080 bp (3.9 Mb) with 4047, 3040, and 4257 annotated coding sequences (CDS). The GC content of wsp1, wsp3, and wsp4 were 66.1, 61.0, and 59.7%, respectively. For further analysis, we compared wsp1 genome sequences with H. volcanii DS2 and both wsp3 and wsp4 genomes with the H. borinquense DSM 11551. Genome circular map built by using BLAST Ring Image Generator (BRIG) tool (Alikhan et al., 2011), revealed that wsp3 has high sequence similarity with both wsp4 and H. borinquense DSM 11551 genomes except one highly variable region of about 1 Mbp (Figure 1F).

During evolution, microbes acquired several genes that facilitate their growth and survival. The important genes in this list include genes responsible for cell signaling, metabolic regulators, antibacterial proteins, ion transporters, etc. To understand the environmental effect on gene pool variation, we performed a pangenome analysis of wsp samples with their closely related species using the Bacterial Pan Genome Analysis (BPGA) pipeline (Chaudhari et al., 2016). The original pangenome concept was developed by Tettelin et al. (2005) and it describes the total pool of genetic material comprized of all members of a species. The pangenome consists of three different groups known as the core, accessory, and unique genomes. The core genome consists of common genes that are present in all individuals, accessory or dispensable genome containing shell genes present in few individuals and a unique genome contains genes that are specifically present only in an individual member (Tettelin et al., 2005; Wolf et al., 2012; Vernikos et al., 2015). The outcomes of the pangenome analysis are discussed in the following sections.

Polyphasic taxonomic characterization were studied according to the methods in the proposed minimal standards for description of new taxa in the order Halobacteriales (Table 1A; Grant and Larsen, 1989; Oren et al., 1997). Biochemical characterization suggested that all three isolates were positive for the catalase test and negative for urease, lipase, and Voges-Proskauer tests. All three strains were also negative for acid production, casein hydrolysis, and hydrogen sulfide production. We also performed enzymatic screening which involved in amino-acid biosynthesis pathways and found that all three were negative for lysine decarboxylase, arginine decarboxylase, aesulin hydrolysis, and ornithine decarboxylase.

Wsp3 and wsp4 strains had many similar enzymatic features such as both were positive for citrate utilization, oxidase test, and methyl red test. Besides these similarities, some variations were also observed e.g., both H. borinquense DSM 11551 and wsp3 are positive for gelatin liquefaction and indole production while wsp4 is negative. We also found that wsp3 is unable to reduce nitrate, unlike H. borinquense DSM 11551 and wsp4. Genome analysis suggests that both H. borinquense DSM 11551 and wsp4 encode nitrate reductase gene which is missing in the wsp3 genome. Similarly, we also found a copy of the nitrate reductase gene in wsp1 genome, which reduces nitrate, whereas it is missing in H. volcanii DS2 which is negative for nitrate utilization.

Carbon source preferences of haloarchaeal isolates were identified by monitoring their growth in the presence of different carbon sources. Optical density-based assay results suggest that all three strains have similar preferences for dextrose while they were unable to utilize arabinose, rhamnose, aldonitol, inositol, inulin, and melibiose (Table 1B). Along with enzyme-based biochemical tests, wsp3 and wsp4 had some similar and dissimilar preferences for carbon source utilization. Both wsp3 and wsp4 were positive for pyruvate and maltose utilization while negative for lactose and galactose utilization. Surprisingly, wsp3 alone was positive for three different carbon sources i.e., sucrose, cellobiose, and dulicitol while both H. borinquense DSM 11551 and wsp4 were negative. Similarly, wsp1 is not able to utilize sucrose and arabinose while its type strain H. volcanii DS2 is capable of utilizing both sugars.

Quantitative analysis of carbon source utilization shows that both wsp1 and wsp3 efficiently utilize galactose and maltose, respectively. Genome analysis suggested that both wsp1 and H. volcanii DS2, encode galactokinase enzyme which help them to utilize galactose as a carbon source (Anderson et al., 2011) while this enzyme is absent in both wsp3 and wsp4 strains. For maltose utilization, two alternative pathways have been proposed (Cibrario et al., 2016). The two essential enzymes of these pathways are malz (α-1, 4-glucosidase) and malA (α-amylase MalA). Genomic data analysis suggested that only wsp3 genome encodes for two different copies of α-1, 4-glucosidase enzyme while wsp1 and wsp4 only have an α-amylase gene in their genomes. This probably explains why wsp3 can utilize maltose more efficiently compared to both wsp1 and wsp4.

Culture isolates were also screened for antibiotic resistance (Table 2). The analysis suggested that all three isolates were sensitive for novobiocin and resistant to penicillin, vancomycin, chloramphenicol, cephadroxil, lincomycin, cephalexin, ceftazidine, and cephadroxil. Surprisingly wsp3 had sensitivity for cefazolin and kanamycin while wsp1 and wsp4 were resistant to both the antibiotics like their type strains. The possible reason for kanamycin resistance in wsp1 and wsp4 is the presence of aminoglycoside phosphotransferase while this enzyme is absent in wsp3 hence probably explaining the differences observed in kanamycin resistance in these isolates.

In the present manuscript, we isolated carotenoids from three haloarchaeal strains (Figures 3A,B). The visible cell pellet color of wsp1 was different when compared to both wsp3, and wsp4 suggesting either variations in the content or molecular structure of the carotenoids produced by these strains (Figure 3A). For further analysis, we purified carotenoids following Yatsunami et al. (2014) protocol and characterized them using UV–visible spectroscopy. UV–visible spectra suggested that wsp1, wsp3, and wsp4 have a similar absorption spectrum having major absorption peaks at 476, 502, and 535 nm, however, there were differences in the peak heights (Figure 3B). These differences may explain why carotenoids isolated from wsp1 are different in color compared to wsp3 and wsp4. These three major peaks correspond to bacterioruberin (535 nm), all-Trans-lycopene (502 nm), and 13-cis-lycopene (476 nm). Bacterioruberin is a major component of haloarchaeal carotenoids which is synthesized from lycopene (Yang et al., 2015). We took the ratio of peak1/peak3 which may help us understand the bacterioruberin and lycopene contents in these strains. The lycopene has specific absorption at 502 and 476 nm while bacterioruberin absorbs at 535 nm. A slight absorption of bacterioruberin is also reported at 466 nm. The peak1/peak3 ratio was 1.0, 0.9, and 0.8 for wsp1, wsp3, and wsp4, respectively, suggesting that wsp1 has the highest bacterioruberin content among the three strains.

Haloarchaea lives in hypersaline environments such as marine salterns, saline soils, soda lakes, salted foods, etc. The cell lysis of marine planktons such as shrimps, diatoms, algae, fish, purple and green bacteria, etc. release different biomolecules including starch, cellulose, proteins, chitin, etc. To digest this biopolymer, haloarchaea needs to produce different digestive enzymes to utilize these substrates.

The whole-genome sequencing and annotation results suggested that wsp1, wsp3, wsp4 genomes code for two, one, and three putative α-amylase genes, respectively. We successfully cloned all four α-amylase genes sharing <40% sequence identity among themselves. However, only one of them, named amy2 (locus tag G3A49-11660) isolated from wsp1, expressed well. Multiple domain analysis of Amy2 (protein ID QIB80089.1) suggested that it has a conserved α-amylase domain in the C-terminal region (residue range 227 to 635). A PSI-BLAST search using the NCBI database was performed for the additional N-terminal region (residue ranges from 1 to 226 aa). However, we did not find any significant hits, therefore, the function of this N-terminal domain is still not clear. Initially, we attempted to purify recombinant His-tagged Amy2 from the cytosolic fraction using E. coli Rosetta DE3 as an expression host. We successfully purified Amy2, however, the purified enzyme was inactive as suggested by the starch agar plate assay. Since most of the amylases are secretory proteins so we cloned amy2 in pET22b vector having pelB secretion signal sequence at the N-terminus to aid secretion/expression in the periplasmic space and C-terminal 6X His-tag to aid purification of the recombinant Amy2. We used this construct for purification and further biochemical characterization of Amy2.

Upon induction, we observed amylase activity even in the cell-free culture supernatant (Figure 4A). E. coli cells alone or cells carrying the pET-22b vector without amylase genes were used as negative controls in these experiments (Figure 4A). We successfully purified Amy2 from the periplasmic space using Ni-NTA-based affinity chromatography (Figure 4B). The gel-filtration profile suggested that Amy2 is predominantly monomeric in solution (Figure 4C) and enzymatically active on the starch agar plates. We initially tested Amy2 salt tolerance by incubating purified enzyme for 12 h with different concentrations of salt ranging from 0.25 to 4 M on the starch agar plate (Figure 4D). We observed amylase activity in all the samples suggesting halotolerant property of Amy2. We further performed the biochemical characterization of Amy2 to study its stability and activity at various salt concentrations, pH, and temperature.

The thermal effect on enzymatic activity was studied at the temperature range of 5–75°C. Our finding revealed that Amy2 showed maximum activity at 35°C, and retained 40% activity at 55°C whereas negligible activity was observed at 75°C (Figure 4G).

The biochemical characterization reveals attractive features of Amy2 including halotolerant, moderately thermostable, and activity at a wide pH range suitable for various industrial applications. These biochemical characteristics reported here are comparable to α-amylases reported from other halophiles (Onodera et al., 2013; Bajpai et al., 2015).

Most of the archaeal α-amylases belong to the subfamily of glycosyl hydrolase GH families: GH13, GH70, and GH77 (Dong et al., 1997; Bowers et al., 2009). In recent years, several potential α-amylases from different halophilic archaea have also been added to these families (Lombard et al., 2014; Santorelli et al., 2016). The enzyme belonging to this families should have three distinct domains: a central catalytic domain harboring a (β/α)₈ Tim barrel (domain A), with an irregular loop domain (domain B) usually protruding as a long loop out of the barrel connecting the third β-strand and the third α-helix and with the typical structure of an antiparallel β-sandwich (domain C) (Sarian et al., 2017).

Multiple sequence alignment using the NCBI blast portal revealed that Amy2 has a catalytic α-amylase domain encompassing 267–600 residue range (Figure 5A). This catalytic domain is mainly present in archaeal and bacterial species and is known to hydrolyze α-(1, 4) glycosidic linkages of glycogen, starch, related polysaccharides, and some oligosaccharides (Antranikian, 1992; Gupta et al., 2003; Sivaramakrishnan et al., 2006). The structural model of the catalytic domain of Amy2 (R269-D625) was built using PHYRE2 (Kelley et al., 2015) webserver suggested that it may have a similar structural architecture found in other members of GH family of amylases i.e., eight stranded alpha/beta-barrel that contains the active site, calcium-binding domain present between beta-strand 3rd and alpha-helix 3rd, and a carboxyl-terminal Greek key beta-barrel domain (Abe et al., 2005). Amy2 sequence blast at the RCSB database (Bernstein et al., 1977) suggested that Halothermothrix orenii α-amylase is the closest structural homolog sharing 28% sequence identity over 426 residues (ranges from 3 to 429 aa) (Figure 5B). The majority of the α-amylase enzymes are calcium-dependent metalloenzymes, where metal ion is required for both stability and enzymatic activity (Hsiu et al., 1964; Boel et al., 1990). H. orenii α-amylase (PDB ID-1WZA) harbors two different calcium-binding loops, loop 1: Asp44 aa to Ile52 aa and loop 2: Asp65 to Asp73 residues (Sivakumar et al., 2006). The sequence alignment and predicted structural model suggests that the calcium-binding loop 2 is missing in Amy2 (Figures 5B,C). Amy2 also has smaller B and C domains compared to H. orenii α-amylase due to deletions in the loop regions (Figures 5B,C).

For amylase activity, a catalytic triad consisting of Asp-Glu-Asp is required where first aspartic acid is involved in attacking the sugar anomeric center by a nucleophilic side chain and this reaction is assisted and governed by other two Glu-Asp residues (Hsiu et al., 1964; Machius et al., 1995). In H. orenii this triad is composed of Asp224-Glu260-Asp330. Multiple sequence alignment-based analysis suggests that Amy2 also has similar tried consisting of Asp436-Glu463-Asp529, respectively (Figure 5D).

The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system is used by bacteria and archaea to fend off foreign genetic elements (Horvath and Barrangou, 2010). Since its discovery, it has been developed into numerous applications like genome editing and regulation of transcription in eukaryotes and bacteria (Gilbert et al., 2013). The genomes of the strains wsp1, wsp3, and wsp4 were submitted to CRISPR Finder¹ (Grissa et al., 2007) which suggested that all three genomes have multiple CRISPR-DR (CRISPR-direct repeat) as well as spacer sequences. In wsp1, wsp3 and wsp4 genomes six, one, and four CRISPR-DR sequences were observed, respectively (Supplementary Table S3). Whole-genome data of wsp1, wsp3, and wsp4 were further analyzed for the presence of CRISPR associated genes (Cas). Our analysis suggested the presence of several Cas sequences in both wsp1 and wsp4 genomes although no Cas-related genes were identified in the wsp3 genome. In haloarchaea CRISPR-Cas system type I, subtype I-B, is dominantly present (Maier et al., 2017). A characteristic feature of type I systems is the presence of nuclease Cas3 protein, and subtype I-B is further characterized by the presence of Cas8b (Makarova and Koonin, 2015). The functional process of Type I-B system is mainly based on the presence of Cas proteins, namely, Cas5, Cas7, and Cas8b which combine to form a Cascade (CRISPR-associated complex for antiviral defense)-like complex in different Haloferax species such as H. volcanii (Maier et al., 2019). Genome analysis of both wsp1 and wsp4 suggested that they encode all the genes required to type I CRISPR system i.e., Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, and Cas8b genes. The presence of both Cas3 and Cas8b suggests that pws1 and pws4 harbor CRISPR-cas type IB system similar to other haloarchaeal species.

In addition to enzymes, recent studies indicate that archaea can also produce a wide range of small peptides and secondary metabolites (Pietra, 1997; Pettit, 2011; Wang et al., 2019). These small peptides and secondary metabolites could be of considerable interest in biotechnology. For the screening of secondary metabolite production, all three genome sequences were uploaded onto an online antiSMASH server (Medema et al., 2011). The output results predicted multiple copies of two important secondary metabolites i.e., siderophore and terpenes in all three strains (Supplementary Table S4). In the case of wsp3, no siderophore gene was predicted. Siderophores play an important role in iron transport (Neilands, 1995) while the functions of terpenes in haloarchaea are not known yet.

For all the biochemical tests, respective basal mediums (composition: 250.0 g NaCl, 20.0 g MgSO₄.7H₂O, 3.0 g trisodium citrate 2H₂O, 2.0 g KCl, 10.0 g peptone, 25.0 g agar in 1000 ml; pH 7.2) were supplemented with a final concentration of 25.0% NaCl. The growth of the isolates was tested at 12, 15, 20, 25, 30, 37, and 42°C on Halovibrio agar (1% agar added to basal medium). Isolates were plated on Halovibrio medium (without NaCl) (HiMedia) supplemented with different concentrations of NaCl (2, 5, 7, 10, 12, 15, 18, 20, 22, 25, 27 and 30%) to test salt tolerance. Growth at different pH (5.0, 6.5, 7.0, 8.0, 9.0, and 10.0) was examined using Halovibrio medium (without NaCl) supplemented with 25% NaCl as described earlier (Chen et al., 2016). The pH was adjusted using different buffers: MES (pH 5.0–6.0), PIPES (pH 6.5–7.0), HEPES (pH 7.5–8.0), and CHES (pH 9.0–10). Catalase activity, citrate utilization (using Simmons’ citrate agar) and urea hydrolysis were determined as described by Cowan and Steel (Cowan and Steel, 1965). The hydrolysis of casein, gelatin, starch and indole, methyl red test, Voges–Proskauer test and oxidase activity were assessed as described by Smibert and Krieg (Smibert et al., 1994). Nitrate reduction was tested as described by Lanyi (Lányi, 1988). Acid production from various sugars was tested on minimal medium by using the method described by Smith et al. (Sasser, 1990). The utilization of different carbohydrates as sole carbon source was tested in minimal medium supplemented with 25.0 % NaCl and 2% MgSO₄7H₂O with 1% different carbon sources.

Genomic DNA extractions were performed using the Zymogen DNA isolation kit (Cat. No. D6105). The 16S rRNA gene sequences of strain wsp1, wsp3, and wsp4 were PCR-amplified using 21 forward (TCCGGTTGATCCYGCCGG) and 1453 reverse (GGGCYGCACGCGYRCTACA) standard primers. The amplified 16S rRNA gene sequences were further aligned with those of representative related taxa using the EzTaxon server (Yoon et al., 2017). The 16S rRNA gene sequences of wsp1, wsp3, and wsp4 representatives closely related species were retrieved from the EzTaxon server (Chun et al., 2007) and aligned using MEGA version X (Tamura et al., 2004; Kumar et al., 2018). Phylogenetic trees were constructed using the neighbor-joining methods (Saitou and Nei, 1987) and the percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1500 replicates) are shown next to the branches (Felsenstein, 1985). The whole-genome sequencing of all three strains were performed using Illumina NextSeq and for assembly CLC NGS Cell ver 9 (CGWB) were used. The draft genomes were annotated using the RAST online server (Aziz et al., 2008). The H. borinquense DSM 11551 and H. volcanii DS2 genomes were used as a reference for comparison and annotation. Pangenome analysis was carried out by using the BPGA pipeline (Chaudhari et al., 2016). The genomes were screened for secondary metabolite gene clusters using antiSMASH online server (Medema et al., 2011).

The genome sequence of wsp1, wsp3, and wsp4 are submitted at NCBI under accession numbers as NZ_CP048738, NZ_CP050274 and NZ_CP048739.

Aliquots of 50 μl from samples containing wild type culture (basal medium supplemented with 25.0% NaCl) were pipetted on a carbon-coated 300-mesh copper grid (Polysciences, United States). The excess sample was blotted and followed by air drying. The grids were further imaged using a JEM 2100 electron microscope, operated at 200 keV (JEOL).

The full length of amy2 was amplified and cloned in pET22b (Novagen) over-expression vector between NdeI-XhoI and NcoI-XhoI sites to yield recombinant protein having C-terminal 6X His-tag. The first set of restrictions were used for cytosolic expression (NdeI-XhoI) while the other set was used to express Amy2 fused with pelB (NcoI-XhoI) secretion signal sequence at the N-terminal. Forward primers 5′AGCTCATATGGCTGTCGGCGAGTCAGTA and 5′AGTAC CATGGCTGTCGGCGAGTCAGTA having NdeI and NcoI sites, respectively, and reverse primer 5′AGTCCTCGAGGGCGAGC GGGCAGACGAC having XhoI site were used for gene amplification. The amplified PCR products and vector were digested with NdeI-XhoI and NcoI-XhoI sites followed by an overnight ligation at 4°C. The ligated products were transformed into Top10 chemical competent cells (Thermo Scientific, United States). Positive clones were screened using colony PCR method. The positive clones were further confirmed by DNA sequencing. The protein was expressed using BL21-DE3 Rosetta cells (Thermo Scientific, United States). Transformed cells were inoculated into 10 ml media as a primary and then into 1000 ml media supplemented 100 μg/ml ampicillin. The cultures were induced at 0.6 OD₆₀₀ by adding 0.3 mM IPTG and incubated overnight at 18°C. Amy2 was purified using Ni-NTA (Merk-Sigma, United States) based affinity chromatography method following standard manufacturer’s instructions. Cell pellets were dissolved in buffer A (20 mM Tris pH 7.4, 250 mM NaCl and 10 mM CaCl₂) and lysed by sonication. The sample was centrifuged at 12,000 g for 30 min. After centrifugation, pellet was discarded and the cell free supernatant was mixed with Ni-NTA resin. Protein was eluted by adding increasing the concentration of imidazole (20–500 mM) to the buffer A. The eluted fractions were loaded on 15% SDS PAGE to check purity and quality of the protein samples. The elution fractions were pooled and concentrated using 30 K centrifugal amicon ultrafiltration devices (Merk Millipore, United States). The protein was further purified using gel filtration chromatography using Superdex 200 Increase column. The purified Amy2 was used for further biochemical experiments.

The 0.5 ml of the purified protein sample was injected into the Superdex 200 Increase (GE Healthcare, United States) analytical gel filtration column pre-equilibrated with 20 mM Tris pH 7.4, 250 mM NaCl and 10 mM CaCl₂. The flow rate was kept at 0.5 ml per min. The chromatogram was recorded at both 280 and 220 nm.

The carotenoids were extracted by following protocol published by Yatsunami et al. (2014). Briefly, 20 ml of haloarchaeal cultures were centrifuged at 12,000 g for 30 min at 25°C. The supernatant was discarded and pellets were further resuspended in 5 ml of acetone and methanol solution (7:3). This solution was incubated at room temperature for 30 min in dark followed by centrifugation at 12,000 g for 30 min. Reddish-pink supernatant was collected and pellets were discarded. Isolated colored supernatants were centrifuged at 3000 g in the speed-vac (Eppendorf concentrator plus) to remove methanol and acetone. The Reddish-pink colored pellets were finally dissolved in 200 μl of 100% methanol. UV spectra of extracted solutions were recorded at 200–700 nm range using a spectrophotometer (CECIL CE7500).

The α-amylase activity of the heterologously expressed Amy2 was measured using a starch agar plate assay. 1 gm of starch agar was dissolved in 100 ml of distilled water and poured into petri-plates. 50 μl of 5 μM purified Amy2 was loaded into starch agar wells and incubated overnight at 37°C. The activity was checked by staining the plates with an iodine solution [15% solution containing 5% (wt/v) I₂ and 10% (wt/v) KI].

Biochemical characterization of the enzyme was performed by the iodine-starch method. The reaction solution of 50 μl contained 1.0 ISU/ml enzyme and 0.2% (w/v) starch in reaction buffer (20 mM Tris–HCl, 250 mM NaCl and 10 mM CaCl_2, pH 7.4). A₆₆₀ was measured by standard enzyme assay. The effect of temperature on enzyme activity was determined by incubating the enzyme at the temperature range of 5–75°C at 10°C intervals for 30 mins. Optimum pH for enzyme activity was determined by measuring the activity at 37°C for 30 min under different pH conditions at an interval of 1.0 pH unit. Sodium acetate buffer was used for pH 3–5, phosphate buffer was used for pH 6–7, Tris buffer was used for pH 8–9, and sodium bicarbonate buffer was used for pH 10–11. Effect of salt concentration was observed by examining the activity at different NaCl concentration (0–4 M) at 37°C for 30 min. The data presented is an average of three independent experiments.

The evolutionary history was inferred using the Neighbor-Joining method (Saitou and Nei, 1987). The optimal tree with the sum of branch length = 0.23099238 is shown. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1500 replicates) is shown next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Maximum Composite Likelihood method and are in the units of the number of base substitutions per site. This analysis involved 16 nucleotide sequences. All ambiguous positions were removed for each sequence pair (pairwise deletion option). There were a total of 1483 positions in the final dataset. Evolutionary analyses were conducted in software suite MEGA X (Kumar et al., 2018).