<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Microbiol.</journal-id>
<journal-title>Frontiers in Microbiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Microbiol.</abbrev-journal-title>
<issn pub-type="epub">1664-302X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fmicb.2019.01454</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Microbiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Improved Monitoring of Low-Level Transcription in <italic>Escherichia coli</italic> by a &#x03B2;-Galactosidase &#x03B1;-Complementation System</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name><surname>Guo</surname> <given-names>Yan</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/757313/overview"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Hui</surname> <given-names>Chang-Ye</given-names></name>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="corresp" rid="c001"><sup>&#x002A;</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/668909/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Liu</surname> <given-names>Lisa</given-names></name>
<xref ref-type="aff" rid="aff3"><sup>3</sup></xref>
</contrib>
<contrib contrib-type="author">
<name><surname>Zheng</surname> <given-names>Hao-Qu</given-names></name>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/757305/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Wu</surname> <given-names>Hong-Min</given-names></name>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
</contrib>
</contrib-group>
<aff id="aff1"><sup>1</sup><institution>Department of Science &#x0026; Education, Shenzhen Prevention and Treatment Center for Occupational Diseases</institution>, <addr-line>Shenzhen</addr-line>, <country>China</country></aff>
<aff id="aff2"><sup>2</sup><institution>Department of Pathology &#x0026; Toxicology, Shenzhen Prevention and Treatment Center for Occupational Diseases</institution>, <addr-line>Shenzhen</addr-line>, <country>China</country></aff>
<aff id="aff3"><sup>3</sup><institution>Institute of Translational Medicine, Shenzhen Second People&#x2019;s Hospital</institution>, <addr-line>Shenzhen</addr-line>, <country>China</country></aff>
<author-notes>
<fn fn-type="edited-by"><p>Edited by: Jos&#x00E9; E. Barboza-Corona, University of Guanajuato, Mexico</p></fn>
<fn fn-type="edited-by"><p>Reviewed by: Gilberto Velazquez, Universidad de Guadalajara, Mexico; Shimshon Belkin, The Hebrew University of Jerusalem, Israel</p></fn>
<corresp id="c001">&#x002A;Correspondence: Chang-Ye Hui, <email>hcy_sypu@hotmail.com</email></corresp>
<fn fn-type="other" id="fn004"><p>This article was submitted to Microbiotechnology, Ecotoxicology and Bioremediation, a section of the journal Frontiers in Microbiology</p></fn>
</author-notes>
<pub-date pub-type="epub">
<day>26</day>
<month>06</month>
<year>2019</year>
</pub-date>
<pub-date pub-type="collection">
<year>2019</year>
</pub-date>
<volume>10</volume>
<elocation-id>1454</elocation-id>
<history>
<date date-type="received">
<day>19</day>
<month>02</month>
<year>2019</year>
</date>
<date date-type="accepted">
<day>11</day>
<month>06</month>
<year>2019</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#x00A9; 2019 Guo, Hui, Liu, Zheng and Wu.</copyright-statement>
<copyright-year>2019</copyright-year>
<copyright-holder>Guo, Hui, Liu, Zheng and Wu</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/"><p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p></license>
</permissions>
<abstract>
<p>Genetically encoded reporter proteins are important and widely used tools for the identification and capture of a promoter, tracking the dynamic behavior of transcription, and the quantification of promoter activity. The sensitivity of the reporter gene is a critical factor for an ideal reporter system because weak transcriptional signal has usually failed to be detected using classical reporters. In this study, we present a novel reporter system for improved monitoring of transcription in <italic>E. coli</italic> based on &#x03B2;-galactosidase &#x03B1;-complementation. In this reporter system, the &#x03B2;-galactosidase activity resulting from the assembly of a reporter lacZ&#x03B1; and an existing &#x03B1;-acceptor in advance serves as a measure of transcriptional activity <italic>in vivo</italic>. To validate the potential of the lacZ&#x03B1;-derived reporter system, a series of artificial operons were constructed, and the moderately strong <italic>lac</italic> promoter, <italic>ara</italic> promoter, and weak <italic>pbr</italic> promoter were chosen as the detection promoters. The response profiles of lacZ&#x03B1; was similar to that of wild type lacZ in artificial <italic>lac</italic> operons. Due to its small size and efficient expression profile, the detection sensitivity of a lacZ&#x03B1;-derived reporter system was significantly higher than that of the traditional full-length &#x03B2;-galactosidase and the fluorescent protein mCherry reporter system in artificial <italic>ara</italic> operons. As expected, the response sensitivity of the lacZ&#x03B1;-derived reporter system was also demonstrated to be significantly higher than that of the &#x03B2;-galactosidase and mCherry reporter systems in lead-sensitive artificial <italic>pbr</italic> operons. The lacZ&#x03B1;-derived reporter system may prove to be a valuable tool for detecting promoter activity, especially low-level transcription <italic>in vivo</italic>.</p>
</abstract>
<kwd-group>
<kwd>transcriptional signal</kwd>
<kwd><italic>E. coli</italic></kwd>
<kwd>fluorescence</kwd>
<kwd>&#x03B2;-galactosidase</kwd>
<kwd>&#x03B1;-complementation</kwd>
</kwd-group>
<counts>
<fig-count count="6"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="31"/>
<page-count count="12"/>
<word-count count="0"/>
</counts>
</article-meta>
</front>
<body>
<sec id="S1">
<title>Introduction</title>
<p>Bacteria dedicate an enormous amount of effort to regulate gene expression in response to environmental or physiological factors. Promoters control the transcription of all genes, and promoter activities are frequently regulated by changes in environmental or physiological conditions (<xref ref-type="bibr" rid="B8">Cases et al., 2003</xref>; <xref ref-type="bibr" rid="B23">Martinez-Antonio and Collado-Vides, 2003</xref>). Transcriptional fusions have been demonstrated to be important tools in studying gene expression and gene regulation in living organisms (<xref ref-type="bibr" rid="B24">Miller et al., 2000</xref>; <xref ref-type="bibr" rid="B10">Flores-Sandoval et al., 2015</xref>). Monitoring promoter activity is greatly facilitated by using reporter genes. Many genetically encoded reporter proteins have been successfully used for quantitative, non-disruptive monitoring of transcription in a living organism (<xref ref-type="bibr" rid="B21">Magrisso et al., 2008</xref>; <xref ref-type="bibr" rid="B7">Carter et al., 2014</xref>; <xref ref-type="bibr" rid="B17">Hui et al., 2019</xref>).</p>
<p>The widely used enzymatic reporters that are used to characterize transcription exhibit many strengths. The great advantage of an enzymatic approach is its relatively high sensitivity because even a low-level production of enzyme can, over time, catalytically hydrolyze enough substrate molecules to produce a detectable signal (<xref ref-type="bibr" rid="B19">Kawano et al., 2005</xref>). In addition, colorimetric detection of enzymatic activity with the naked eye using convenient and inexpensive plate assays is usually possible (<xref ref-type="bibr" rid="B9">Duttweiler, 1996</xref>; <xref ref-type="bibr" rid="B11">Fuxman Bass et al., 2016</xref>). Classical enzymatic reporters, such as &#x03B2;-galactosidase, hydrolyze an externally supplied substrate and yield a detectable product. &#x03B2;-galactosidase has been widely used as a reporter both <italic>in vivo</italic> (<xref ref-type="bibr" rid="B2">Asanuma et al., 2015</xref>; <xref ref-type="bibr" rid="B12">Gu et al., 2016</xref>) and <italic>in vitro</italic> (<xref ref-type="bibr" rid="B27">Seeber and Boothroyd, 1996</xref>; <xref ref-type="bibr" rid="B20">Kita et al., 2008</xref>). &#x03B2;-galactosidase has a molecular weight of 540 kDa, and previous studies suggest that transcripts from many potential promoters are not detected because of a low expression level of high molecular weight reporter proteins (<xref ref-type="bibr" rid="B19">Kawano et al., 2005</xref>). Thus, there is an urgent need to develop a small-molecule reporter protein or peptide for enhanced detection sensitivity.</p>
<p>The intracistronic &#x03B1;-complementation, a property of the <italic>lacZ</italic> gene, has been well characterized and adapted in many studies including the blue-white screening of recombinant clones, live-cell dynamic sensing of protein&#x2013;protein interactions, and so on (<xref ref-type="bibr" rid="B1">Ahmad et al., 2012</xref>; <xref ref-type="bibr" rid="B25">Mogalisetti and Walt, 2015</xref>). The lacZM15 is a &#x03B2;-galactosidase deletion mutant lacking N-terminal residues 11&#x2013;41. The production of lacZM15 can be induced by the analogs of lactose in specific laboratory strains of <italic>Escherichia coli</italic>, such as Top10, DH5&#x03B1;, and JM109 (<xref ref-type="bibr" rid="B18">Jacobson et al., 1994</xref>). The resultant protein lacZM15, also known as an &#x03B1;-acceptor, is dimeric and inactive. The mechanism of &#x03B1;-complementation most likely involves an initial binding of two &#x03B1;-donor peptides to the lacZM15 dimer, followed by the slow and essentially irreversible formation of active &#x03B2;-galactosidase with a native-like tetramer (<xref ref-type="bibr" rid="B25">Mogalisetti and Walt, 2015</xref>).</p>
<p>Many &#x03B1;-donor peptides with varying lengths have been investigated for &#x03B1;-complementation, and a peptide containing less than 37 residues was required for &#x03B1;-donor activity (<xref ref-type="bibr" rid="B26">Nishiyama et al., 2015</xref>). Excessive redundant sequences may lead to lower expression levels in bacterial cells. However, a short peptide chain may lead to lower stability <italic>in vivo</italic>. It was found that short &#x03B1;-donor peptides were generally degraded very rapidly, while longer &#x03B1;-donor peptides were more stable (<xref ref-type="bibr" rid="B31">Zabin, 1982</xref>; <xref ref-type="bibr" rid="B18">Jacobson et al., 1994</xref>).</p>
<p>Unlike the previous studies, the lacZ&#x03B1; gene was chosen as a reporter gene rather than a full-length &#x03B2;-galactosidase gene in this study. Inductive production of &#x03B1;-donor lacZ&#x03B1; peptide encoded by reporter vectors and &#x03B1;-acceptor lacZM15 encoded in the host genome can be conveniently assembled into an active enzyme in the host cell. LacZ&#x03B1; production-inducing &#x03B2;-galactosidase activity can finally be detected in traditional enzymatic assays. Polypeptide expression always imposes a lower energy consumption on host cells than the full-length protein does. Due to the efficient expression profile resulting from its small size, the detection sensitivity of a lacZ&#x03B1;-derived system was expectedly increased. The improved detection sensitivity makes the lacZ&#x03B1;-derived reporter system a potential tool in the analysis of weak promoter activity.</p>
</sec>
<sec id="S2" sec-type="materials|methods">
<title>Materials and Methods</title>
<sec id="S2.SS1">
<title>Bacterial Strains and Vectors</title>
<p>The <italic>E. coli</italic> strains and plasmids used in this study are listed in <xref ref-type="table" rid="T1">Table 1</xref>. Chemically competent <italic>E. coli</italic> Top 10 was used as a host for the cloning and propagation of plasmids. <italic>E. coli</italic> Top 10 and DH5&#x03B1; were used for induced expression of plasmid-coded red fluorescence protein mCherry, lacZ, and lacZ&#x03B1; peptide. <italic>E. coli</italic> was grown in Lysogeny Broth (LB) (1% w/v tryptone, 0.5% w/v yeast extract, and 1% w/v NaCl) supplemented with 1% w/v glucose and 50 &#x03BC;g/mL ampicillin (Amp), as necessary (<xref ref-type="bibr" rid="B4">Bertani, 2004</xref>). All molecular biology reagents were obtained from TaKaRa (Dalian, China). 5-bromo-4-chloro-3-indolyl-&#x03B2;-D-galactoside (X-gal), Isopropyl-&#x03B2;-D-thiogalactopyranoside (IPTG), 2-Nitrophenyl-&#x03B2;-D-galactopyranoside (ONPG), <sc>L</sc>-arabinose, antibiotics, and lysozyme were purchased from Sangon Biotech (Shanghai, China). Tryptone and yeast extract were obtained from OXOID (Basingstoke, United Kingdom). All chemicals were purchased from Sigma-Aldrich (Indianapolis, United States). All oligonucleotides and some fusion genes were synthesized by Sangon Biotech (Shanghai, China).</p>
<table-wrap position="float" id="T1">
<label>TABLE 1</label>
<caption><p>Bacterial strains and plasmids used in this study.</p></caption>
<table cellspacing="5" cellpadding="5" frame="hsides" rules="groups">
<thead>
<tr>
<td valign="top" align="left"><bold>Strains/plasmids</bold></td>
<td valign="top" align="center"><bold>Genotypes or description</bold></td>
<td valign="top" align="center"><bold>Source</bold></td>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left"><italic>E. coli</italic> Top10</td>
<td valign="top" align="left">F<sup>&#x2013;</sup>, &#x03A6;80<italic>lac</italic>Z&#x0394;M15, &#x0394;<italic>lac</italic>X74, <italic>rec</italic>A1</td>
<td valign="top" align="center">Invitrogen</td>
</tr>
<tr>
<td valign="top" align="left"><italic>E. coli</italic> DH5&#x03B1;</td>
<td valign="top" align="left">F<sup>&#x2013;</sup>, &#x03A6;80<italic>lac</italic>Z&#x0394;M15 &#x0394;(<italic>lac</italic>ZYA-<italic>arg</italic>F), U169, <italic>rec</italic>A1</td>
<td valign="top" align="center">Invitrogen</td>
</tr>
<tr>
<td valign="top" align="left">pBR322</td>
<td valign="top" align="left">Amp<sup>R</sup>, Tet<sup>R</sup>, <italic>ori pMB1</italic>, commonly used <italic>E. coli</italic> cloning vector</td>
<td valign="top" align="center">Novagen</td>
</tr>
<tr>
<td valign="top" align="left">pUCm-T</td>
<td valign="top" align="left">TA cloning</td>
<td valign="top" align="center">Sangon</td>
</tr>
<tr>
<td valign="top" align="left">pBAD</td>
<td valign="top" align="left">Amp<sup>R</sup>, <italic>ori pBR322</italic>, containing <italic>ara</italic>BAD promoter</td>
<td valign="top" align="center">Thermo Fisher Scientific</td>
</tr>
<tr>
<td valign="top" align="left">pT-RFP</td>
<td valign="top" align="left">pUCm-T carrying <italic>mCherry</italic></td>
<td valign="top" align="center"><xref ref-type="bibr" rid="B16">Hui et al.,2018c</xref></td>
</tr>
<tr>
<td valign="top" align="left">pPlac-lacZ&#x03B1;</td>
<td valign="top" align="left">Amp<sup>R</sup>, <italic>ori pMB1</italic>, pBR322 derivative with lacZ&#x03B1; peptide expressing under <italic>lac</italic> promoter</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">pPlac-lacZ</td>
<td valign="top" align="left">pBR322 derivative with &#x03B2;-galactosidase expressing under <italic>lac</italic> promoter</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">pPlac-RFP</td>
<td valign="top" align="left">pBR322 derivative with mCherry protein expressing under <italic>lac</italic> promoter</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">pPara-lacZ&#x03B1;</td>
<td valign="top" align="left">Amp<sup>R</sup>, <italic>ori pMB1</italic>, pBR322 derivative with lacZ&#x03B1; peptide expressing under <italic>ara</italic>BAD promoter</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">pPara-lacZ</td>
<td valign="top" align="left">pBR322 derivative with &#x03B2;-galactosidase expressing under <italic>ara</italic>BAD promoter</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">pPara-RFP</td>
<td valign="top" align="left">pBR322 derivative with mCherry protein expressing under <italic>ara</italic>BAD promoter</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">pT-Ppbr</td>
<td valign="top" align="left">pUCm-T carrying <italic>pbrR</italic> and divergent <italic>pbr</italic> promoter region</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">pPpbr-RFP</td>
<td valign="top" align="left">pPlac-RFP derivative with <italic>pbrR</italic> and <italic>pbr</italic> promoter preceding <italic>mCherry</italic>, a single RFP reporter system</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">pPpbr-lacZ&#x03B1;</td>
<td valign="top" align="left">pPlac-lacZ&#x03B1; derivative with <italic>pbrR</italic> and <italic>pbr</italic> promoter preceding <italic>lacZ&#x03B1;</italic>, a single lacZ&#x03B1; reporter system</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">pPpbr-lacZ</td>
<td valign="top" align="left">pPlac-lacZ&#x03B1; derivative with <italic>pbrR</italic> and <italic>pbr</italic> promoter preceding <italic>lacZ</italic>, a single lacZ reporter system</td>
<td valign="top" align="center">This study</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<attrib><italic>The cloning/expression regions of recombinant plasmids used in this study are shown in <xref ref-type="supplementary-material" rid="SM1">Supplementary Figure S1</xref>.</italic></attrib>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="S2.SS2">
<title>Construction of the <italic>lac</italic> Promoter Reporter Vectors</title>
<p>For cloning purposes, all PCR reactions were carried out for 25 cycles of 2 min at 95&#x00B0;C, 1 min at 50&#x2013;60&#x00B0;C, and 1&#x2013;2 min at 72&#x00B0;C. All primers used in this study are listed in <xref ref-type="table" rid="T2">Table 2</xref>.</p>
<table-wrap position="float" id="T2">
<label>TABLE 2</label>
<caption><p>Oligonucleotides used in this study.</p></caption>
<table cellspacing="5" cellpadding="5" frame="hsides" rules="groups">
<thead>
<tr>
<td valign="top" align="justify"><bold>Name</bold></td>
<td valign="top" align="center"><bold>Sequence 5&#x2032;&#x2013;3&#x2032;</bold></td>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">F-Plac</td>
<td valign="top" align="left">CACACCGCATATGATTAATGCAGCTGGC</td>
</tr>
<tr>
<td valign="top" align="left">R-Plac-RFP</td>
<td valign="top" align="left">CTCGCCTTTAGAGACCATAGCTGTTTCCTG</td>
</tr>
<tr>
<td valign="top" align="left">F-Plac-RFP</td>
<td valign="top" align="left">CAGGAAACAGCTATGGTCTCTAAAGGCGAG</td>
</tr>
<tr>
<td valign="top" align="left">R-RFP-Ter</td>
<td valign="top" align="left">CTGATTTAATCTGTATTATTTGTACAGTTCG</td>
</tr>
<tr>
<td valign="top" align="left">F-RFP-Ter</td>
<td valign="top" align="left">CGAACTGTACAAATAATACAGATTAAATCAG</td>
</tr>
<tr>
<td valign="top" align="left">R-Ter</td>
<td valign="top" align="left">GGAATTCAAGGCCCAGTC</td>
</tr>
<tr>
<td valign="top" align="left">F-Para</td>
<td valign="top" align="left">CACACCGCATATG TTATGACAACTTGACGG</td>
</tr>
<tr>
<td valign="top" align="left">R-Para</td>
<td valign="top" align="left">ACGCGTCGAC AGCCCAAAAAAACG</td>
</tr>
<tr>
<td valign="top" align="left">F-RFP</td>
<td valign="top" align="left">ACGCGTCGAC AGGAGGAATTAACC ATGGTCTCTAAAGGC</td>
</tr>
<tr>
<td valign="top" align="left">F-lacZ&#x03B1;</td>
<td valign="top" align="left">ACGCGTCGAC AGGAGGAATTAACC ATGACCATGATTACGG</td>
</tr>
<tr>
<td valign="top" align="left">F-Ppbr</td>
<td valign="top" align="left">CACACCGCATATGTTACCCAGATG</td>
</tr>
<tr>
<td valign="top" align="left">R-Ppbr-RFP</td>
<td valign="top" align="left">CCTTTAGAGACCATGAGTAACTCC</td>
</tr>
<tr>
<td valign="top" align="left">F-Ppbr-RFP</td>
<td valign="top" align="left">GGAGTTACTCATGGTCTCTAAAGG</td>
</tr>
<tr>
<td valign="top" align="left">R-Ppbr-lacZ&#x03B1;</td>
<td valign="top" align="left">CCGTAATCATGGTCATGAGTAACTCC</td>
</tr>
<tr>
<td valign="top" align="left">F-Ppbr-lacZ&#x03B1;</td>
<td valign="top" align="left">GGAGTTACTCATGACCATGATTACGG</td>
</tr>
<tr>
<td valign="top" align="left">R-Ppbr</td>
<td valign="top" align="left">ACGCGTCGACGAGTAACTCCTG</td>
</tr>
</tbody>
</table></table-wrap>
<p>A cassette containing the <italic>lac</italic> promoter, a lacZ&#x03B1; open reading frame (ORF), and <italic>rrn</italic>B termination region was synthesized by Sangon Biotech (Shanghai, China). The synthesized fragment was then cloned as a <italic>Nde</italic>I/<italic>Eco</italic>RI fragment into pBR322, previously digested with the same enzymes. The resulting plasmid was named pPlac-lacZ&#x03B1;. Another fusion cassette containing the <italic>lac</italic> promoter, a <italic>Sal</italic>I restriction enzyme site, a full-length &#x03B2;-galactosidase lacZ ORF, and <italic>rrn</italic>B terminator was also synthesized. The resulting <italic>Plac</italic>-<italic>lacZ-rrn</italic>B terminator gene fusion cassette was then digested and inserted in pBR322 via <italic>Nde</italic>I and <italic>Eco</italic>RI sites, generating Plac-lacZ.</p>
<p>The pPlac-RFP was constructed through a PCR overlap extension method (<xref ref-type="bibr" rid="B24">Miller et al., 2000</xref>). First, the <italic>lac</italic> promoter region was amplified from pPlac-lacZ&#x03B1; using primers F-Plac and R-Plac-RFP, and <italic>mCherry</italic> was amplified from pT-RFP using primers F-Plac-RFP and R-RFP-Ter. Second, both of the amplified products from the above reactions were added to a second PCR reaction using primers F-Plac and R-RFP-Ter, and the resulting fragment was the <italic>Plac</italic>-<italic>mCherry</italic> cassette. Finally, the <italic>rrn</italic>B terminator was amplified from pPlac-lacZ&#x03B1; using primers F-RFP-Ter and R-Ter. Then the amplified product and the <italic>Plac</italic>-<italic>mCherry</italic> cassette were added to a second PCR reaction using primers F-Plac and R-Ter. The resulting <italic>Plac</italic>-<italic>mCherry</italic>-<italic>rrn</italic>B terminator gene fusion cassette and pBR322 were then digested with <italic>Nde</italic>I and <italic>Eco</italic>RI, and ligated together to generate the plasmid pPlac-RFP.</p>
</sec>
<sec id="S2.SS3">
<title>Construction of the <italic>ara</italic> Promoter Reporter Vectors</title>
<p>The cassette containing the sequence encoding araC and an <italic>ara</italic> promoter region was amplified from pBAD vector using primers F-Para and R-Para. This fragment was then cloned as a <italic>Nde</italic>I and <italic>Sal</italic>I fragment into pPlac-lacZ, previously digested with the same enzymes. The resulting plasmid was named pPara-lacZ. The cassette containing the gene of mCherry and <italic>rrn</italic>B terminator region was amplified from pPlac-RFP using primers F-RFP and R-Ter. The amplified fragment was then cloned as a <italic>Sal</italic>I and <italic>EcoR</italic>I fragment into pPara-lacZ to generate the plasmid pPara-RFP. The cassette containing the gene of lacZ&#x03B1; and <italic>rrn</italic>B terminator region was amplified from pPlac-lacZ&#x03B1; using primers F-lacZ&#x03B1; and R-Ter. The resulting PCR fragment was digested and inserted into pPara-lacZ via <italic>Sal</italic>I and <italic>EcoR</italic>I sites, generating pPara-lacZ&#x03B1;.</p>
<p>The strategy used for detection of <italic>lac</italic> and <italic>ara</italic> promoter activity with different reporter systems is summarized in <xref ref-type="fig" rid="F1">Figure 1</xref>. A 2063 bp <italic>Nde</italic>I-<italic>Eco</italic>RI fragment of plasmid pBR322, which only retains the origin of replication of pMB1, and the gene <italic>bla</italic> encoding the ampicillin resistance (Amp<sup>R</sup>) protein, was chosen to be the cloning vector backbone. All promoter reporter vectors share a common plasmid pBR322 backbone, but contain different promoter reporter cassettes. The target promoter, the ribosome binding site (RBS), a reporter encoding sequence and the terminator (derived from <italic>E. coli rrnB</italic> operon) (<xref ref-type="bibr" rid="B6">Brosius et al., 1981</xref>) were first fused. The resultant fusion cassette and the clone vector backbone were then assembled with restriction enzymes <italic>Nde</italic>I and <italic>Eco</italic>RI to create the reporter vectors.</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption><p>The strategy used for constructing a series of <italic>lac</italic> promoter and <italic>ara</italic> promoter reporter vectors. <bold>(A)</bold> Schematic representation of wild-type &#x03B2;-galactosidase, lacZM15, and lacZ&#x03B1; polypeptides. Five distinct domains of the &#x03B2;-galactosidase monomer (1024 aa) was marked. LacZM15 is a deletion mutant (residues 11&#x2013;41) that maps in the &#x03B1; region. The preferred &#x03B1;-donor peptide lacZ&#x03B1; involved in this study contains wild type residues 1&#x2013;56. &#x03B1;-complemented active &#x03B2;-galactosidase assembled from lacZM15 and lacZ&#x03B1; contains two sets of overlapping sequences, which are segments 1&#x2013;10 and 42&#x2013;56. <bold>(B)</bold> Assembly strategy for the <italic>lac</italic> promoter and <italic>ara</italic> promoter reporter vectors used in the study. Assembly of the desired target promoter, ribosome binding site, a reporter gene (including the encoding sequence for lacZ&#x03B1;, mCherry, or full-length lacZ), and <italic>rrn</italic>B terminator via the genetic methods to construct the reporter cassette. The resulting fusion fragments are then inserted into pBR322 via <italic>Nde</italic>I and <italic>Eco</italic>RI sites.</p></caption>
<graphic xlink:href="fmicb-10-01454-g001.tif"/>
</fig>
</sec>
<sec id="S2.SS4">
<title>Construction of the <italic>pbr</italic> Promoter Reporter Vectors</title>
<p>The <italic>pbr</italic> operon, originating from <italic>Cupriavidus metallidurans</italic> strain CH34, is a unique lead resistance operon (<xref ref-type="bibr" rid="B5">Borremans et al., 2001</xref>; <xref ref-type="bibr" rid="B29">Vandamme and Coenye, 2004</xref>; <xref ref-type="bibr" rid="B14">Hui et al., 2018a</xref>). Based on the natural <italic>pbr</italic> operon, the lead bacterial biosensors have been successfully developed, and the genetic elements of the lead biosensor constructs consist of the transcriptional factor PbrR gene, together with a divergent <italic>pbr</italic> promoter, and a promoterless reporter fluorescent protein gene (<xref ref-type="bibr" rid="B30">Wei et al., 2014</xref>; <xref ref-type="bibr" rid="B3">Bereza-Malcolm et al., 2016</xref>). To test the detection sensitivity of <italic>pbr</italic> promoter activity, pPpbr-RFP, pPpbr-lacZ&#x03B1;, and pPpbr-lacZ were constructed in this study.</p>
<p>The cassette containing the sequence encoding the transcriptor PbrR and the bidirectional <italic>pbr</italic> promoter region was synthesized by Sangon Biotech (Shanghai, China), and the synthesized fragment (520 bp) was cloned into pUCm-T to generate pT-Ppbr. The lacZ&#x03B1; and mCherry <italic>pbr</italic> promoter reporter cassettes were constructed as follows: A lacZ&#x03B1; reporter element and a mCherry reporter element were amplified from pPlac-lacZ&#x03B1;, and pPlac-RFP, respectively, and fused to the genetic element containing <italic>pbrR</italic> and <italic>pbr</italic> promoter by a PCR overlap extension method. Briefly, a lacZ&#x03B1; reporter element was amplified with primers F-Ppbr-lacZ&#x03B1; and R-Ter, and a mCherry reporter element was amplified with primers F-Ppbr-RFP and R-Ter. The genetic element containing <italic>pbrR</italic> and <italic>pbr</italic> promoter was amplified from pT-Ppbr using primers F-Ppbr and either R-Ppbr-lacZ&#x03B1; or R-Ppbr-RFP. Both of the amplified products from pPlac-lacZ&#x03B1; and pT-Ppbr (using primer R-Ppbr-lacZ&#x03B1;) were added to a second PCR reaction containing primers F-Ppbr and R-Ter to generate the Ppbr-lacZ&#x03B1; gene fusion cassette. Similarly, the second round of PCR with primers F-Ppbr and R-Ter was performed after mixing the amplified product from pT-Ppbr (using primer R-Ppbr-RFP) with the amplified product from pPlac-RFP to generate the Ppbr-RFP gene fusion cassette. The two Ppbr reporter cassettes above and pBR322 were finally digested with <italic>Nde</italic>I and <italic>Eco</italic>RI, and ligated together to generate pPpbr-lacZ&#x03B1;, and pPpbr-RFP, respectively. The cassette containing the sequence encoding PbrR and a <italic>pbr</italic> promoter region was amplified from the pT-Ppbr vector using primers F-Ppbr and R-Ppbr. This fragment was then cloned as a <italic>Nde</italic>I and <italic>Sal</italic>I fragment into pPlac-lacZ, previously digested with the same enzymes. The resulting plasmid was named pPpbr-lacZ.</p>
<p>The strategy and potential mechanism involved in three reporter systems are shown in <xref ref-type="fig" rid="F2">Figure 2</xref>. &#x03B2;-galactosidase &#x03B1;-complementation can be achieved by assembling the lead(II) inductive lacZ&#x03B1; derived from the plasmid with the IPTG inductive lacZM15 derived from the host cell genome.</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption><p>Genetic organization of the <italic>pbr</italic> promoter reporter systems. The lead(II) inducible mCherry reporter expression, full-length lacZ reporter expression, and lacZ&#x03B1; reporter expression are achieved in <italic>E. coli</italic> Top10 harboring pPpbr-RFP, pPpbr-lacZ, and pPpbr-lacZ&#x03B1;, respectively. Based on a well-known monocistronic reporter cassette, fluorescent signal and enzymatic activity are detected under Pb(II) induction. LacZ&#x03B1; and lacZM15 are separately synthesized under the control of target <italic>pbr</italic> promoter driven by Pb(II), and host <italic>lac</italic> promoter driven by IPTG. After the active &#x03B2;-galactosidase with a native-like tetramer is finally assembled <italic>in vivo</italic>, a standard chromogenic substrate method can then be used for qualitative and quantitative determination of &#x03B2;-galactosidase activity.</p></caption>
<graphic xlink:href="fmicb-10-01454-g002.tif"/>
</fig>
</sec>
<sec id="S2.SS5">
<title>Reporter Genes Expression</title>
<p><italic>Escherichia coli</italic> hosts were transformed with recombinant vectors using a CaCl<sub>2</sub>-mediated transformation method (<xref ref-type="bibr" rid="B15">Hui et al., 2018b</xref>). The transformed <italic>E. coli</italic> cells were spread onto LB agar plates containing 50 &#x03BC;g/mL ampicillin, and cultured overnight at 37&#x00B0;C. A single colony picked from an agar plate was used to inoculate 3 mL of LB medium supplemented with 50 &#x03BC;g/mL ampicillin in a 15 mL Bio-Reaction tube (Jet, Guangzhou, China), and cultured for 12 h in a 37&#x00B0;C shaking incubator at 200 rpm.</p>
<p>For IPTG-induced reporter genes expression, recombinant <italic>E. coli</italic> harboring the <italic>lac</italic> promoter reporter vectors were cultured in LB medium for 12 h, and diluted to an OD<sub>600</sub> of 0.01 in 12 mL fresh LB medium supplemented with 1% glucose and 50 &#x03BC;g/mL ampicillin in a 50 mL Bio-Reaction tube. The culture was grown at 37&#x00B0;C for 3 h with rotation at 220 rpm, and the bacteria reached log phase with an optical density 0.4 at 600 nm. The cultures were then induced with 0&#x2013;1.0 mM IPTG and incubated at 37&#x00B0;C with shaking at 220 rpm. Induced cultures were sampled and evaluated for the expression of reporter genes at regular intervals.</p>
<p>For arabinose-induced reporter genes expression, recombinant <italic>E. coli</italic> harboring the <italic>ara</italic> promoter reporter vectors were cultured in LB medium for 12 h, and diluted to an OD<sub>600</sub> of 0.01 in 12 mL fresh LB medium supplemented with 50 &#x03BC;g/mL ampicillin plus 0.1 mM IPTG in a 50 mL Bio-Reaction tube. The cultures were grown at 37&#x00B0;C for 3 h with rotation at 220 rpm, and then induced with varying concentrations of arabinose. Induced cultures were incubated at 37&#x00B0;C with shaking at 220 rpm, and tested for the expression of reporter genes at regular intervals.</p>
<p>For Pb(II)-induced reporter genes expression, recombinant <italic>E. coli</italic> harboring the <italic>pbr</italic> promoter reporter vectors were cultured in LB medium for 12 h, and diluted to an OD<sub>600</sub> of 0.01 in 12 mL fresh LB medium supplemented with 50 &#x03BC;g/mL ampicillin in a 50 mL Bio-Reaction tube. The cultures were grown at 37&#x00B0;C for 3 h with rotation at 220 rpm, and then induced with varying concentrations of Pb(II) plus 0.1 mM IPTG. Induced cultures were incubated for 4 h at 37&#x00B0;C with shaking at 220 rpm, sampled and subjected to reporter gene assays.</p>
</sec>
<sec id="S2.SS6">
<title>Enzymatic Assay of &#x03B2;-Galactosidase Using <italic>E. coli</italic> Cell Lysate</title>
<p>An enzymatic assay of &#x03B2;-galactosidase activity using cell lysate was performed and modified as previously described (<xref ref-type="bibr" rid="B28">Tomizawa et al., 2016</xref>). In brief, <italic>E. coli</italic> cells were collected, washed twice with 50 mM phosphate buffer saline (PBS, pH 7.0), and resuspended in 50 mM PBS. After the OD<sub>600</sub> of the resuspended cells was measured, an equal volume of assay solution (1 mg/mL lysozyme, 2 mM X-gal, 200 mM NaCl, 50 mM PBS) was added, vortexed for 2 min, and incubated at 37&#x00B0;C for 30 min. The supernatant was obtained by centrifuging at 3500 rpm for 5 min, and then the absorbance was measured at 630 nm using an iMark microplate reader (Bio-Rad, United States). The background value was obtained from the control assays with uninduced cell lysate, and the optical density at 630 nm was then normalized by the OD<sub>600</sub> value of cell suspensions.</p>
</sec>
<sec id="S2.SS7">
<title>Fluorescence Quantitative Analysis</title>
<p>The fluorescence intensity of mCherry produced in <italic>E. coli</italic> was measured as previously described (<xref ref-type="bibr" rid="B16">Hui et al., 2018c</xref>). Briefly, <italic>E. coli</italic> cells were collected, washed, and resuspended in 50 mM PBS. A 3-mL aliquot of <italic>E. coli</italic> suspension or diluent was added to 1-cm low fluorescence background quartz cuvette. To test the fluorescence intensity of induced mCherry, the excitation wavelength was set at 587 nm and the intensity of emitted fluorescence of mCherry at 610 nm was recorded with Lumina fluorescence spectrometer (Thermo Fisher Scientific, United States). The fluorescence intensity was normalized by dividing the fluorescence intensity at the emission wavelength 610 nm by the OD<sub>600</sub> value of the same sample. The background value was obtained from the control assays with uninduced cell suspensions.</p>
</sec>
<sec id="S2.SS8">
<title>Plate Induction Assay</title>
<p>Single colonies were picked from each construct and inoculated in 3 mL LB medium with 50 &#x03BC;g/mL ampicillin at 37&#x00B0;C for 6 h. The precultured recombinant <italic>E. coli</italic> was plated on LB plate containing optimal concentration of inducer for assay, or no inducer for the control, cultured at 37&#x00B0;C for 18 h. The LB agar was supplemented with 0.6 mM IPTG to induce the transcription of <italic>lac</italic> promoter, 0.002% arabinose plus 0.1 mM IPTG to induce the transcription of <italic>ara</italic> promoter, and 20 &#x03BC;M Pb(II) plus 0.1 mM IPTG to induce the transcription of <italic>pbr</italic> promoter. To examine the expression of reporter lacZ&#x03B1; and LacZ, extra substrate 0.4% X-gal or 0.4% ONPG was also added to LB agar.</p>
</sec>
</sec>
<sec id="S3">
<title>Results and Discussion</title>
<sec id="S3.SS1">
<title>Detection of <italic>lac</italic> Promoter Activity With lacZ&#x03B1; Production-Inducing &#x03B2;-Galactosidase</title>
<p>In order to compare the transcriptional and translational levels of the novel lacZ &#x03B1;-complementation reporter system, the full-length &#x03B2;-galactosidase, and the commonly used fluorescent protein reporter system, a monocistronic lacZ&#x03B1;, lacZ, and mCherry reporter vectors based on an artificial <italic>lac</italic> operon were assembled, and named pPlac-lacZ&#x03B1;, pPlac-lacZ, and pPlac-RFP, respectively.</p>
<p>First, we investigated the response profiles of recombinant <italic>E. coli</italic> Top10 harboring pPlac-lacZ&#x03B1;, pPlac-lacZ, and pPlac-RFP in response to varying concentrations of IPTG. After bacterial cells in logarithmic growth were exposed to 0&#x2013;1.0 mM IPTG for 8 h at 37&#x00B0;C, &#x03B2;-galactosidase activity was assayed in Top10/pPlac-lacZ&#x03B1; and Top10/pPlac-lacZ cultures, and mCherry fluorescent intensity was determined in Top10/pPlac-RFP cultures. The results are shown in <xref ref-type="fig" rid="F3">Figure 3A</xref>. Top10/pPlac-RFP was found to respond to the lowest concentration of IPTG at 0.1 mM. However, even when the concentration of IPTG reached as low as 0.001 mM IPTG, &#x03B2;-galactosidase activity was still detected in both Top10/pPlac-lacZ&#x03B1; and Top10/pPlac-lacZ cultures. With the increase of IPTG concentration, although significantly higher response levels of three reporters were observed, there was no significant difference of &#x03B2;-galactosidase activities in Top10/pPlac-lacZ&#x03B1; and Top10/pPlac-lacZ with 0.001&#x2013;0.2 mM IPTG induction. The highest response levels of Top10/pPlac-lacZ&#x03B1; and Top10/pPlac-lacZ were obtained at about 0.2 mM IPTG, and 0.4 mM IPTG, respectively. The highest response level of Top10/pPlac-RFP was obtained at about 0.6 mM IPTG. The preferred concentration of IPTG was finally determined to be 0.6 mM for the following response time assay.</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption><p>Comparison of <italic>lac</italic> promoter activities in response to IPTG in lacZ&#x03B1;, lacZ, and mCherry reporter systems. <bold>(A)</bold> Response curves of Top10/pPlac-lacZ&#x03B1;, Top10/pPlac-lacZ, and Top10/pPlac-RFP to different concentrations of IPTG. Recombinant <italic>E. coli</italic> was first induced with 0&#x2013;1 mM IPTG at 37&#x00B0;C for 8 h. Then, &#x03B2;-galactosidase activity and mCherry fluorescent signal of induced cultures were determined. <bold>(B)</bold> Time courses of reporter signals in recombinant Top10/pPlac-lacZ&#x03B1;, Top10/pPlac-lacZ, and Top10/pPlac-RFP treated with 0.6 mM IPTG. Recombinant <italic>E. coli</italic> was induced with 0.6 mM IPTG, and &#x03B2;-galactosidase activity and mCherry fluorescent signal of induced cultures were determined at regular time intervals. The data are representative of three independent experiments and expressed as mean &#x00B1; SEM. The optical density at 630 nm and the mCherry fluorescence intensity were all normalized by the OD<sub>600</sub> value of the induced culture.</p></caption>
<graphic xlink:href="fmicb-10-01454-g003.tif"/>
</fig>
<p>Second, response times of Top10/pPlac-lacZ&#x03B1;, Top10/pPlac-lacZ, and Top10/pPlac-RFP were analyzed following exposure to 0.6 mM IPTG. The results are shown in <xref ref-type="fig" rid="F3">Figure 3B</xref>. Cultures were sampled at consecutive time intervals after IPTG exposure. An approximate 3-h delay in the mCherry fluorescent signal was observed in Top10/pPlac-RFP cultures, and the highest fluorescent intensity was obtained at around 6 h. The response times of Top10/pPlac-lacZ&#x03B1; and Top10/pPlac-lacZ were as low as 0.5 h. &#x03B2;-galactosidase activity derived from both lacZ&#x03B1; and wild type lacZ increased with prolongation of the induction time up to 4 h, at which point the enzyme activity reached a maximum. Then, the enzyme activity of Top10/pPlac-lacZ&#x03B1; decreased gradually, and remained at approximately 88% of the maximum at 10 h.</p>
<p>The production of active &#x03B2;-galactosidase depends on the expression of both &#x03B1;-donor lacZ&#x03B1; peptide and &#x03B1;-acceptor lacZM15 protein (<xref ref-type="bibr" rid="B25">Mogalisetti and Walt, 2015</xref>). The inductive expression profile of lacZ&#x03B1; encoded in a reporter vector might be variable in different hosts. To further validate the performance of lacZ&#x03B1; reporter system in different hosts, we examined the response levels of Top10/pPlac-lacZ&#x03B1; and DH5&#x03B1;/pPlac-lacZ&#x03B1; in response to 0.001, 0.01, 0.1, and 1.0 mM IPTG, respectively. IPTG at varying concentrations was added to an exponential phase bacterial culture and incubated for 4 h at 37&#x00B0;C. Interestingly, Top10/pPlac-lacZ&#x03B1; was found to produce significantly higher &#x03B2;-galactosidase activity at all IPTG concentrations examined, in comparison to DH5&#x03B1;/pPlac-lacZ&#x03B1; (<xref ref-type="supplementary-material" rid="SM1">Supplementary Figure S2</xref>). It is well known that the expression of recombinant protein is determined by host genetic background, plasmid copy number, inducer concentration, culture conditions, and so on (<xref ref-type="bibr" rid="B13">Hortsch and Weuster-Botz, 2011</xref>; <xref ref-type="bibr" rid="B22">Mahalik et al., 2014</xref>). <italic>E. coli</italic> Top10 was then chosen as a preferred host for the following tests.</p>
<p>Furthermore, &#x03B2;-galactosidase activity was not elevated above 0.1 mM IPTG induction, and there was no significant difference in the growth curves of Top10/pPlac-lacZ&#x03B1; and DH5&#x03B1;/pPlac-lacZ&#x03B1; with 0&#x2013;0.1 mM IPTG induction (data not shown). Thus, 0.1 mM IPTG was used for the induced expression of lacZM15 in the following promoter activity assays.</p>
</sec>
<sec id="S3.SS2">
<title>A lacZ&#x03B1; Reporter System for Improving Detection Sensitivity of <italic>ara</italic> Promoter Activity</title>
<p>To further determine the potential of lacZ&#x03B1; reporter system in detecting promoter activity using a promoter other than the <italic>lac</italic> promoter, a monocistronic lacZ&#x03B1;, lacZ, and mCherry reporter constructs based on an artificial <italic>ara</italic> operon were assembled.</p>
<p>The response profiles of Top10/pPara-lacZ&#x03B1;, Top10/pPara-lacZ, and Top10/pPara-RFP in response to varying concentrations of inducer arabinose was first determined. After recombinant <italic>E. coli</italic> in logarithmic growth were exposed to 0&#x2013;0.02% arabinose for 8 h at 37&#x00B0;C, &#x03B2;-galactosidase activity and mCherry fluorescent intensity were assayed. As shown in <xref ref-type="fig" rid="F4">Figure 4A</xref>, Top10/pPara-lacZ&#x03B1; was demonstrated to respond to as low as 0.0001% arabinose. With the increase of arabinose concentration, significantly increased response of lacZ&#x03B1; production-inducing &#x03B2;-galactosidase activity was achieved. The highest response level of Top10/pPara-lacZ&#x03B1; was obtained at 0.0006% arabinose. However, Top10/pPara-lacZ and was found to respond to the lowest concentration of arabinose at 0.0002% after 8-h induction. Although the response level of Top10/pPara-lacZ always increased with the increase of arabinose concentration, the response level of full-length lacZ reporter was still significantly lower than that of lacZ&#x03B1; reporter with 0.0001&#x2013;0.002% arabinose induction. Top10/pPara-RFP was found to respond to the lowest concentration of arabinose at 0.0006% after 8-h induction, and the highest response level of Top10/pPara-RFP was obtained at 0.001% arabinose.</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption><p>Comparison of the <italic>ara</italic> promoter activities in response to arabinose in lacZ&#x03B1;, lacZ, and mCherry reporter systems. <bold>(A)</bold> Response curves of Top10/pPara-lacZ&#x03B1;, Top10/pPara-lacZ, and Top10/pPara-RFP to different concentrations of arabinose. Recombinant <italic>E. coli</italic> was induced with 0&#x2013;0.02% arabinose plus 0.1 mM IPTG at 37&#x00B0;C. Then, &#x03B2;-galactosidase activity and mCherry fluorescent signal of induced cultures were determined at 8 h. <bold>(B)</bold> Time courses of reporter signals in recombinant Top10/pPara-lacZ&#x03B1;, Top10/pPara-lacZ, and Top10/pPara-RFP treated with 0.002% arabinose. After recombinant <italic>E. coli</italic> was induced with 0.002% arabinose plus 0.1 mM IPTG, &#x03B2;-galactosidase activity and mCherry fluorescent signal of induced cultures were determined at regular time intervals. The data are representative of three independent experiments, and expressed as mean &#x00B1; SEM. The optical density at 630 nm and mCherry fluorescence intensity were all normalized by the OD<sub>600</sub> value of the induced culture.</p></caption>
<graphic xlink:href="fmicb-10-01454-g004.tif"/>
</fig>
<p>Response times of Top10/pPara-lacZ&#x03B1;, Top10/pPara-lacZ, and Top10/pPara-RFP were analyzed following induction with 0.002% arabinose. The results are shown in <xref ref-type="fig" rid="F4">Figure 4B</xref>. An approximate 2-h delay in the mCherry fluorescent signal was observed in Top10/pPara-RFP, and the highest fluorescent intensity was obtained at 6 h. An approximate 1-h delay in wild type lacZ activity was observed in Top10/pPara-lacZ, and the lacZ activity increased with prolongation of the induction time up to 10 h. Interestingly, nearly no time delay was observed in lacZ&#x03B1; production-inducing &#x03B2;-galactosidase activity. In addition, the response level of lacZ&#x03B1; reporter increased with prolongation of the induction time up to 3 h, at which point the enzyme activity had reached a maximum. Importantly, the response level of lacZ&#x03B1; reporter was always higher than that of full-length lacZ reporter within a 6-h induction, and the biggest difference between the two groups occurred within a 4-h induction.</p>
<p>The inducible pattern of lacZ&#x03B1; reporter is different from a standard lacZ reporter, in which a truncated lacZ&#x03B1; is substituted for a wild type lacZ as a reporter. Importantly, the expression of lacZM15 is independent of the inducible expression of lacZ&#x03B1;. Through &#x03B1;-complementation, lacZ&#x03B1; peptide can be used as a reporter for the target promoter, because &#x03B1;-acceptor lacZM15 is pre-expressed in the host cell in advance. Obviously, induced expression of a small peptide lacZ&#x03B1; would be easier and faster in <italic>E. coli</italic> cells than induced expression of a large-sized lacZ.</p>
</sec>
<sec id="S3.SS3">
<title>Lead(II) Biosensor Using the lacZ&#x03B1; Reporter System for Significantly Enhanced Lead(II) Response</title>
<p>The application of lacZ&#x03B1; reporter system is limited in lacZM15-producing bacteria, and this is its only disadvantage. When a moderately strong <italic>ara</italic> promoter was placed in front of three reporter cassettes, the results above indicate that the most sensitive response was achieved in a lacZ&#x03B1; reporter vector. To examine whether the lacZ&#x03B1;-derived report system can be used to detect low-level transcriptional signals from a weak promoter other than <italic>ara</italic> promoter, a 520 bp fragment containing <italic>pbrR</italic> and <italic>pbr</italic> promoter was placed in front of promoterless mCherry, lacZ, and lacZ&#x03B1; reporter cassettes. The <italic>pbr</italic> promoter activity was then evaluated by assays of both mCherry and &#x03B2;-galactosidase activity. <italic>E. coli</italic> transformed with Ppbr-RFP, Ppbr-lacZ, and Ppbr-lacZ&#x03B1; showed increased signals in response to elevated concentrations of Pb(II). The results are shown in <xref ref-type="fig" rid="F5">Figure 5</xref>.</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption><p>Assay of the <italic>pbr</italic> promoter activities in response to lead(II). <bold>(A)</bold> The response of Top10/pPpbr-RFP to different concentrations of Pb(II) plus 0.1 mM IPTG after 4 h incubation at 37&#x00B0;C. <sup>*</sup>A significant increase (<italic>t</italic>-test, <italic>P</italic> &#x003C; 0.05) in the reported signal, in comparison to the same recombinant bacteria with no Pb(II) exposure. <bold>(B)</bold> The response of Top10/pPpbr-lacZ&#x03B1; and Top10/pPpbr-lacZ to different concentrations of Pb(II) plus 0.1 mM IPTG after 4 h incubation at 37&#x00B0;C. <sup>*</sup>A significant increase (<italic>t</italic>-test, <italic>P</italic> &#x003C; 0.05) between Top10/pPpbr-lacZ&#x03B1; and Top10/pPpbr-lacZ. The optical density at 630 nm and mCherry fluorescence intensity were all normalized by the OD<sub>600</sub> value of the induced culture. The data are representative of three independent experiments, and expressed as mean &#x00B1; SEM.</p></caption>
<graphic xlink:href="fmicb-10-01454-g005.tif"/>
</fig>
<p>Recombinant Top10/pPpbr-RFP, Top10/pPpbr-lacZ&#x03B1;, and Top10/pPpbr-lacZ in logarithmic growth were exposed to varying concentrations of Pb(II) plus 0.1 mM IPTG for 4 h at 37&#x00B0;C. Top10/pPpbr-RFP, a lead biosensor with a single mCherry reporter system, detected 15 &#x03BC;M Pb(II) (<xref ref-type="fig" rid="F5">Figure 5A</xref>). This result was basically consistent with previous findings (<xref ref-type="bibr" rid="B3">Bereza-Malcolm et al., 2016</xref>). However, the lacZ&#x03B1; peptide, like full-length lacZ, was demonstrated to be a much more sensitive reporter to detect low transcriptional activity. Both Top10/pPpbr-lacZ&#x03B1; and Top10/pPpbr-lacZ were demonstrated to respond to concentrations as low as 3 &#x03BC;M Pb(II) (<xref ref-type="fig" rid="F5">Figure 5B</xref>). It is worth mentioning that the responses from both lacZ&#x03B1; and lacZ report systems were associated with Pb(II) exposure in a dose-response manner, and lacZ&#x03B1; production-inducing &#x03B2;-galactosidase activity was significant higher than wild type &#x03B2;-galactosidase activity with 3&#x2013;10 &#x03BC;M Pb(II) induction. However, no significantly higher response from the mCherry reporter system was observed with the increase of Pb(II) in the study. These results suggest that even a weak promoter with very poor transcriptional activity may still be detected with a lacZ&#x03B1;-derived reporter system.</p>
</sec>
<sec id="S3.SS4">
<title>A lacZ&#x03B1;-Derived Reporter System Can Be Conveniently Observed in a Plate Assay</title>
<p>The activity of a target promoter in response to an inducer can be quantified in the liquid media. Moreover, like the expression of mCherry and wild type &#x03B2;-galactosidase, the activation of &#x03B2;-galactosidase in lacZ&#x03B1;-derived reporter systems could also be clearly observed with the naked eye in a plate assay (<xref ref-type="fig" rid="F6">Figure 6</xref>). Both X-gal and ONPG could be used as substrates for the chromogenic reaction to indicate the production of active &#x03B2;-galactosidase.</p>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption><p>Expression of the three reporters in recombinant <italic>E. coli</italic> Top10. The strains harboring the <italic>lac</italic>, <italic>ara</italic>, and <italic>pbr</italic> promoter reporter systems presented &#x03B2;-galactosidase <bold>(A,B)</bold> or mCherry signal <bold>(C)</bold> when cultured in the presence of 0.06 mM IPTG, 0.002% arabinose plus 0.1 mM IPTG, and 20 mM Pb(II) plus 0.1 mM IPTG, respectively. Extra substrate, 0.4% X-gal or 0.4% ONPG, was added to LB plate for the detection of &#x03B2;-galactosidase activity.</p></caption>
<graphic xlink:href="fmicb-10-01454-g006.tif"/>
</fig>
</sec>
</sec>
<sec id="S4">
<title>Conclusion</title>
<p>Enzyme fragment complementation has been used as a selection marker for the rapid detection of recombinant bacteria, protein-protein interaction, high throughput screenings, and so on. In the current study, &#x03B2;-galactosidase &#x03B1;-complementation proves to be a novel tool for transcription monitoring in <italic>E. coli</italic> for the first time. The variable production of lacZ&#x03B1;, a small fragment of &#x03B2;-galactosidase, is driven by the detection promoter, and the expression of an inactive lacZ deletion mutant is independently driven by a natural <italic>lac</italic> promoter located in the host genome. The resultant stable heteromeric enzyme complex can be easily detected using a chromogenic substrate, X-gal, which forms an intense blue precipitate when hydrolyzed. A <italic>lac</italic> promoter was first chosen as target promoter. As expected, when the expression of both &#x03B1;-donor lacZ&#x03B1; and &#x03B1;-acceptor lacZM15 were all under the control of the <italic>lac</italic> promoter, there was no significant difference of &#x03B2;-galactosidase activities between the lacZ&#x03B1; reporter system and wild type lacZ reporter system. A moderately strong <italic>ara</italic> promoter was then chosen to be the detection promoter. Owing to its small size, the response of the lacZ&#x03B1;-derived system was significantly more sensitive and higher than that of the wild type lacZ reporter system and commonly used mCherry reporter system. A weak <italic>pbr</italic> promoter was finally chosen to be the detection promoter. Due to the efficient expression profile of lacZ&#x03B1; peptide, the response sensitivity of lacZ&#x03B1;-derived system was demonstrated to be significantly higher than that of both wild type lacZ and mCherry-derived system. This study suggests that lacZ&#x03B1;-derived reporter systems have numerous potential applications for monitoring low-level transcription in <italic>E. coli</italic>.</p>
</sec>
<sec id="S5">
<title>Data Availability</title>
<p>The raw data supporting the conclusions of this manuscript will be made available by the authors, without undue reservation, to any qualified researcher.</p>
</sec>
<sec id="S6">
<title>Author Contributions</title>
<p>C-YH designed the experimental protocol and drafted the manuscript. YG, H-QZ, and H-MW carried out the majority of the study. LL analyzed the data and corrected the manuscript. All authors read and approved the final manuscript.</p>
</sec>
<sec id="conf1">
<title>Conflict of Interest Statement</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
</body>
<back>
<fn-group>
<fn fn-type="financial-disclosure">
<p><bold>Funding.</bold> This work was supported by the Science and Technology Program of Shenzhen (JCYJ20180306170237563) and the Natural Science Foundation of Guangdong Province (2015A030313838).</p>
</fn>
</fn-group>
<sec id="S8" sec-type="supplementary material"><title>Supplementary Material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fmicb.2019.01454/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fmicb.2019.01454/full#supplementary-material</ext-link></p>
<supplementary-material xlink:href="Data_Sheet_1.docx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document" xmlns:xlink="http://www.w3.org/1999/xlink"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ahmad</surname> <given-names>J.</given-names></name> <name><surname>Dwivedi</surname> <given-names>S.</given-names></name> <name><surname>Alarifi</surname> <given-names>S.</given-names></name> <name><surname>Al-Khedhairy</surname> <given-names>A. A.</given-names></name> <name><surname>Musarrat</surname> <given-names>J.</given-names></name></person-group> (<year>2012</year>). <article-title>Use of beta-galactosidase (lacZ) gene alpha-complementation as a novel approach for assessment of titanium oxide nanoparticles induced mutagenesis.</article-title> <source><italic>Mutat. Res.</italic></source> <volume>747</volume> <fpage>246</fpage>&#x2013;<lpage>252</lpage>. <pub-id pub-id-type="doi">10.1016/j.mrgentox.2012.06.002</pub-id> <pub-id pub-id-type="pmid">22705419</pub-id></citation></ref>
<ref id="B2"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Asanuma</surname> <given-names>D.</given-names></name> <name><surname>Sakabe</surname> <given-names>M.</given-names></name> <name><surname>Kamiya</surname> <given-names>M.</given-names></name> <name><surname>Yamamoto</surname> <given-names>K.</given-names></name> <name><surname>Hiratake</surname> <given-names>J.</given-names></name> <name><surname>Ogawa</surname> <given-names>M.</given-names></name><etal/></person-group> (<year>2015</year>). <article-title>Sensitive beta-galactosidase-targeting fluorescence probe for visualizing small peritoneal metastatic tumours in vivo.</article-title> <source><italic>Nat. Commun.</italic></source> <volume>6</volume>:<issue>6463</issue>. <pub-id pub-id-type="doi">10.1038/ncomms7463</pub-id> <pub-id pub-id-type="pmid">25765713</pub-id></citation></ref>
<ref id="B3"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Bereza-Malcolm</surname> <given-names>L.</given-names></name> <name><surname>Aracic</surname> <given-names>S.</given-names></name> <name><surname>Franks</surname> <given-names>A. E.</given-names></name></person-group> (<year>2016</year>). <article-title>Development and application of a synthetically-derived lead biosensor construct for use in Gram-Negative bacteria.</article-title> <source><italic>Sensors</italic></source> <volume>16</volume>:<issue>2174</issue>. <pub-id pub-id-type="doi">10.3390/s16122174</pub-id> <pub-id pub-id-type="pmid">27999352</pub-id></citation></ref>
<ref id="B4"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Bertani</surname> <given-names>G.</given-names></name></person-group> (<year>2004</year>). <article-title>Lysogeny at mid-twentieth century: P1, P2, and other experimental systems.</article-title> <source><italic>J. Bacteriol.</italic></source> <volume>186</volume> <fpage>595</fpage>&#x2013;<lpage>600</lpage>.</citation></ref>
<ref id="B5"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Borremans</surname> <given-names>B.</given-names></name> <name><surname>Hobman</surname> <given-names>J. L.</given-names></name> <name><surname>Provoost</surname> <given-names>A.</given-names></name> <name><surname>Brown</surname> <given-names>N. L.</given-names></name> <name><surname>Van Der Lelie</surname> <given-names>D.</given-names></name></person-group> (<year>2001</year>). <article-title>Cloning and functional analysis of the pbr lead resistance determinant of <italic>Ralstonia metallidurans</italic> CH34.</article-title> <source><italic>J. Bacteriol.</italic></source> <volume>183</volume> <fpage>5651</fpage>&#x2013;<lpage>5658</lpage>. <pub-id pub-id-type="pmid">11544228</pub-id></citation></ref>
<ref id="B6"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Brosius</surname> <given-names>J.</given-names></name> <name><surname>Dull</surname> <given-names>T. J.</given-names></name> <name><surname>Sleeter</surname> <given-names>D. D.</given-names></name> <name><surname>Noller</surname> <given-names>H. F.</given-names></name></person-group> (<year>1981</year>). <article-title>Gene organization and primary structure of a ribosomal RNA operon from <italic>Escherichia coli</italic>.</article-title> <source><italic>J. Mol. Biol.</italic></source> <volume>148</volume> <fpage>107</fpage>&#x2013;<lpage>127</lpage>.</citation></ref>
<ref id="B7"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Carter</surname> <given-names>K. P.</given-names></name> <name><surname>Young</surname> <given-names>A. M.</given-names></name> <name><surname>Palmer</surname> <given-names>A. E.</given-names></name></person-group> (<year>2014</year>). <article-title>Fluorescent sensors for measuring metal ions in living systems.</article-title> <source><italic>Chem. Rev.</italic></source> <volume>114</volume> <fpage>4564</fpage>&#x2013;<lpage>4601</lpage>.</citation></ref>
<ref id="B8"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Cases</surname> <given-names>I.</given-names></name> <name><surname>De Lorenzo</surname> <given-names>V.</given-names></name> <name><surname>Ouzounis</surname> <given-names>C. A.</given-names></name></person-group> (<year>2003</year>). <article-title>Transcription regulation and environmental adaptation in bacteria.</article-title> <source><italic>Trends Microbiol.</italic></source> <volume>11</volume> <fpage>248</fpage>&#x2013;<lpage>253</lpage>. <pub-id pub-id-type="pmid">12823939</pub-id></citation></ref>
<ref id="B9"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Duttweiler</surname> <given-names>H. M.</given-names></name></person-group> (<year>1996</year>). <article-title>A highly sensitive and non-lethal beta-galactosidase plate assay for yeast.</article-title> <source><italic>Trends Genet.</italic></source> <volume>12</volume> <fpage>340</fpage>&#x2013;<lpage>341</lpage>.</citation></ref>
<ref id="B10"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Flores-Sandoval</surname> <given-names>E.</given-names></name> <name><surname>Eklund</surname> <given-names>D. M.</given-names></name> <name><surname>Bowman</surname> <given-names>J. L.</given-names></name></person-group> (<year>2015</year>). <article-title>A simple auxin transcriptional response system regulates multiple morphogenetic processes in the liverwort <italic>Marchantia polymorpha</italic>.</article-title> <source><italic>PLoS Genet.</italic></source> <volume>11</volume>:<issue>e1005207</issue>. <pub-id pub-id-type="doi">10.1371/journal.pgen.1005207</pub-id> <pub-id pub-id-type="pmid">26020649</pub-id></citation></ref>
<ref id="B11"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Fuxman Bass</surname> <given-names>J. I.</given-names></name> <name><surname>Reece-Hoyes</surname> <given-names>J. S.</given-names></name> <name><surname>Walhout</surname> <given-names>A. J.</given-names></name></person-group> (<year>2016</year>). <article-title>Colony lift colorimetric assay for beta-galactosidase activity.</article-title> <source><italic>Cold Spring Harb. Protoc.</italic></source> <volume>2016</volume>:<issue>pdb.prot088963</issue>. <pub-id pub-id-type="doi">10.1101/pdb.prot088963</pub-id> <pub-id pub-id-type="pmid">27934685</pub-id></citation></ref>
<ref id="B12"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Gu</surname> <given-names>K.</given-names></name> <name><surname>Xu</surname> <given-names>Y.</given-names></name> <name><surname>Li</surname> <given-names>H.</given-names></name> <name><surname>Guo</surname> <given-names>Z.</given-names></name> <name><surname>Zhu</surname> <given-names>S.</given-names></name> <name><surname>Zhu</surname> <given-names>S.</given-names></name><etal/></person-group> (<year>2016</year>). <article-title>Real-time tracking and in vivo visualization of beta-galactosidase activity in colorectal tumor with a ratiometric near-infrared fluorescent probe.</article-title> <source><italic>J. Am. Chem. Soc.</italic></source> <volume>138</volume> <fpage>5334</fpage>&#x2013;<lpage>5340</lpage>. <pub-id pub-id-type="doi">10.1021/jacs.6b01705</pub-id> <pub-id pub-id-type="pmid">27054782</pub-id></citation></ref>
<ref id="B13"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Hortsch</surname> <given-names>R.</given-names></name> <name><surname>Weuster-Botz</surname> <given-names>D.</given-names></name></person-group> (<year>2011</year>). <article-title>Growth and recombinant protein expression with <italic>Escherichia coli</italic> in different batch cultivation media.</article-title> <source><italic>Appl. Microbiol. Biotechnol.</italic></source> <volume>90</volume> <fpage>69</fpage>&#x2013;<lpage>76</lpage>. <pub-id pub-id-type="doi">10.1007/s00253-010-3036-y</pub-id> <pub-id pub-id-type="pmid">21181153</pub-id></citation></ref>
<ref id="B14"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Hui</surname> <given-names>C.</given-names></name> <name><surname>Guo</surname> <given-names>Y.</given-names></name> <name><surname>Zhang</surname> <given-names>W.</given-names></name> <name><surname>Gao</surname> <given-names>C.</given-names></name> <name><surname>Yang</surname> <given-names>X.</given-names></name> <name><surname>Chen</surname> <given-names>Y.</given-names></name><etal/></person-group> (<year>2018a</year>). <article-title>Surface display of PbrR on <italic>Escherichia coli</italic> and evaluation of the bioavailability of lead associated with engineered cells in mice.</article-title> <source><italic>Sci. Rep.</italic></source> <volume>8</volume>:<issue>5685</issue>. <pub-id pub-id-type="doi">10.1038/s41598-018-24134-3</pub-id> <pub-id pub-id-type="pmid">29632327</pub-id></citation></ref>
<ref id="B15"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Hui</surname> <given-names>C. Y.</given-names></name> <name><surname>Guo</surname> <given-names>Y.</given-names></name> <name><surname>Yang</surname> <given-names>X. Q.</given-names></name> <name><surname>Zhang</surname> <given-names>W.</given-names></name> <name><surname>Huang</surname> <given-names>X. Q.</given-names></name></person-group> (<year>2018b</year>). <article-title>Surface display of metal binding domain derived from PbrR on <italic>Escherichia coli</italic> specifically increases lead(II) adsorption.</article-title> <source><italic>Biotechnol. Lett.</italic></source> <volume>40</volume> <fpage>837</fpage>&#x2013;<lpage>845</lpage>. <pub-id pub-id-type="doi">10.1007/s10529-018-2533-4</pub-id> <pub-id pub-id-type="pmid">29605936</pub-id></citation></ref>
<ref id="B16"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Hui</surname> <given-names>C. Y.</given-names></name> <name><surname>Guo</surname> <given-names>Y.</given-names></name> <name><surname>Zhang</surname> <given-names>W.</given-names></name> <name><surname>Huang</surname> <given-names>X. Q.</given-names></name></person-group> (<year>2018c</year>). <article-title>Rapid monitoring of the target protein expression with a fluorescent signal based on a dicistronic construct in <italic>Escherichia coli</italic>.</article-title> <source><italic>AMB Express</italic></source> <volume>8</volume>:<issue>81</issue>. <pub-id pub-id-type="doi">10.1186/s13568-018-0612-5</pub-id> <pub-id pub-id-type="pmid">29785487</pub-id></citation></ref>
<ref id="B17"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Hui</surname> <given-names>C. Y.</given-names></name> <name><surname>Guo</surname> <given-names>Y.</given-names></name> <name><surname>Liu</surname> <given-names>L.</given-names></name> <name><surname>Zheng</surname> <given-names>H. Q.</given-names></name> <name><surname>Wu</surname> <given-names>H. M.</given-names></name> <name><surname>Zhang</surname> <given-names>L. Z.</given-names></name><etal/></person-group> (<year>2019</year>). <article-title>Development of a novel bacterial surface display system using truncated OmpT as an anchoring motif.</article-title> <source><italic>Biotechnol. Lett.</italic></source> <volume>41</volume> <fpage>763</fpage>&#x2013;<lpage>777</lpage>. <pub-id pub-id-type="doi">10.1007/s10529-019-02676-4</pub-id> <pub-id pub-id-type="pmid">31025146</pub-id></citation></ref>
<ref id="B18"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Jacobson</surname> <given-names>R. H.</given-names></name> <name><surname>Zhang</surname> <given-names>X. J.</given-names></name> <name><surname>Dubose</surname> <given-names>R. F.</given-names></name> <name><surname>Matthews</surname> <given-names>B. W.</given-names></name></person-group> (<year>1994</year>). <article-title>Three-dimensional structure of beta-galactosidase from <italic>E. coli</italic>.</article-title> <source><italic>Nature</italic></source> <volume>369</volume> <fpage>761</fpage>&#x2013;<lpage>766</lpage>. <pub-id pub-id-type="pmid">8008071</pub-id></citation></ref>
<ref id="B19"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Kawano</surname> <given-names>M.</given-names></name> <name><surname>Storz</surname> <given-names>G.</given-names></name> <name><surname>Rao</surname> <given-names>B. S.</given-names></name> <name><surname>Rosner</surname> <given-names>J. L.</given-names></name> <name><surname>Martin</surname> <given-names>R. G.</given-names></name></person-group> (<year>2005</year>). <article-title>Detection of low-level promoter activity within open reading frame sequences of <italic>Escherichia coli</italic>.</article-title> <source><italic>Nucleic Acids Res.</italic></source> <volume>33</volume> <fpage>6268</fpage>&#x2013;<lpage>6276</lpage>. <pub-id pub-id-type="pmid">16260475</pub-id></citation></ref>
<ref id="B20"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Kita</surname> <given-names>H.</given-names></name> <name><surname>Matsuura</surname> <given-names>T.</given-names></name> <name><surname>Sunami</surname> <given-names>T.</given-names></name> <name><surname>Hosoda</surname> <given-names>K.</given-names></name> <name><surname>Ichihashi</surname> <given-names>N.</given-names></name> <name><surname>Tsukada</surname> <given-names>K.</given-names></name><etal/></person-group> (<year>2008</year>). <article-title>Replication of genetic information with self-encoded replicase in liposomes.</article-title> <source><italic>Chembiochem</italic></source> <volume>9</volume> <fpage>2403</fpage>&#x2013;<lpage>2410</lpage>. <pub-id pub-id-type="doi">10.1002/cbic.200800360</pub-id> <pub-id pub-id-type="pmid">18785673</pub-id></citation></ref>
<ref id="B21"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Magrisso</surname> <given-names>S.</given-names></name> <name><surname>Erel</surname> <given-names>Y.</given-names></name> <name><surname>Belkin</surname> <given-names>S.</given-names></name></person-group> (<year>2008</year>). <article-title>Microbial reporters of metal bioavailability.</article-title> <source><italic>Microb. Biotechnol.</italic></source> <volume>1</volume> <fpage>320</fpage>&#x2013;<lpage>330</lpage>. <pub-id pub-id-type="doi">10.1111/j.1751-7915.2008.00022.x</pub-id> <pub-id pub-id-type="pmid">21261850</pub-id></citation></ref>
<ref id="B22"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Mahalik</surname> <given-names>S.</given-names></name> <name><surname>Sharma</surname> <given-names>A. K.</given-names></name> <name><surname>Mukherjee</surname> <given-names>K. J.</given-names></name></person-group> (<year>2014</year>). <article-title>Genome engineering for improved recombinant protein expression in <italic>Escherichia coli</italic>.</article-title> <source><italic>Microb. Cell Fact.</italic></source> <volume>13</volume>:<issue>177</issue>. <pub-id pub-id-type="doi">10.1186/s12934-014-0177-1</pub-id> <pub-id pub-id-type="pmid">25523647</pub-id></citation></ref>
<ref id="B23"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Martinez-Antonio</surname> <given-names>A.</given-names></name> <name><surname>Collado-Vides</surname> <given-names>J.</given-names></name></person-group> (<year>2003</year>). <article-title>Identifying global regulators in transcriptional regulatory networks in bacteria.</article-title> <source><italic>Curr. Opin. Microbiol.</italic></source> <volume>6</volume> <fpage>482</fpage>&#x2013;<lpage>489</lpage>. <pub-id pub-id-type="pmid">14572541</pub-id></citation></ref>
<ref id="B24"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Miller</surname> <given-names>W. G.</given-names></name> <name><surname>Leveau</surname> <given-names>J. H.</given-names></name> <name><surname>Lindow</surname> <given-names>S. E.</given-names></name></person-group> (<year>2000</year>). <article-title>Improved gfp and inaZ broad-host-range promoter-probe vectors.</article-title> <source><italic>Mol. Plant Microbe Interact.</italic></source> <volume>13</volume> <fpage>1243</fpage>&#x2013;<lpage>1250</lpage>. <pub-id pub-id-type="pmid">11059491</pub-id></citation></ref>
<ref id="B25"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Mogalisetti</surname> <given-names>P.</given-names></name> <name><surname>Walt</surname> <given-names>D. R.</given-names></name></person-group> (<year>2015</year>). <article-title>Stoichiometry of the alpha-complementation reaction of <italic>Escherichia coli</italic> beta-galactosidase as revealed through single-molecule studies.</article-title> <source><italic>Biochemistry</italic></source> <volume>54</volume> <fpage>1583</fpage>&#x2013;<lpage>1588</lpage>. <pub-id pub-id-type="doi">10.1021/bi5015024</pub-id> <pub-id pub-id-type="pmid">25668156</pub-id></citation></ref>
<ref id="B26"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Nishiyama</surname> <given-names>K.</given-names></name> <name><surname>Ichihashi</surname> <given-names>N.</given-names></name> <name><surname>Kazuta</surname> <given-names>Y.</given-names></name> <name><surname>Yomo</surname> <given-names>T.</given-names></name></person-group> (<year>2015</year>). <article-title>Development of a reporter peptide that catalytically produces a fluorescent signal through alpha-complementation.</article-title> <source><italic>Protein Sci.</italic></source> <volume>24</volume> <fpage>599</fpage>&#x2013;<lpage>603</lpage>. <pub-id pub-id-type="doi">10.1002/pro.2667</pub-id> <pub-id pub-id-type="pmid">25740628</pub-id></citation></ref>
<ref id="B27"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Seeber</surname> <given-names>F.</given-names></name> <name><surname>Boothroyd</surname> <given-names>J. C.</given-names></name></person-group> (<year>1996</year>). <article-title><italic>Escherichia coli</italic> beta-galactosidase as an in vitro and in vivo reporter enzyme and stable transfection marker in the intracellular protozoan parasite <italic>Toxoplasma gondii</italic>.</article-title> <source><italic>Gene</italic></source> <volume>169</volume> <fpage>39</fpage>&#x2013;<lpage>45</lpage>. <pub-id pub-id-type="pmid">8635747</pub-id></citation></ref>
<ref id="B28"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Tomizawa</surname> <given-names>M.</given-names></name> <name><surname>Tsumaki</surname> <given-names>K.</given-names></name> <name><surname>Sone</surname> <given-names>M.</given-names></name></person-group> (<year>2016</year>). <article-title>Characterization of the activity of beta-galactosidase from <italic>Escherichia coli</italic> and <italic>Drosophila melanogaster</italic> in fixed and non-fixed Drosophila tissues.</article-title> <source><italic>Biochim. Open</italic></source> <volume>3</volume> <fpage>1</fpage>&#x2013;<lpage>7</lpage>. <pub-id pub-id-type="doi">10.1016/j.biopen.2016.06.001</pub-id> <pub-id pub-id-type="pmid">29450125</pub-id></citation></ref>
<ref id="B29"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Vandamme</surname> <given-names>P.</given-names></name> <name><surname>Coenye</surname> <given-names>T.</given-names></name></person-group> (<year>2004</year>). <article-title>Taxonomy of the genus <italic>Cupriavidus</italic>: a tale of lost and found.</article-title> <source><italic>Int. J. Syst. Evol. Microbiol.</italic></source> <volume>54</volume> <fpage>2285</fpage>&#x2013;<lpage>2289</lpage>. <pub-id pub-id-type="pmid">15545472</pub-id></citation></ref>
<ref id="B30"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Wei</surname> <given-names>W.</given-names></name> <name><surname>Liu</surname> <given-names>X.</given-names></name> <name><surname>Sun</surname> <given-names>P.</given-names></name> <name><surname>Wang</surname> <given-names>X.</given-names></name> <name><surname>Zhu</surname> <given-names>H.</given-names></name> <name><surname>Hong</surname> <given-names>M.</given-names></name><etal/></person-group> (<year>2014</year>). <article-title>Simple whole-cell biodetection and bioremediation of heavy metals based on an engineered lead-specific operon.</article-title> <source><italic>Environ. Sci. Technol.</italic></source> <volume>48</volume> <fpage>3363</fpage>&#x2013;<lpage>3371</lpage>. <pub-id pub-id-type="doi">10.1021/es4046567</pub-id> <pub-id pub-id-type="pmid">24564581</pub-id></citation></ref>
<ref id="B31"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zabin</surname> <given-names>I.</given-names></name></person-group> (<year>1982</year>). <article-title>beta-Galactosidase alpha-complementation. A model of protein-protein interaction.</article-title> <source><italic>Mol. Cell Biochem.</italic></source> <volume>49</volume> <fpage>87</fpage>&#x2013;<lpage>96</lpage>. <pub-id pub-id-type="pmid">6818452</pub-id></citation></ref>
</ref-list>
</back>
</article>