This study was carried out in accordance with the recommendations of “Institutional Animal Ethical Committee” of the Rajendra Memorial Research Institute of Medical Sciences (Patna, India). The protocol was also approved by the “Institutional Animal Ethical Committee” of the Rajendra Memorial Research Institute of Medical Sciences (Patna, India, Ref No. 364/GO/R/S/2001/CPCSEA).

Female BALB/c mice of age 6–8 weeks were used in this study. The animals were kept in polypropylene cages and bedding material was chopped wheat straw with the temperature around 20–30°C. All the experimental mice were fed a standard chow and water ad libitum.

A cloned line of L. donovani strain (AG83) was used in this study. The motile form of promastigotes was cultured in complete Dulbecco’s Modified Eagle Medium (DMEM, pH 7.2; Gibco, United States), which contained 10% heat-inactivated fetal bovine serum (FBS; Gibco, United States), 2 mM L-glutamine, sodium bicarbonate (3.7 gm/L), penicillin (100 U/mL), streptomycin (100 μg/mL), and gentamicin (20 μg/mL) at 26°C in a BOD incubator. In all stages of experiments, metacyclic promastigotes were used and obtained from late log phage to stationary stage using standard protocol (Späth and Beverley, 2001).

A 4% starch solution was injected to peritoneal cavity of mice and after 48 h macrophages were isolated by standard protocol. Cells were thoroughly washed and suspended in RPMI medium supplemented with 10% FBS and antibiotics. Further, macrophages (10⁶ cells per well) were plated in six well culture plates and incubated in CO₂ incubator in 5% CO₂ atmosphere. After overnight incubation, the non-adherent cells were removed and fresh medium was added to each wells.

The macrophages were infected with Leishmania parasites for 6 h at a cells/parasite ratio of 1:10. After 6 h, the unbound parasites were removed by washing with RPMI without FBS and incubated up to 24 h as per our experimental conditions. The cells were then fixed with formaldehyde followed by staining with May-Grünwald Giemsa and observation under bright field microscope at 100× with oil immersion objective.

We evaluated the expression of HIF-1α mRNA in L. donovani infected and uninfected macrophages by semi-quantitative PCR and further validated by real-time PCR (ABI 7500, Applied Biosystem) using HIF-1α specific primers. The cycling conditions for qPCR were as follows: 1 cycle at 95°C for 3 min and 40 cycles of 95°C for 15 s (denaturation), 56°C for 30 s (annealing), and 72°C for 30 s (extension). Results are the target/reference ratios of each sample, normalized by the target/reference ratio of the calibrator. Here, the target/reference values of uninfected macrophages were used as the calibrator and the GAPDH was used as the reference.

Pimonidazole is a novel marker for confirmation of cellular hypoxia (Varia et al., 1998). The cellular hypoxia was estimated by detection of pimonidazole adducts by western blotting using Hypoxyprobe^TM-1 kit (Hypoxyprobe-1, Chemicon). Briefly, 250 μM of pimonidazole hydrochloride was added to L. donovani infected and uninfected macrophage culture. After 24 h, proteins were isolated from macrophages and quantified by Lowry’s method (Lowry et al., 1951). The protein (40 μg/lane) was then subjected to SDS–PAGE and transferred on to the nitrocellulose membrane. Further, protein bands on membrane were blocked by TBST buffer with [5% (w/v) non-fat dry milk containing 0.1% (v/v) Tween20] for 2 h. After three times washing the membrane with TBST buffer, membrane was incubated with mouse anti-pimonidazole antibody diluted 1:50 (Chemicon) for 2 h at room temperature (RT). After routine wash with TBST, membrane was incubated with horseradish peroxidase-conjugated secondary antibody, diluted in the ratio of 1:400 for 2 h. Protein bands on the blot were developed by 0.03% (v/v) DAB, 0.01% (v/v) H₂O₂ solution. β-actin was used as house-keeping protein.

Small RNA library preparation, TruSeq small RNA library preparation, and miRNAs’ expression are reported in our previous study (Tiwari et al., 2017). In this study, we selected differentially expressed upregulated and downregulated miRNAs for real-time validation. For real-time validation, total RNA was isolated using TRIzol method and quantified by Nanodrop spectrophotometer and cDNA was prepared using miRNA specific primers and following the standard protocol. Briefly, 1 μg of total RNA was taken and reverse transcribed using 20U M-MLV reverse transcriptase (Fermentas, Germany), 1× RT buffer, 20 mM dNTPs (New England Biolabs, United States), 20U RNasin (Fermentas, Germany), 100 ng of random hexamers (Fermentas, Germany), 0.1 M DTT, and DEPC treated water. The expression level was quantified on ABI 7500 Fast system as per manufacturer instructions (Applied Biosystem) using 5 pmol/μL of each miRNA specific primer. Briefly, 20 μL of real-time mixture was prepared which contained 1 μL cDNA, 6 μL MilliQ water, 10 μL of Power SYBER green master mix (Applied Biosystem), and 1.5 μL of forward and reverse primers. Temperatures’ setting for PCR was as follows: initial incubation of 50°C for 2 min, denaturation at 95°C for 10 min and 40 cycles at 95°C for 15 s, 60°C for 1 min, and 72°C for 40 s. The comparative Ct method (ΔΔCt) was used to determine the level of expression of miRNA. The calibrator used for miRNA analysis was non-infected macrophage. Sno miRNA-202 was used as endogenous controls for expression analysis (Choi et al., 2013). We were calculated the fold change (2^-ΔΔCt) using the formula normalized gene expression: (2^-ΔCt) in the infected macrophage divided the normalized gene expression (2^-ΔCt) in the uninfected macrophages as described elsewhere (Livak and Schmittgen, 2001).

For evaluating the role of HIF-1α in regulation of miR-210 expression in L. donovani infected macrophage, HIF-1α was silenced by HIF-1α specific siRNAs or scramble control (Santa Cruz Biotechnology, United States). The silencing of HIF-1α was done using the company specific protocol and reagents. Briefly, macrophages (10⁶ cells/well) were re-suspended in 500 μL transfection medium and transfected with 25 nM siRNA or scramble control. After 6 h of incubation, an additional 500 μL RPMI 1640 complete medium was added and cells were cultured overnight in a six-well culture plate. Next day, cells were washed and further experiments were executed. Silencing efficiency of HIF-1α was evaluated by semi-quantitative PCR. β-actin gene was used as loading control. Further, expression of miR-210 in HIF-1α silenced macrophages was evaluated by qPCR using the miRNA-210 specific primers as described earlier. Sno202 miRNA was taken as an endogenous control.

We predicted the target of miR-210 by online software miRDB and Target Scan based on target rank and score. Top 20 genes were functionally correlated with activation of NF-κB. Binding site of miR-210 and TNF receptor family was detected by Target Scan 6.0. The 3′-UTR of genes of interest containing the putative miRNA target site(s) WT-TNF-α receptor family (wild-type) and Mut-TNF-α receptor family (mutant) was cloned into the XbaI site of the pGL3 control vector containing firefly luciferase gene linked to the 3′-UTR of gene (Promega, United States). Macrophages were transfected by constructed pGL3 vector with either controls or mimics of miR-210 using Lipofectamine 2000 (Invitrogen, United States). After 24 h, cells were lyzed and luciferase activity was measured by Dual-Glo luciferase Assay System (Promega, United States) according to manufacturer’s instruction on luminometer. Firefly luciferase reading was normalized by renilla luciferase reporter.

The role of miR-210 in NF-κB mediated pro-inflammatory immune responses was evaluated by silencing with antagomir. The miR-210 antagomir (designed in our laboratory and was synthesized by Integrated DNA Technologies, New Delhi) using sequence, CAGUGUGCGGUGGGCAGUGGCU with the following modification. The 2′-OMe modified bases (2′-hydroxyl of the ribose was replaced with a methoxy group), phosphorothioate (phosphodiester linkages were changed to phosphorothioate) on the first two and last four bases, and an addition of cholesterol motif at 3′ end through a hydroxyproline modified linkage. Antagomir scramble (mismatched miR-210) was also obtained from the same company and used as negative control. The expression of miR-210 was silenced by antagomir according to the standard protocol described previously with required modification (Krützfeldt et al., 2005; Haftmann et al., 2015). Briefly, macrophages (10⁶ cells/well) were suspended in 500 μL of serum-free media for 2 h at 37°C and 5% CO₂ supplemented with 1 μM of antagomir-210 or antagomir scramble. After incubation, 150 μL of media containing serum and antibiotics were added and culture for 24 h in CO₂ incubator. For evaluating the functional role of miR-210, four experimental groups were plotted as follows: (1) uninfected Mφ, (2) Mφ infected with L. donovani, (3) miR-210 silenced Mφ infected with L. donovani, and (4) antagomir scramble treated Mφ infected with L. donovani. Macrophages were incubated in CO₂ incubator with 5% CO₂ for 24 h. After 24 h of incubation, supernatants were collected for measurement of cytokines, NO_x and reactive oxygen species (ROS).

In another experiment to the study of the role of HIF-1α and miR-210 in parasite infectivity and survival inside the macrophages, parasitic load was measured in siHIF-1α and antagomir treated L. donovani infected macrophages along with negative control at 6, 12, and 24 h of infection. Percent infectivity was calculated by counting the number of infected cells and parasite load was determined by counting the number of amastigotes per 100 macrophages. The results were expressed as mean ± standard deviation (SD) and performed in quadruplicate.

Macrophages (10⁶ cells/well) were harvested from culture plates, centrifuged, and pellets were suspended in 1 mL cold PBS. The suspension was further centrifuged at 6000 rpm for 5 min in a cold room and supernatant was removed. Tubes were immediately kept on ice and 5X cytoplasmic proteins extraction buffer (1 M HEPES, 5 M NaCl, 0.5 M EDTA, 100% glycerol, and protease inhibitor) was added and incubated on ice with occasional vortexing from time to time. The suspension was centrifuged at 3000 rpm for 5 min and the supernatant containing cytoplasmic proteins was collected.

Prior to nuclear protein extraction, pellets obtained after cytoplasmic protein were washed with 100 μL of cytoplasmic buffer for four to five times by repeated centrifugation at 3000 rpm for 5 min. Further, 100 μL nuclear protein extraction buffer (1 M HEPES, 2 M KCl, 0.5 M EDTA, 100% NP-40, and protease) was added to the pellet and incubated on ice for 10 min with vortexing occasionally time to time. Samples were further centrifuged at 14,000 rpm for 5 min at 4°C and the supernatant containing nuclear protein was collected. The proteins were quantified and stored at -80°C for execute of further experiments. NF-κB transcription factor (p50) activation assay in cytoplasmic and nuclear proteins extract of all experimental groups was performed using NF-κB activation assay kit (Abcam, ab207217) as per protocol provided by the manufacturer. Optical density was determined at 450 nm using a spectrophotometer.

Expression of NF-κB transcription factor (p50 and p65) was studied by western blot in both cytoplasmic and nuclear proteins of macrophages. Equal amount of protein (40 μg/lane) was loaded and separated on 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS–PAGE). Total separated protein bands were transferred on nitrocellulose membrane (Millipore, United States). The membranes containing protein bands were blocked in 1× TBST buffer (5% (w/v) non-fat dry milk containing 0.1% (v/v) Tween20) for 1 h at RT. After blocking, membranes were washed with TBST for three times and further incubated with p50 and p65 specific primary antibodies (Santa Cruz Biotechnology, United States) for 4 h (1:200 dilutions). After incubation, membranes were washed with TBST and incubated with horseradish peroxidase-conjugated secondary antibody, diluted in the ratio of 1:500 for 2 h. Protein bands on the blots were developed by 0.03% (v/v) DAB, 0.01% (v/v) H₂O₂ solution. Lamin B and β-actin (Santa Cruz Biotechnology, United States) proteins were used as reference for nuclear and cytoplasmic protein, respectively. Reference proteins were used to analyze the relative band intensity by Image Analysis Software of gel documentation system (Bio-Rad). The data were represented as mean ±SD of band density ratio of the experiments.

The cytokine levels (TNF-α, IL-12, and IL-10) in cell culture supernatant of all the experimental groups were measured by MAX^TM standard set enzyme-linked immunosorbent assay (ELISA) kit as per manufacturer’s instructions (BioLegend, United States). The results were represented in pg/mL.

Total RNA was isolated from macrophages of all experimental groups using TRI Reagent^® (Sigma Chemicals, United States) following manufacturer’s instruction. Briefly, cells were pelleted by centrifugation at 5,000 rpm and pellet was washed thrice with PBS (0.02 M, pH 7.2). Further, cells were lyzed in 300 μL of TRIzol and 120 μL chloroform. The cells were centrifuged at 10,000 rpm for 10 min. The upper aqueous layer was transferred into another centrifuge tube and twice volume of isopropanol was added. The mixture containing aqueous layer and isopropanol was centrifuged again at 10,000 rpm for 10 min and RNA pellets were collected. In the last step, RNA pellets were washed with 70% (v/v) ethanol treated with RNAse-free DNase to avoid DNA contamination. In all step of centrifugation, 4°C temperature was maintained. For analysis of cytokine mRNA expression, 20 μL cDNA was prepared following the protocol describing elsewhere. Briefly, equal amount of total RNA (1 μg) was taken and reverse transcribed using 1× RT buffer, 20 mM dNTPs (New England Biolabs, United States), 0.1 M DTT with DEPC-treated water, 200 ng of random hexamers (Fermentas, Germany), 20U RNasin (Fermentas, Germany), and 20U M-MLV reverse transcriptase (Fermentas, Germany). The cDNA was subsequently amplified using mRNA specific cytokines primers. The β-actin was used as house-keeping control gene. The 25 μL of reaction mixture was prepared containing 2 μL cDNA templates, 1× polymerase chain reaction buffer, 200 μM dNTPs, 0.5 mM MgCl2, 1U Taq DNA polymerase (New England Biolabs, United States), and 3.2 μM mice mRNA specific forward and reverse primers. Amplification was performed for 22 cycles and temperature and time of PCR were set as follows: denaturation at 94°C for 30 s, annealing at 46–55°C (depended on the Tm of the primers) for 30 s, and extension at 72°C for 30 s. Before the start of PCR cycles, initial denaturation at 94°C for 5 min and after completion of cycles, final extension for 7 min at 72°C was performed. The amplified PCR products were separated on 2% agarose gel containing ethidium bromide (0.5% w/v) and visualized under UV illumination in a gel documentation system (Bio-Rad, United States). The relative mRNA expression levels were analyzed by Image Analysis Software. List of primers used in this study is given in Supplementary Table S1.

In culture supernatant, total nitric oxide (NO_x) was estimated by measuring the amount of nitrite using Griess reagent as described elsewhere (Ding et al., 1988). The cultured supernatants (100 μL) were incubated with Griess reagent in the ratio of 1:1 for 10 min at RT. The absorbance was measured at 540 nm. The concentration of total nitrite was determined by comparing with a standard curve plotted using sodium nitrite (50–1.56 μM) as standard and expressed in micromolar.

The super oxide anion content was estimated in cell culture supernatant by the method described elsewhere (Johnstan et al., 1978). The principle of this method is based on the reduction of ferricytochrome c into ferrocytochrome c in the presence of O₂^- that directly correlates the level of O₂^- production to the cytochrome c reduced. In brief, 2 mL reaction mixture contained 100 μL of culture supernatant and 0.05 mM ferricytochrome c in PBS. Reaction mixture was incubated for 15 min at 37°C and reactions were terminated by placing the tubes on ice. Absorbance of the supernatant fractions was measured at 550 nm. The concentration of cytochrome c reduced was determined using extinction coefficient 2.1 × 10⁴ M^-1 cm^-1 and expressed as nmoles of O₂^- liberated per mg of protein.

The data were analyzed by one-way analysis of variance (ANOVA) using Student’s–Newman–Keuls test by Sigma Stat 3.5 software. The p-value less than 0.05 was considered to be significant. All the experiments were performed in quadruplicate and the data represented as mean ±SD.

Leishmania donovani infection in macrophages increased the expression of HIF-1α gene, which was significantly higher (p < 0.001) compared to uninfected macrophages. Figure 1A shows the band densitometry of the expression of HIF-1α mRNA and Figure 1B is the real-time validation in infected and uninfected macrophages.

Cellular hypoxia was confirmed by detecting pimonidazole adducts in protein lysate of macrophages by western blotting (Figure 2). In protein lysates of L. donovani infected macrophages, multiple bands were observed since pimonidazole forms adduct with molecules in hypoxic cells.

Out of 150 identified miRNA as shown in heat map (Supplementary Figure S1), we selected 25 highly upregulated and 43 downregulated miRNA for qPCR confirmation. Tables 1, 2 show the fold change of miRNA expression in Leishmania infected macrophages. Graphical representation of qPCR confirmation of differentially expressed miRNAs is shown in Figure 3.

To find out the role of HIF-1α in regulation of miRNA-210 expression, we silenced HIF-1α gene in macrophages by HIF-1α specific siRNA (Supplementary Figure S2). The HIF-1α expression was found significantly (p < 0.001) increased in Leishmania infected macrophages. However, after silencing of HIF-1α (Figure 4A), the expression of miR-210 was significantly (p < 0.001) downregulated (Figure 4B), which confirmed that the upregulation of miR-210 was HIF-1α dependent. Control scramble siRNA did not affect the HIF-1α either in L. donovani infected or uninfected macrophages.

Out of top 20 targeted genes (Supplementary Figure S3) of miRNA-210, we found that sixth rank of its targeted gene, i.e., tumor necrosis factor receptor super family plays an important role in activation of NF-κB (p50) subunit by gene ontology and KEGG (data not shown) since TNF-α is the main inducer of this signaling protein. Further, for validation of miR-210 target genes, we performed the luciferase reporter assay. The transfection with mimic of miR-210 significantly (p < 0.001) reduced the luciferase activities of genes fused to TNF-α receptor family 3′ UTR. Mutated 3′ UTR seed sequences of TNF-α receptor family did not show any significant luciferase activities treated with mimic of miR-210 (Figure 5).

The role of HIF-1α and miR-210 was validated in the following four experiment groups, i.e., (1) uninfected Mφ, (2) Mφ infected with L. donovani, (3) antagomir treated Mφ infected with L. donovani, and (4) Antagomir scramble treated Mφ infected with L. donovani to validate the role of miR210 on parasitic infectivity and survival.

We determined the percentage of infected macrophages and parasitic load in siHIF-1α and antagomir treated macrophages with negative control. We observed that after silencing HIF-1α, parasite infectivity and parasitic load were significantly (p < 0.001) reduced at 24 h of infection (Figure 6A). A similar pattern was also observed in antagomir-210 treated macrophages where parasite infectivity and parasitic load were found to be significantly (p < 0.001) arrested (Figure 6B). Further, at 12 h of infection, parasite infectivity and parasitic load also found significantly (p < 0.05) decreased (Supplementary Figures S4C,D). However, after 6 h of infection, parasite infectivity and parasitic load did not show significant changes (Supplementary Figures S4A,B).

The role of miR-210 in TNF-α mediated NF-κB p50 activation was investigated. In this study, we performed the NF-κB p50 activation assay in cytoplasmic and nuclear extract in protein lysates in all experimental groups. The optical density in cytoplasmic or nuclear protein lysates was not found significant before antagomir treatment. However, after treatment of macrophages with antagomir, optical density in nuclear extract protein showed optimal level and significantly (p < 0.001) increased (Figure 7).

The NF-κB p50 and p65 expression in cytoplasmic and nuclear protein extracts was evaluated by western blotting (Supplementary Figures S5, S6). The expression levels of p50 and p65 in all groups of Mφ cells are depicted in Figures 8A,B. In cytoplasm, before and after L. donovani infection, p50 and p65 showed normal level of expression (lanes 1 and 2 of Figure 8A); however, after miR-210 silencing, the p50 protein forms heterodimer with p65 and translocated to the nucleus and its expression was significantly (p < 0.001) lowered in cytoplasmic protein content (lane 3 of Figure 8A). In a similar manner, before and after L. donovani infection, the expression of p50 and p65 subunit shows normal expression level in nuclear proteins (lane 1 and 2 of Figure 8B); however, after miR-210 silencing, the expression of p50 and p65 proteins was significantly (p < 0.001) higher in nuclear proteins (lane 3 of Figure 8B). Antagomir scramble did not affect the NF-κB p50 and p65 expression in either cytoplasmic or nuclear protein extracts. These findings clearly showed that miR-210 regulates the activation of NF-κB p50 and hypoxia induced miR-210 targets the TNF-α receptor super family gene.

Release of cytokines in cultured supernatant was measured by cytokine ELISA and is depicted in Figure 9. The level of pro-inflammatory cytokines, i.e., TNF-α and IL-12, was significantly higher (p < 0.05) in antagomir treated macrophages compared to untreated macrophages. However, the level of anti-inflammatory cytokines, i.e., IL-10 in antagomir treated macrophages was found lower (p < 0.001) compared to untreated macrophages. The level of pro-inflammatory cytokines mRNAs showed a similar pattern of result and their expression in antagomir treated macrophages was higher compared to untreated macrophages (Supplementary Figures S7–S9). The expression level of IL-10 was lower in antagomir treated macrophages compared to untreated cells. The macrophages treated with antagomir scramble did not show significant change in pro- or anti-inflammatory cytokines level compared to untreated macrophages. These results indicated that miR-210 has an important role in IL-10 cytokine production during Leishmania infection and its control can upregulate the production of inflammatory cytokines.

Respiratory burst activity was measured in terms of O₂^- level after 2 h and NO_x levels after 24 h of infection in culture supernatants and results are depicted in Figures 10A,B, respectively. The levels of O₂^- and NO_x in antagomir treated macrophages were 107.64 ± 15.26 nmoles/per mg of protein and 31.45 ± 3.12 μM, respectively. However, in untreated macrophages, their levels were 34.67 ± 5.41 nmoles/per mg and 11.53 ± 2.21 μM, respectively. The O₂^- and NO_x levels were found increased (p < 0.001) in antagomir treated macrophages compared to untreated macrophages. The antagomir scramble treated macrophages did not show significant change in either O₂^- or NO_x levels. These results confirmed the regulatory role of miR-210 in macrophage effector functions in terms of respiratory burst activity.