Luria–Bertani (LB) broth, LB agar, Baird–Parker agar base, and egg yolk (EY) tellurite enrichment, Tryptic Soy Broth (TSB) and Brain heart infusion (BHI) broth were obtain from Himedia (India). Potassium phosphate dibasic, citrate protected gold nano particle (20 nm), glycine, sodium chloride (NaCl), sodium hydroxide, o-Phenylenediamine dihydrochloride (OPD), Dulbecco's phosphate buffer saline (DPBS), bovine serum albumin (BSA), and all PCR reagents obtained from Sigma-Aldrich (India).

Synthesized single-stranded DNA (ssDNA) aptamer (SEB2) 5′TAGCTCACTCATTAGGCACGGGTAGGCCATAATATCTTATTAGCGTAATTCTGCGATTGGCATAGTTAAGCCAGCC3′ (Mondal et al., 2015) and random ssDNA (RDNA) 5′CGTAGTCTAGTGTCGATTAGTTTCCTTGAGACCTTGTGCT3′ were obtained from Xcelris Bioscience (Ahmadabad). DNA stock solution was prepared in 10 mM DPBS (pH 7.0) and was stored at 4°C before use. All other reagents were of analytical reagent grade and ultra-pure water (Milli-Q plus, Millipore Inc) used throughout the experiments.

The bacterial reference strains used in the study are listed in Table 1. Staphylococcal and non-staphylococcal cultures were grown in Brain heart infusion (BHI) broth under aeration at 37°C for 18–24 h. S. aureus cells were grown in Tryptic Soy Broth (TSB) for 24 h for enterotoxin production. Cultures were cryopreserved in 15% glycerol and stored at −80°C.

The UV-vis absorption spectra and kinetics parameter was monitored using UV-vis spectrophotometer (TECAN, India).

First, 50 μL of single-stranded SEB aptamer or random DNA (240 nM) and different concentrations (0.5 ng−50 μg/mL) of SEB in 10 mM PBS were added in 96-well microtiter plates for 30 min. Then, 50 μL of AuNPs solution was added and incubated for 5 min. Subsequently, 50 μL of 300 mM NaCl was mixed with the solution to provide a final volume of 150 μL. After the solution was equilibrated for 15 min, UV–vis absorbance was recorded at 520 nm. The UV–vis absorption measurement was carried out at the range from 400 to 850 nm. To developed colorimetric biosensing assay conditions such as, aptamer concentration, NaCl concentration, binding temperature, and binding time were investigated in this study. For evaluation of cross-reactivity among different related toxins and other proteins, the assays were repeated using r-SEA, r-SEC, r-SEG, and BSA.

To evaluate the specificity of established colorimetric biosensing, toxins extracted from various staphylococcal and non-staphylococcal cultures mentioned in Table 1 were tested. Briefly, the bacterial cultures were grown in TSB medium for 24 h. Enterotoxins were extracted from samples by TCA precipitation method described by Vernozy-Rozand and co-workers (Nguyen, 2014). Extracted toxin was tested directly through colorimetric biosensing as mentioned earlier. For comparison, staphylococcal isolates were subjected to PCR analysis to examine the presence of seb gene using seb specific primers. In order to appraise the feasibility of the assay for direct detection in food matrix, r-SEB was spiked into milk (0.5 ng−50 μg/mL) and colorimetric biosensing was performed as mentioned earlier. Toxins from milk samples were extracted by TCA precipitation.

To access the real time applications of colorimetric biosensing method, different natural samples were tested (Table 1) for detection of presence of enterotoxin B producing S. aureus through newly developed method. Enterotoxins were extracted from samples by TCA precipitation and subjected for detection in standardized assay condition.

The sensitivity and feasibility of the newly described method was evaluated by comparing with in-house developed sandwich ELISA and PCR kits. Toxin was extracted from various S. aureus culture broth and the colorimetric assay was performed. The UV–vis absorption of the colorimetric reactions was measured and the results were interpreted and compared with in house developed kit.

In house, sandwich ELISA was standardized using anti SEB chicken IgY(Anti SEB IgY) as capture antibody and murine monoclonal anti SEB antibody (SEB mAb) as revealing antibody followed by detection using HRP conjugated goat anti mouse IgG. Briefly, anti-SEB IgY was diluted to 1:500 in carbonate–bicarbonate buffer and coated in maxisorb 96-well plate (Nunc- Denmark) and incubated at 4 °C for overnight. After blocking with 250 μL of 1% BSA for 1 h, samples (culture supernatants/enriched samples/extracted samples) was added to the wells and incubated at room temperature (RT) for 45 min. The plate was incubated with secondary conjugate for 40 min and chromogenic reaction was carried out using o-Phenylenediamine dihydrochloride (OPD) and 30% H₂O₂ in citrate phosphate buffer. After each step, plate was washed thoroughly with PBST (Tween 20–0.05%) solution. Results were interpreted either by visual inspection or by measuring the absorbance at 450 nm in ELISA reader (TECAN, USA).

For PCR based detection, DNA was extracted from pure culture and PCR was performed in a 50 μl reaction mixture containing 1X of PCR buffer, 1.5 mM of MgCl₂, 0. 20 mM of dNTPs, 1.25 U of Taq DNA polymerase and 5 pmol of each seb specific primer (Table S1).

In this work, synthesized citrate protected AuNP solution was used to prevent the strong van der Waals attraction between AuNPs causing them to aggregate (Wang et al., 2010). The detailed principle was described in Supporting Information 1 (Figure 1).

As we can see, the aptamer with a random coil structure could bind to AuNPs. After adding a high concentration of NaCl, AuNPs would remain dispersed. Upon the addition of target, SEB–binding aptamer (SEB2) induced the conformation to a rigid stem–loop structure. As a result, aptamer lost the ability to protect the AuNPs under high-salt conditions. Hence AuNPs aggregates and the color of AuNPs solution changes from red to purple (Figures 2A,B).

Aggregated AuNPs tend to precipitate easily, so it is important to monitor the salt-induced AuNPs aggregation kinetics for colorimetric detection of SEB. To optimize, the performance of the developed assay various conditions such as, aptamer concentration, NaCl concentration, binding temperature, and binding time were investigated in this study.

To optimize the NaCl concentration in the absence or presence of SEB, various range of NaCl (0–500 mM) was added in predetermined volume of AuNPs solutions (Figure S1). The net absorbance of AuNPs solution reached the maximum at 300 mM NaCl at 620 nm. On the contrary, in the absence of SEB, the A620 nm reached a relatively high value at 350 mM NaCl and thus increased the interference from the background. Then, on basis of higher sensitivity and lower background signal, 250 mM NaCl was considered as suitable concentration for AuNPs aggregation.

The kinetic parameters of AuNPs aggregation was measured between 0 and 35 min in presence of SEB. As we can see in Figure 3 that the absorbance values of AuNPs at 520 nm decreased with the reaction time and reached maximum at 20 min and reached a constant. After 20 min, the absorbance increased very slowly. Considering the assay speed, 15 min were preferred as the assay time on the basis of higher sensitivity and time saving.

The effect of aptamer concentration also monitored for colorimetric detection of SEB. High concentration of aptamer is not suitable for detection of small amounts of the target because it can produce large background signal. The effect of the aptamer concentration was studied in the range of 0–350 nM (Figure S2). The optimum result was obtained at 240 nM aptamer concentration without any background, hence considered as suitable concentration for the detection of SEB.

The kinetic parameters of AuNPs aggregation in various temperatures (10–60°C) were monitored. Higher response was observed within the range of 10–30°C, and the response decreased at 30°C, this could be due to loss of secondary structure of aptamer at high temperature. Taking consideration of aptamer selection condition and most probable secondary (Figure S3) structure (Mondal et al., 2015), room temperature (27°C) was chosen as the suitable temperature for all experiments.

UV–vis spectra of the AuNPs solution for colorimetric detection of SEB under different experimental conditions were shown in Figure 2A. As can be observed, after addition of salt to the AuNPs solution the surface Plasmon resonance (SPR) absorption band shifted and a new peak appeared at about 620 nm. Correspondingly, the AuNPs solution color also changed from red to purple. This shifting and color change was mainly due to salt-induced aggregation of AuNPs (Figure 2B). Only after the addition of SEB2 aptamer or random DNA a similar characteristic SPR absorption band of AuNPs at 520 nm appeared. We consider the surface of AuNPs was absorbed by ssDNA to protect the AuNPs from salt-induced aggregation (Lavu et al., 2016). However, after addition of SEB, a SPR band at about 620 nm was clearly observed and the color of the AuNPs solution changed from red to purple (Figure 2C).

To support the analysis, control experiments were performed using random DNA (RDNA) under the standardized condition. As could be observed, after the addition of SEB, there was not any change in UV–vis spectrum shift and the color of the AuNPs solution remained red. This indicates that SEB could binds to its aptamer, not to random DNA.

To monitor the sensitivity of colorimetric Apta sensor, the UV–vis spectra of AuNPs with different concentration of SEB in the range of (0–50 μg/mL) was monitored in the optimized experimental conditions (Figure 4). As can be seen in Figure 4, spectrometrically the limit of detection (LOD) was 0.5 ng/mL of SEB and even with the naked eye; we could identify 50 ng/mL of SEB within few minutes. Moreover, a linear correlation was obtained between A620 nm and the concentration from 0 to 50 μg/mL (Figure 5). This linear range and LOD could be comparable to the available detection system for SEB.

Selectivity of colorimetric biosensor was evaluated by testing with other related toxins and various bacterial cultures toxin extracts. Reactivity was observed only in SEB producing S. aureus strains and presence of r-SEB toxin. Result shows that there was no major change in the SPR band of AuNPs before and after the addition of other related toxins (Figures 6A–C) and other non-staphylococcal bacterial cultures protein extract (Table 1). Correspondingly, the red color remained unchanged. We inferred that the other related proteins had no specific binding to the SEB aptamer, thus, no aggregation occurred. However, in presence of SEB, AuNPs aggregates and the absorbance at 520 nm decreased and a SPR band at about 620 nm was clearly observed.

Most common root of Enterotoxigenic S. aureus contamination is milk and milk based products, hence spiking study was performed in milk. The gold nano particle based colorimetric biosensor could detect r-SEB at level of 0.5 ng/mL without any hindrance in sensitivity (Figure 7). However, insignificant lower signal and absorbance values were observed in toxin extracted from spiked milk in comparison with actual recombinant toxins.This limitation can be ruled out by using a blank with similar composition of the sample.

Gold nano particle based colorimetric biosensor was assessed for its efficiency and practicability for detection of targets from natural food samples. Among 50 naturally contaminated food samples, the assay able to detect 15 positive sample for the presence of SEB. As shown in Table 2, the assay can able to detect SEB positive S. aureus from natural samples within 45 min. The comparison of result with in-house ELISA and PCR kit validate the same. Altogether,these experimental results demonstrated that this colorimetric biosensor based detection of SEB can be can be a suitable alternative tool for routine investigation of food and natural sample in laboratory during biological emergencies.

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.