In the last decade, we have systematically surveyed flies for the presence of trypanosomatids in general by culturing and PCR-screening. We examined 3,900 flies collected manually (mostly from 2007 to 2016) of the families Calliphoridae, Muscidae, Syrphidae, and Sarcophagidae. The Calliphoridae constituted most of the sample collected (2,418 flies, ∼ 62%) and they were the focus of this work. The blowflies examined were classified as: Chrysomya (C. putoria, C. albiceps, C. megacephala); Lucilia (L. eximia, L. sericata/L. cuprina) and Cochliomyia (C. hominivorax, C. macellaria). No molecular attempts were made to distinguish L. sericata from L. cuprina, which are morphologically very similar, thus specimens collected in Neotropical regions were classified as L. sericata following the recommended classification (Williams et al., 2016). Species and geographic origin of all flies examined in the present study are in Supplementary Table 1.

In the Afrotropical region, flies were collected in Guinea-Bissau (cities of Bissau and Buba); Mozambique (Beira, Tete, Chupanga, Maputo, Marromeu, and Gorongosa); Madagascar (Andasibe, Antsiranana, Antananarivo, and Moramanga); South Africa (Pretoria); Tanzania (Dar es Salaam and Zanzibar); and Ethiopia (Addis Ababa, Arba Minch, Harar, Hawassa and Lalibela [2,500 m]). In Central America, flies were collected in Panamá city. In South America, sampling of flies extended from northern to southern regions. In Venezuela, flies were collected in Merida and Laguna of Mucubaji (3,500 m) in the Andean Mountains, and in the wetlands of Santa Barbara. In Colombia, flies were collected in Ibagué and near villages between the Central and Oriental Andes Cordilleras. In Ecuador, flies were collected in Ingapirca and Quito (2,850 m). In French Guyana, calliphorids were collected in Cayenne. In Brazil, flies were collected in domestic and sylvatic environments from northern to southern regions across the biomes of the Amazonia, Pantanal, Atlantic Forest, Cerrado, and Caatinga. The locations where flies were collected are shown in Figure 1 and Table 1 (detailed in Supplementary Table 1). Blowflies were identified using morphological parameters, and African and American specimens representative of different species from each country were also identified by cytochrome c oxidase 1 (COI) barcoding (Marinho et al., 2012).

The gut contents of dissected flies were microscopically examined for trypanosomatids. Samples that were microscopically positive for trypanosomatids were inoculated in culture tubes containing TC100 medium (=Grace’s medium) containing 20 μg/ml of gentamicin, and incubated at 25°C. Positive cultures cleared of bacteria and fungi were cloned and re-cloned using agar plates (TC100 medium with 2% agar base) (Sbravate et al., 1989; Borghesan et al., 2013). Then, well-separated colonies were transferred to liquid medium, and flagellates checked regarding clonality by sequencing of V7V8 SSU rRNA and/or gGAPDH genes. Cryopreserved cultures, ethanol preserved gut samples, and whole flies were deposited in the Trypanosomatid Culture Collection of the University of São Paulo (TCC-USP). With the aim of detecting Angomonas, DNA from guts of blowflies that were positive for trypanosomatids were submitted to V7V8 SSU rRNA barcoding using primers and PCR conditions described previously (Borghesan et al., 2013), and sequences obtained employed for Angomonas identification (Figure 2).

To specifically detect the TPEs of Angomonas spp. using DNA obtained from fly guts, we designed primers based on GAPDH sequences retrieved from published genomes of A. deanei and A. desouzai symbionts: GAPDH.ENDO.F (5′AAGAGCTCATTATGAAGGTGG3′) and GAPDH.ENDO.R (5′TGGAATCATAYTCATGGTTGC3′). PCR reaction mixtures (25 μl) contained 50–100 ng of DNA, 100 ng of each primer, 200 μM of each dNTP, 1.5 mM of MgCl_2, and 2.5 U of Taq DNA polymerase. PCR reactions were carried out with 30 cycles of 3 min at 94°C, 2 min at 58°C, and 2 min at 72°C, and a final extension for 10 min at 72°C. PCR-screening based on GAPDH sequences of TPEs were used to select fly samples containing Angomonas for further analyses. All TPE sequences obtained herein were aligned with GenBank available sequences and submitted to phylogenetic inferences (parsimony, as described below). This approach allows identification of known and novel TPEs of Angomonas.

PCR-sequencing of the variable V7V8 SSU rRNA and gGAPDH from Angomonas cultures and fly gut samples were performed as described previously (Borghesan et al., 2013). Sequences obtained were screened for chimera using the RDP4 package (Martin et al., 2015), and aligned with sequences from species of several genera representative of the main clades of Trypanosomatidae using ClustalX. Three alignments, were used for phylogenetic inferences. Alignment A1 comprised V7V8 SSU rRNA gene (810 characters) from SHTs, and was submitted to parsimony analysis. A2 included concatenated V7V8 SSU rRNA and gGAPDH sequences (1,957 characters) from representatives of all Angomonas spp., other species of SHTs, and various trypanosomatid genera; analyses were performed by maximum likelihood (ML) and Bayesian inference (BI) methods. A3 contained gGAPDH sequences (864 characters) representative of all species and genotypes of Angomonas using species of the genus Strigomonas as outgroups, and submitted to parsimony. Parsimony and bootstrap analyses were performed using PAUP^∗ version 4.0b10 software (Swofford, 2002) with 500 random sequence replicates followed by branch swapping (RAS-TBR). ML analyses were performed using the general time reversible (GTR)-gamma-I model in RAxML v.7.0.4 (Stamatakis, 2006) with 1,000 maximum parsimony-starting trees. Model parameters were estimated using the randomized accelerated maximum likelihood (RAxML) model over the duration of the tree search. Bootstrap support was calculated by including 1,000 replicates in the RAxML model using the rapid bootstrapping algorithm, and maximum parsimony as starting trees. Bayesian analysis was performed using MrBayes v3.1.2, the tree searches employed GTR-gamma-I, and the first 25% of the trees from 1,000,000 generations were discarded as burn-in. Default values were used for the remaining parameters. Sequence divergences were calculated using distance matrices (uncorrected p-distance) that were constructed using the program PONTOS (¹). Sequences of V7V8 SSU rRNA and gGAPDH genes representative of all Angomonas species and genotypes, from different flies and geographical origin, determined in the present study were deposited in GenBank. The accession numbers of these sequences, and those from previously sequenced SHTs are shown in Supplementary Table 2.

To evaluate whether SHTs and TPEs have undergone parallel diversification, the significance of topological congruence was assessed using the program TreeMap 3.0β, a pairwise distance correlation test of topological congruence that allowed for graphic representation (tanglegrams) of coevolutionary, host-switching, and other events (Charleston and Robertson, 2002). TreeMap uses reconciled trees to compute the fit between the host and parasite phylogenies, and includes a statistical testing that generated random trees to assess whether co-divergence is significantly higher than chance alone.

Sequences of PCR-amplified internal transcribed spacer-1 (ITS1) of rDNA were determined using primers and PCR reaction described previously (Borghesan et al., 2013). Sequences obtained in the present study were aligned with those described previously for Angomonas spp. (from GenBank), and employed for phylogenetic analysis using parsimony as described above. Secondary structures of ITS rDNA were inferred using the Unafold package (thermodynamically predicted models) with the energy minimization of paired and unpaired regions at 37°C folding temperatures (Markham and Zuker, 2008), as described previously for trypanosomatids of the genus Herpetomonas (Borghesan et al., 2013). The secondary structures were visualized by using the VARNA program (Darty et al., 2009). All ITS1 rDNA sequences employed in this study are deposited in GenBank, and the accession numbers are shown in Supplementary Table 2.

Analyses of genetic structures of Angomonas populations were tested using AMOVA implemented in Arlequin v. 3.5.1.2 (Excoffier and Lischer, 2010), and the significance was calculated using 20,000 permutations. Statistical analyses were done using Epi Info public domain site. The correlation between the geographic and genetic distance matrices was investigated with the Mantel test version 2.0 (Liedloff, 1999), with 1,000 iterations for the calculation of the random distribution. Fisher’s Test, a standard procedure for measuring the statistical association between two discrete variables, were used to assess the significance of associations between Angomonas species/genotypes and geographical origin or host species.

Microscopy revealed the presence of trypanosomatids in 1,209 out of 3,900 flies from the families Calliphoridae, Sarcophagidae, Muscidae, and Syrphidae, yielding an estimated overall prevalence of 31%. Gut contents of all microscopically positive flies were inoculated in culture, and 505 cultures of different genera of trypanosomatids were obtained, yielding a 42% rate of culturing success. In the last 15 years, V7V8 SSU rRNA barcoding of trypanosomatids from a range of fly families has been systematically carried out in our laboratory. Barcoding of 505 cultures of fly trypanosomatids allowed to identify 175 (34%) cultures harboring Angomonas spp.: 154 A. deanei (88%), 18 (10%) A. desouzai, and 3 (2%) A. ambiguus. Barcoding of trypanosomatids from non-cloned cultures and guts from blowflies revealed the coexistence of Angomonas spp., and other species that require further phylogenetic analyses. Among 130 cloned cultures of Angomonas from blowflies, 113 (87%) were identified as A. deanei, 14 (11%) as A. desouzai, and 3 (2%) as A. ambiguus (Figure 2A).

Phylogenetic analysis of V7V8 SSU rRNA sequences from cultured Angomonas spp. showed three strongly supported clades corresponding to the three species, A. deanei, A. desouzai, and A. ambiguus (Figure 3A). Phylogeny including all know species of the different genera of SHT supported three separate clades, Angomonas, Strigomonas, and Kentomonas (Figure 3A), which together form the subfamily Strigomonadinae (Votýpka et al., 2014). V7V8 SSU rRNA sequences failed to disclose infraspecific diversity within Angomonas spp. Most V7V8 SSU rRNA sequences employed in this analysis were determined in the present study, and sequences representative of each species/genotypes were deposited in Genbank (Supplementary Table 2).

Comparison of symbiont-GAPDH sequences from all Angomonas spp. discovered relevant polymorphisms among sequences obtained for 113 cultures of A. deanei, whereas sequences from A. desouzai and A. ambiguus were more homogeneous. Analysis of symbiont-GAPDH sequences allowed to identify four genotypes of A. deanei: Dea1, 55 cultures (48%); Dea3, 54 cultures (48%); Dea2 and Dea4, two cultures each (2%) (Figure 2A).

PCR-amplification of symbiont-GAPDH sequences from gut content of 100 blowflies revealed 46 flies (46%) harboring Angomonas spp. Further analysis of 39 flies revealed infections with a single species in 25 (64%) flies, and mixed infections with two and three species in 8 (21%) and 6 (15%) flies, respectively, yielding a total of 59 symbiont-GAPDH sequences. These sequences showed a predominance of A. deanei (28 sequences, 47%) followed by A. desouzai (22 sequences, 38%), and A. ambiguus (9 sequences, 15%) (Figure 2B). The results reveal that A. ambiguus and A. desouzai have a higher prevalence (7 and 3.5 times, respectively) in blowfly gut samples than in cultures (p < 0.01), confirming experimental observation that culturing favors the growth of A. deanei over A. desouzai and A. ambiguus. In addition, the genotype Dea3 (76%) prevails over Dea1 (16%) in blowfly guts, thus differing from cultures showing 48% prevalence rates for both Dea1 and Dea3 genotypes. Notably, not a single species or even genotype of Angomonas distinct from those found in cultures were unveiled by direct examination of blowfly gut samples.

Altogether, the identification of Angomonas spp. among trypanosomatids of cultures and blowfly guts by the combination of SSU rRNA barcoding plus symbiont-GAPDH genotyping revealed A. deanei in 184 flies (141 blowflies), A. desouzai in 38 (36 blowflies), and A. ambiguus in 12 blowflies (Figures 2A,B and Table 1).

Analyses of gGAPDH sequences of Angomonas spp. corroborated species identification based on V7V8 SSU rRNA, and genotyping based on symbiont-GAPDH sequences. Phylogenetic analysis using V7V8 SSU rRNA and gGAPDH sequences strongly supported three clades corresponding to the three species of Angomonas as showed in the phylogenetic tree inferred using isolates representative of each species/genotypes (Figures 3A,B). In addition, this analysis strongly support the partition of A. deanei in two main lineages, with infra-lineage diversity (moderately supported) suggesting the existence of four genotypes of this species (Figure 3B).

In contrast with highly conserved SSU rRNA sequences, the more polymorphic gGAPDH sequences from isolates of A. deanei showed relevant sequence divergences supporting the four (Dea1–Dea4) genotypes of this species previously uncovered by comparison of symbiont-GAPDH sequences. Among the 113 cultures of A. deanei examined, 55 (48%) were identified as Dea1, 54 (48%) as Dea 3, 2 (2%) as Dea 2, and 2 (2%) as Dea4 (Figures 2, 3). Phylogenetic relationships based on gGAPDH sequences of a larger number of isolates of A. deanei strongly supported the Dea1-Dea4 genotypes (Figure 4). In addition, the four genotypes of A. deanei were strongly supported in the analyses restricted to Angomonas based on ITS rDNA (Figure 5),

Genotype Dea1 includes the holotype of A. deanei, TCC 036E (Teixeira et al., 2011). There were no gGAPDH divergences greater than 0.1% among isolates of the same genotype of A. deanei. The gGAPDH sequence divergences among the four Dea genotypes ranged from 2.0 to 3.0%. For comparison, gGAPDH divergences of A. deanei from A. desouzai and A. ambiguus were about 7%, whereas divergences between A. desouzai and A. ambiguus were 4.0%. New isolates of A. desouzai and A. ambiguus diverged less than 1.0% from the respective holotypes, thus lacking relevant polymorphisms that would justify their separation in infraspecific genotypes.

Aiming at improving the assessment on infraspecific genetic diversity within the species of SHTs, we determined sequences of the highly polymorphic ITS rDNA sequences (Teixeira et al., 2011). ITS rDNA phylogenetic analysis confirmed the clustering of sequences according to species and genotypes (Figure 5A). Extensive polymorphisms, with divergences of ∼ 50% in ITS rDNA sequences, separate the cluster containing A. deanei genotypes from those formed by A. desouzai and A. ambiguus (which diverge ∼ 35% from each other), and corroborated the high genetic diversity among A. deanei genotypes: ∼ 12% between Dea1and Dea2, and ∼20% between Dea1 and Dea3/Dea4. Sequence divergences within a given genotype were small, varying from 1.0% (within Dea3) to 6.0% (within Dea1). The maximum ITS rDNA sequence divergence among clones of a given isolate was 2.0%. Despite relevant polymorphisms among species and genotypes, the relationships inferred using ITS rDNA sequences (Figure 5) corroborated V7V8 SSU rRNA + gGAPDH (Figure 3B) and gGAPDH (Figure 4A) inferred phylogenetic relationships.

Angomonas spp. exhibited the same general features of ITS rDNA secondary structure of trypanosomatids in general, consisting of an open loop with four main helices. The putative secondary structures exhibited four helices that varied in length, shape and position, which allowed for the species of Angomonas to be clearly distinguished. The structures of the most divergent Dea1 and Dea3 genotypes were distinguishable, while Dea1 and Dea 2 shared very similar structures (Figure 5B). In every case, isolates of the same genotype yielded identical overall structure, which added support to the consistency of secondary structures as one valuable taxonomic parameter to distinguish species and even genotypes of trypanosomatids (Borghesan et al., 2013).

Accompanying the genetic heterogeneity of gGAPDH sequences of Angomonas spp. hosts (Figure 4A), GAPDH sequences of Angomonas symbionts also exhibited marked heterogeneity. In the inferred phylogenies, sequences of the symbionts of A. deanei were split into two main clusters, each one comprising two well-supported genotypes (three genotypes were herein reported for the first time). We refer to these four genotypes of Candidatus Kinetoplastibacterium crithidii as Kcr1, Kcr2, Kcr3, and Kcr4 (Figure 4B). The Dea clusters are congruent with the Kcr clusters as supported by ML, P, and BI analyses: Kcr1 associated exclusively with Dea1, Kcr2 with Dea2, Kcr3 with Dea3, and Kcr4 with Dea4. Similarly, isolates of A. desouzai paired only with Ca. K. desouzaii. The only exception was the lack of congruence between A. ambiguus and its symbiont; this species harbors the symbiont Kcr3 of A. deanei Dea3 (Figures 4A,B).

To assess whether SHTs and TPEs have undergone parallel diversification, the significance of topological congruence between the phylogenies of the SHT and TPE species and genotypes was assessed by TreeMap. The tanglegram inferred by TreeMap strongly supported (p < 0.002) codivergence events between SHTs and TPEs, and a single event of host switch represented by A. ambiguus carrying the symbiont Kcri3 of A. deanei Dea3 (Figure 6).

Keeping in mind that Cochliomyia spp. and Lucilia eximia are New World flies and that, until the 1970’s, Chrysomya was absent in the Americas, we scored the presence of Angomonas genotypes, and their association with these three genera of Calliphoridae, in the Neotropical and Afrotropical realms (Figures 1, 7). A. deanei predominated in all examined genera of blowflies, from Neotropic and Afrotropic, regardless whether the trypanosomatids were analyzed from cultures or directly from fly guts. C. putoria and C. megacephala as well as in L. sericata and L. eximia were the commonest hosts of A. deanei. A. desouzai was identified exclusively in the Neotropical blowflies of the three calliphorid genera examined; however, most isolates of this species were detected in L. eximia followed by C. putoria. The absence of A. desouzai in Chrysomya in Africa contrasts with very high significance (p < 0.01) with its presence in the introduced Chrysomya spp. A. ambiguus was found in the Afrotropic and Neotropic, mainly in C. putoria and sporadically in C. megacephala, C. albiceps, and L. eximia from the New World (Figures 1, 7). Interestingly, this species was not detected in Cochliomyia, even in searches carried out directly by PCR using DNA from fly guts to avoid favored culturing of other species. To date, C. hominivorax and C. macellaria were found infected with A. deanei and A. desouzai (Figures 2B, 7 and Table 1).

Regarding genotypes of A. deanei, Dea3 was predominant in Chrysomya spp. from the Afrotropic and Neotropic, collected either in native or invaded regions (p < 0.01). Notably, this genotype was also common in Cochliomyia. In contrast, Dea1 was the predominant genotype infecting South American Lucilia, either the Neotropical L. eximia or exotic L. cuprina/L. sericata. Compared to Dea3, Dea1 was rarer in African Chrysomya spp., whereas it is worth noting the presence of Dea2 exclusively in African Chrysomya (Figure 7). The repertoire of A. deanei uncovered in C. hominivorax and C. macellaria collected in Brazil, Colombia, Venezuela and French Guiana revealed A. deanei of the genotypes Dea3 and Dea4 (Figures 1, 7). In addition, these flies were the major hosts of A. desouzai, suggesting (p < 0.01) that this species may be endemic to the New Word. Altogether, our data revealed a distinct repertoire of Angomonas species and genotypes for each calliphorid genus examined (Figure 7). Apparently, Dea1 and Dea3 genotypes have preferences for Chrysomya and Lucilia, respectively, with very high significance estimated by Fisher’s Test (p < 0.01).

Despite the widespread distribution of A. deanei and A. ambiguus, divergences of gGAPDH sequences of isolates from distant areas in South America and Africa were always smaller than 1.0%. Similar results were obtained for isolates of A. desouzai from distant collecting sites of South America. We used Mantel’s test to assess the correlation between geographic and genetic distances among the main genotypes Dea1 and Dea3 that infect blowflies in the Afrotropic and Neotropic. We found no significant correlation (r = –0.0353) between the two matrices, with a standard normal variate (g) value of –0.4359 for our dataset (for a significance of 0.05, the critical value is 1.645). Overall, 34.6% of the random permutations exhibited a better correlation between matrices than that of collected data. Thus, no correlation was found between geographic and genetic distances of Dea1 and Dea3 genotypes from Africa and South America what clearly indicates the recentness of their geographical separation.

We also analyzed the genetic structure of A. deanei genotypes by comparing gGAPDH sequences from the Afrotropical and Neotropical genotypes Dea1 and Dea3. Using the AMOVA test, results revealed a diversity of 2.4% between the African and South American genotypes, and 97.4% in each population, which supports the lack of spatial genetic structure for both Neotropical and Afrotropical parasites (ф_ST 0.024, p < 0.003). Regarding the endosymbiont, the analysis of Kcr1 and Kcr3 TPEs confirmed the somewhat higher degree of genetic structure of symbionts. Divergence between gGAPDH sequences amounted to 6.1% between African and South American TPEs, with ∼ 85% divergence within each population (ф_ST 0.15).