Fresh leaves of A. aspera L. plants were collected from different parts of Manipur, India. The leaves were washed with tap water and surface sterilized with 70% ethanol for 1 min followed by 0.1% mercuric chloride for 5 min. Leaves were washed in water, and rinsed in phosphate buffer, macerated in mortar and pestle under aseptic condition. Suitable dilution of 1.0 g of macerated tissue was plated on yeast extract mannitol agar (YEMA) and incubated at 30°C for 3 days. The bacterial colonies were selected, sub-cultured, purified, and used for further studies.

The isolates were characterized for morphological and biochemical properties according to Bergey’s Manual of Systematic Bacteriology (Bergey et al., 1994). Colony morphology, shape, color, and growth pattern were recorded after 24 h of growth on YEMA. The isolates were also tested for catalase (Aneja, 2006), oxidase (Cappuccino and Sherman, 1996), citrate, indole production (Seeley and VanDemark, 1981), and carbohydrate fermentation test (Aneja, 2006).

The genomic DNA of isolates was extracted using HiPurA Bacterial Genomic Purification Kit (Hi-Media). The primers 27F (5′-CAGAGTTTGATCCTGGCT-3′) and 1492R (5′-AGGAGGTGATCCAGCCGCA-3′) were used for amplification of 16S rRNA gene (Weisburg et al., 1991). The total PCR mixture was 25.0 μL comprising 2× Master mix (GCC Biotech), 12.5 μL; 27F, 1.0 μL; 1492R, 1.0 μL; lysate DNA, 1.0 μL, and nuclease free Milli-Q water, 9.5 μL. The PCR condition was an initial denaturation at 94°C for 5 min, followed by 30 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 1.30 min and final extension at 72°C for 10 min. Five microliters of purified PCR product was loaded in the agarose gel (1%) while 1 μL DNA ladder (100 bp) (Promega) was also loaded to estimate the size of the amplified fragments. The gel was run at 100 V for about 90 min and observed under the UV transilluminator for possible amplification. The amplified 16S rRNA gene was sequenced (Xcelris Labs Ltd, India), and identified using the EzTaxon-e server database (Kim et al., 2012) and NCBI GenBank databases. It was aligned with the 16S rRNA gene sequences of other related species using CLUSTAL X v2.1 (Larkin et al., 2007). Phylogenetic analyses were performed using the software package MEGA 4 (Tamura et al., 2011).

The isolate Pseudomonas aeruginosa AL2-14B was subjected for “hemolytic activity” assay, and screening for virulence genes to check if it may be potentially pathogenic. The isolate was spot-inoculated on blood agar plates and incubated at 37°C for 48 h to determine its ability to release hemolytic cytotoxin. The plates were checked for appearance of zones for complete or partial hemolytic activity. Further, virulence genes—toxA (270 bp) for exotoxin and plcH (608 bp) for hemolysin—were screened by PCR amplification (Sabharwal et al., 2014), where 25 μL reaction mixtures had 2.5 μL of dNTPs (10 mM), 1.25 μL each of forward and reverse primers (5 pmol each), 2.5 μL 10× PCR buffer and 0.25 μL Taq DNA polymerase (3 μL). The following gene-specific primers were used: (a) toxA F (CTGCGCGGGTCTATGTGCC) and toxA R (GATGCTGGACGGGTCGAC), (b) plcH F (GCACGTGGTCATCCTGATGC) and plcH R (TCCGTAGGCGTCGACGTAC). PCR conditions remained as initial denaturation at 95°C for 7 min, 30 cycles of denaturation at 95°C for 1 min, annealing at 52 or 53°C for 1 min (for toxA or plcH, respectively), and extension at 72°C for 30 s, followed by a final extension at 72°C for 10 min. Clinical P. aeruginosa isolates—C82, A135, and C69—were used as positive control.

The ability of isolates to produce siderophore was determined by formation of orange halo around bacterial colonies on Chrome Azurol S (CAS) agar plates incubated at 30°C for 48 h (Schwyn and Neilands, 1987). The cultures were inoculated in iron-deficient CAS liquid medium (Schwyn and Neilands, 1987) and incubated on rotary shaker at 120 rpm. Quantitative estimation of siderophores was done by CAS-shuttle assay. One milliliter of culture supernatant was mixed with 1 mL of CAS reagent (10 mM HDTMA; 1 mM FeCl₃ solution; 2 mM CAS solution) and absorbance was measured at 630 nm against a reference, having 1 mL of uninoculated broth and 1 mL of CAS reagent (Payne, 1994). The activity was recorded in “percentage siderophore units” calculated as [(Ar - As) × Ar^-1) × 100]. Where, Ar is the absorbance of reference at 630 nm (un-inoculated media + CAS reagent) and As is the absorbance of sample at 630 nm (culture supernatant + CAS reagent). The type of siderophore produced (catecholate or hydroxamate) was determined according to Arnow’s (1937) and FeCl₃ tests (Meyer et al., 1995).

For the determination of the threshold level of iron for siderophore production, iron content of succinic medium (Sayyed et al., 2005) was varied by the addition of ferric chloride in the range of 0–30 μM concentration. Bacterial strain was inoculated and incubated at 29°C at 120 rpm, and siderophore content was estimated as described above. The siderophore production was quantified twice, each with three replicates.

The indole acetic acid (IAA) production was determined by the method of Loper and Scroth (1986). The isolates were grown on YEMA medium for 5 days. A loopful of the culture was inoculated in different flasks having YEM broth, each supplemented with a different L-tryptophan concentration (0, 0.2, 0.4, 0.6, 0.8, or 1.0%) and incubated at rotatory shaker (150 rpm, 30°C). Production of IAA was measured after every 24 h interval. The cultures were harvested by centrifugation (11,000 × g, 15 min), 1 mL of the supernatant was mixed with 2 mL of Salkowski reagent (50 mL, 35% perchloric acid with 1 mL, 0.5 M FeCl3) (Gordon and Weber, 1951). Optical density (OD) was measured at 530 nm and the amount of IAA produced was quantified by comparing with the standard curve prepared with known concentrations of IAA. The IAA release was quantified twice, each with three replicates.

The ability of isolates to solubilize inorganic phosphate was assayed using modified Pikovskaya medium (Nautiyal, 1999). The halo and colony diameter were measured every 24 h up to 4 days of incubation at 30°C. The solubilization index has been defined as the ratio of the total diameter (colony + halo zone) to the colony diameter (Premono et al., 1996). Quantitative estimation of P content in the supernatant was estimated using the vanado-molybdate colorimetric method (Koenig and Johnson, 1942).

Ability to fix atmospheric nitrogen was screened in nitrogen-free combined carbon (NFCC) supplemented with 0.5 mM glucose (Mirza and Rodrigues, 2012), where semisolid NFCC medium (0.5% agar) was inoculated with test strain and incubated under atmospheric conditions. Nitrogenase activity was determined by acetylene reduction assay to confirm nitrogen fixation ability of isolate by using GC-FID (Hardy et al., 1971). Further, nifH gene was amplified, with a set primer nifH F: 5′-CGTTTTACGGCAAGGGCGGTATCGGCA-3′ and nifH R: 5′-TCCTCCAGCTCCTCCATGGTGATCGG-3′. PCR conditions for the amplification of nifH gene fragment was denaturation at 94°C for 5 min followed by 30 cycles of denaturation at 94°C for 1 min, primer annealing at 51–57°C for 30 s, and elongation at 72°C for 1 min followed by a final step of extension at 72°C for 5 min. Amplified PCR products were resolved on 1% agarose gel. Klebsiella pneumoniae S4C9 was experimented in parallel for nifH amplification as positive control. ACC deaminase activity was screened according to El-Tarabily (2008) using the nitrogen-free Dworkin and Foster’s minimal salts agar medium (Dworkin and Foster, 1958). The solid medium was supplemented with either 2 g (NH₄)₂SO₄ or 3 mM ACC per liter as sole nitrogen source, and incubated aerobically. The growth experiment was conducted twice, on five plates, at each attempt.

The antifungal activity of the isolates was tested in vitro against three strains of pathogenic fungi, i.e., Rhizoctonia solani, Fusarium oxysporum, and Pyricularia oryzae. The antifungal bioassays were performed using dual culture method (Khamna et al., 2009). Three days old culture was spot inoculated at the corners of the PDA plates leaving some distance from the margins. Fungal plug (6 mm) was then placed at the center of the plates. The plates were incubated at 30°C for 5 days. Plates containing fungal plugs without the isolates were used as control. The inhibition zone was measured after the fungal mycelia in the control plates reached the edges of the plates. Growth inhibition was calculated using the formula:

where, C is the radial growth of the test pathogen in the control plates (mm), and T is the radial growth of the test pathogen in the test plates (mm). The dual-culture assay was conducted twice, on three plates, at each attempt.

Micropropagated plantlets of A. aspera were raised from the surface sterilized seeds on half strength Murashige and Skoog (MS) medium. The seeds of A. aspera were placed in the Petri dishes containing 25 mL sterilized half strength of MS medium and incubated at 60% humidity, 24 ± 2°C and 1000 lux light (16 h light and 8 h dark). After 4 weeks, when the seedlings have cotyledons and roots, they were transferred to freshly prepared MS medium and allowed to grow. After development of extensive root system and with six leaflets, the plantlets were gradually acclimatized to natural environment and finally planted in sterile soil under greenhouse conditions (26 ± 2°C and 70% RH).

Bacteria were grown to the mid-log phase, and harvested by centrifugation (6000 × g, 10 min, 24°C). Pellets were washed twice, and suspended in sterilized double distilled water. The suspension was maintained at the OD₆₀₀ of 1.0. To confirm inoculation density and purity, an aliquot of culture was serially diluted in sterile double distilled water and plated on YEMA medium. The plants were inoculated (in triplicate), when a minimum height of 7.5 cm was attained and the stalks were at least 0.5 cm in diameter, which corresponded to 75–80 days after seed germination. A 26-gauge needle attached to a tuberculin syringe containing a bacterial suspension was passed horizontally through the stem just above the first cotyledon leaves of the plant. A 10 μL droplet of suspension was formed at the tip of the needle, which was withdrawn through the plant stem.

AL2-14B was experimented for its colonizing behavior in aerial region of A. aspera. It was inoculated, and re-isolated for estimation of population density, from stem and leaves of experimentally inoculated A. aspera seedlings. Morphological and physiological characteristics of the re-isolated endophytic bacterium were compared to assure it to be AL2-14B. Isolates were further confirmed to be P. aeruginosa AL2-14B based on 16S rRNA sequence similarity. A 10 μL of AL2-14B suspension (OD₆₀₀ = 1.0, which corresponded to 12.9 × 10⁵ CFU/mL), was inoculated into the plant hosts and grown in the greenhouse condition. The bacterial multiplication in the stem and leaves of plants were determined at 3 and 5 days after inoculation (DAI). Lower parts of stems and first leaves were collected from three replicates, weighed, and surface sterilized in 70% ethanol for 15 s, rinsed with double distilled water and macerated with 1 mL of sterile double distilled water. After 20 min, the supernatant were serially diluted and plated on YEMA amended with 25 μg/mL of kanamycin and incubated at 28°C for 48 h. The control plants were inoculated with sterile double distilled water by using the methods used for the experimental plants. Kanamycin was used for screening against any contamination (if any) for AL2-14B, as it was found to be resistant for kanamycin.

Further, the acclimatized plantlets were transferred into bigger pot having diameter of 25 cm² and depth of 20 cm. The pot has the capacity of holding 5 kg of soil:sand (4:1) and kept at randomized block design. The plants were watered every alternative day. The plants were harvested after 150 days and different growth parameters such as shoot length, root length, numbers of leaves, fresh leaf weight, fresh shoot weight, fresh root weight, dry leaf weight, dry shoot weight, dry root weight, and area of the leaf were measured.

Availability of nitrogen, phosphorus, potassium (NPK) in soil, for each treatment was analyzed at initial stage, and after 30 days. Effect of AL2-14B on nutrient uptake of A. aspera L. was analyzed in the leaves of 30 days old seedlings. Total N was estimated by Kjeldahl digestion method, total P in plant samples was estimated by ammonium molybdate method; whereas K was analyzed by flame photometric method.

The pot trial experiment had two treatments (with and without bacterial inoculation) each with three replicates having five plants in each pot and arranged in a completely randomized design. All data were subjected to one-way analysis of variance (ANOVA) followed by independent t-test at P < 0.05 using the SPSS 16 software (SPSS Inc). The CFU data were subjected to single factor ANOVA or t-test (assuming equal variance) using the SPSS 16 software (SPSS Inc.). The mean ± standard deviation values are presented.

The leaves samples were cleaned, dried, and powered with the help of mixer grinder. The powered leaves were extracted with ethanol and water using soxhlet apparatus at 55–85°C for 8–10 h. The free radical scavenging activity of 50% aqueous ethanolic extract of A. aspera L. on stable radical 1,1-diphenyl-2-picrylhydrazyl (DPPH) was evaluated by the method of Brand-Williams et al. (1995). Briefly, 2.0 mL of extract at different concentrations (50–250 μg/mL) was mixed with 2.0 mL of DPPH solution in methanol (0.004% w/v). The mixture was allowed to stand at room temperature in dark for 20 min. The mixture was vortexed and then absorbance was recorded at 517 nm. Ascorbic acid was used as a reference standard and control consisted of DPPH solution without extract. The test was performed in triplicate and percentage scavenging of DPPH free radical by extract was calculated using the equation: [(A_control -A_test) A_control^-1] × 100. Here, A_control was the absorbance of control and A_test was the absorbance in presence of extract or standard. Mean of three determinations was recorded.

β-Carotene bleaching assay was done according Wettasinghe and Shahidi (1999). One milliliter of β-carotene solution (0.2 mg/mL in chloroform) was pipetted into a round bottom flask containing 0.02 mL of linoleic acid and 0.2 mL of 100% Tween-20. The mixture was evaporated in a rotary vacuum evaporator for 10 min to remove chloroform. The mixture was immediately diluted with 100 mL of distilled water with vigorous shaking to form an emulsion. Varying concentrations of extract and standard (100–500 μg/mL) was added to 5 mL of the emulsion in different test-tubes and the mixture was kept at 37°C for 1 h. Absorbance of sample and control was measured at time t = 0 and t = 60 min. Total antioxidant activity was calculated based on the following equation: AA = [1 - (A₀ -A_t) × (A₀⁰ -A_t⁰)^-1] × 100, where AA is antioxidant activity, A₀ and A₀⁰ are the absorbance values measured at the initial incubation time for samples and control, respectively while A_t and A_t⁰ are the absorbance values measured in the samples or standards and control at t = 60 min. Mean of three determinations was recorded.

The reducing power of leaves extract was determined by the method of Jayanthi and Lalitha (2011). Substances possessing reducing power react with potassium ferricyanide (Fe³⁺) to form potassium ferrocyanide (Fe²⁺) which then reacts with ferric chloride to form ferric ferrous complex that has an absorption maximum at 700 nm. Varying concentrations of plant extract and standard (50–250 μg/mL) were mixed with phosphate buffer (2.5 mL) and potassium ferrocyanide (2.5 mL). The mixture was kept at water bath at 50°C for 20 min. After cooling 2.5 mL of 10% trichloroacetic acid was added and centrifuged at 3000 × g for 10 min. The upper layer (2.5 mL) of the resulting solution was mixed with distilled water (2.5 mL) and freshly prepared ferric chloride solution (0.5 mL). The absorbance was measured at 700 nm. Ascorbic acid at various concentration was taken as standard. Increase in absorbance indicated the increase in reducing power of extract as compared to standard. Mean of three determinations was recorded.

Seventy-three isolates were obtained from different area of Manipur, India, as endophytic bacteria from the leaves and stems of A. aspera. One of the isolate, AL2-14B was selected for this study because of its excellent plant growth stimulating attributes. AL2-14B was Gram-negative, catalase and oxidase positive, small rod that forms irregular greenish-brown, circular, and smooth colonies on YEMA. It fermented glucose and lignin but found negative for other carbohydrates such as fructose, mannitol, sucrose, cellulose, and maltose. It was indole negative, methyl red negative, Voges–Proskauer negative and Simmons’ citrate positive. The results of the BLAST analysis of the 1200 bp long 16S rRNA gene sequence indicated that AL2-14B isolate is closely related to P. aeruginosa. Based on the phylogenetic tree constructed with the 16S rRNA similarity (%), it was identified as P. aeruginosa, and maximum similarity was observed with isolate P. aeruginosa JCM 5962T/BAMA01000316 (Figure 1). Strain AL2-14B clustered with Pseudomonas indica and P. aeruginosa. 16S rDNA sequence of strain AL2-14B was submitted to GenBank under accession no. KY0879823.1

The isolate did not show any hemolytic activity on blood agar medium suggesting it to be non-producer of hemolytic cytotoxin. PCR-based screening also confirmed it to be negative for toxA and plcH genes, which has been suggested as marker for pathogenic strains of P. aeruginosa (Sabharwal et al., 2014).

Formation of orange halo zone in CAS medium inoculated with AL2-14B was observed after 24 h, which indicated the production of siderophore. The zone size increased with time. Zone of siderophore produced at 96 h was found to be 40% higher than that of zone produced at 24 h. Siderophore release was further confirmed by quantitative CAS test where instant decolourization of CAS reagent from blue to orange was observed. A total of 71.806% unit of siderophore was recorded for AL2-14B in succinate broth (Figure 2A). In P. aeruginosa AL2-14B, the siderophore production was found to start after 24 h of incubation in SM broth and maximum siderophore was released after 72 h of incubation (71.806% units) (Figure 2B). It was evident that the siderophore production was high at late log phase, and amount of siderophore release was in accordance with the growth profile of isolate AL2-14B.

The isolate AL2-14B was screened for the ability to produce IAA. Varying levels of IAA production was recorded with different concentration of L-tryptophan (0, 0.2, 0.4, 0.6, 0.8, and 1.0%). The IAA production was in the range of 6.64–114.79 μg/mL. A 1.0% concentration of L-tryptophan was found to be optimum for IAA production by this isolate. IAA production decreased at higher concentrations of tryptophan (Figure 3A). The amount of 1AA production was maximum after 96 h of incubation for all the concentrations of tryptophan, except 0.6% (Figure 3A).

AL2-14B solubilized tri calcium phosphate in Pikovskaya’s agar, forming a clear halo around the colony (Figure 3B). The phosphate solubilization index of the isolate was found to be in the range of 2.33 ± 0.17 to 3.66 ± 0.28, between 24 and 96 h. The pH of the medium decreased with increase in the amount of free phosphate released, showing maximum P solubilization at pH 3.9 after 144 h of incubation (383 μg/mL) (Figure 3B). The correlation coefficient (r) between free P concentrations against pH after various durations was calculated and found to be (-) 0.9683.

Further, the isolate was found to have nitrogen fixation ability. The growth of AL2-14B in NFCC medium, was observed to be close to surface, but not on surface. The ability to fix nitrogen was further confirmed by quantifying Nitrogenase activity, and it was found to be 1.8617 ± 0.31 nmol ethylene/μg/protein/h as detected using GC-FID technique (Figure 3C). Further, N-fixing ability was confirmed by the presence of nifH gene, and desired amplicon of 781 bp corresponding to nifH gene was obtained in P. aeruginosa AL2-14B (Figure 3C). The isolate was unable to growth on minimal salt medium amended with ACC, which indicate that AL2-14B did not produce ACC deaminase.

The isolate AL2-14B showed considerable inhibition of mycelial growth, because of release of diffusible compound(s) against R. solani. Percentage of growth inhibition was found to be 68.75 ± 2.72% (Figure 4). However, there was no zone of inhibition observed with F. oxysporum and P. oryzae, suggesting limited antifungal activity in AL2-14B.

During in vitro propagation of A. aspera in germ free condition, 29% of seeds germinated in half strength MS medium as compared to full strength MS medium, in which only 22% seeds germinated. Better germination was observed in seeds without husk, as compared to husk coated seeds. The colonization ability of AL2-14B was determined, and it was found that the population of AL2-14B increased from 70 × 10⁶ to 32.3 × 10¹⁰ CFU/g (fresh weight) between 3rd and 5th DAI (Table 1) in stem of seedlings. Further, AL2-14B was not detected in leaves till 3 DAI. However, after 5 DAI, 11.3 × 10⁴ CFU/g of AL2-14B was recovered from leaves of bacteria-treated A. aspera plants. The representative control trials yielded no other indigenous bacteria.

Inoculation of endophytic bacteria AL2-14B in host plant resulted increase in all growth parameters of A. aspera L. It significantly increased shoot length by 72.83 ± 1.24% (P < 0.05), fresh shoot weight by 302 ± 2.74% (P < 0.05), dry shoot weight by 486 ± 1.43% (P < 0.05), fresh root weight by 385.71 ± 3.69% (P < 0.05), dry root weight by 700 ± 3.92% (P < 0.05), and area of leaves by 135.28 ± 1.6% (P < 0.05) (Table 2 and Figure 5). Further, the NPK concentration, i.e., the availability was estimated in the soil planted with A. aspera L. (without inoculation) at the 1st day and after 30th day of the treatments. It showed that the NPK concentration in soil at the 1st day was 42 ± 0.63, 35.42 ± 2.11, and 80.5 ± 2.38 mg/kg, respectively, which was found to decreased in inoculated with AL2-14B. The NPK content in soil in which AL2-14B was inoculated with plants, decreased up to 36 ± 0.13, 33 ± 0.86, and 39.2 ± 0.5.11 mg/kg, respectively. Again, the uptake of NPK was analyzed by estimating their concentration in the leaves. In the case of control plant (without inoculation), the NPK content in leaves was found to be 29,400 ± 121, 2300.85 ± 24.2, and 48,550 ± 234 mg/kg, respectively. The NPK content in leaves with AL2-14B was significantly higher, recorded as 30,520 ± 320 mg/kg (P < 0.05), 2589.64 ± 64 mg/kg (P < 0.05), and 57850 ± 199 mg/kg (P < 0.001), respectively. The plants were grown till 150 days for estimation of growth parameters.

Achyranthes aspera L. plant treated with the isolate AL2-14B showed higher DPPH radical scavenging activity compared to control plant (Figure 6A). The free radical scavenging activity of the extract was concentration dependent. The values of DPPH activity of treated plant ranged from 9.34 ± 2.12 to 39.36 ± 3.26 while the values of DPPH activity of control plants were in the range of 5.24 ± 1.28 to 29.1 ± 2.52. IC₅₀ was observed at a concentration of 6.41 ± 0.11 mg/mL for DPPH free radical scavenging activity of AL2-14B with the control plant having IC₅₀ of 8.11 ± 0.24 mg/mL (Figure 6B).

β-Carotene-linoleic acid content of extract was found to be more in AL2-14B inoculated plants as compared to control. However, the difference in the activity was not significant (P < 0.05). In fact, the activity of the plant treated with AL2-14B ranged from 15.77 to 78.85 while that of un-inoculated control plant were in the range of 15.35–76.76 (Figure 6C).

The reducing power of the plant extract increased with respective increase in concentration. The reducing power of A. aspera L. leaves inoculated with AL2-14B was found to be higher than that of control plant. The values ranged from 0.452 to 1.122 in inoculated plant but in control plant the values were found in the range from 0.342 to 0.951. For each concentration of extract, the reducing power was found to be significantly higher (P < 0.05). The results for reducing power activity of A. aspera leaves extract are given in Figure 6D.