Front. Microbiol. Frontiers in Microbiology Front. Microbiol. 1664-302X Frontiers Media S.A. 10.3389/fmicb.2017.01780 Microbiology Correction Corrigendum: Microbiome of Trichodesmium Colonies from the North Pacific Subtropical Gyre Gradoville Mary R. 1 * † Crump Byron C. 1 Letelier Ricardo M. 1 Church Matthew J. 2 White Angelicque E. 1 1College of Earth, Ocean and Atmospheric Sciences, Oregon State University Corvallis, OR, United States 2Flathead Lake Biological Station, University of Montana MT, United States

Edited and reviewed by: Sophie Rabouille, Centre National de la Recherche Scientifique (CNRS), France

*Correspondence: Mary R. Gradoville mgradoville@ucsc.edu

This article was submitted to Aquatic Microbiology, a section of the journal Frontiers in Microbiology

†Present Address: Mary R. Gradoville, Ocean Sciences Department, University of Santa Cruz, Santa Cruz, CA, United States

 19 09 2017 2017 8 1780 14 08 2017 01 09 2017 Copyright © 2017 Gradoville, Crump, Letelier, Church and White. 2017 Gradoville, Crump, Letelier, Church and White

This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.

 A corrigendum on Microbiome of Trichodesmium Colonies from the North Pacific Subtropical Gyre by Gradoville, M. R., Crump, B. C., Church, M. J., Letelier, R. M., and White, A. E. (2017). Front. Microbiol. 8:1122. doi: 10.3389/fmicb.2017.01122 Trichodesmium marine microbiome nifH diversity heterotrophic marine diazotrophs metagenomics 16S rRNA nitrogen fixation

In the original article, there were two errors. First, an incorrect NCBI accession number was provided. A correction has been made to Methods, Bioinformatic Analyses, Paragraph 4:

“All raw sequences are available from NCBI (accession SRP095769). Assemblies and annotation data are available from IMG/M ER (http://img.jgi.doe.gov/mer; Taxon OIDs 3300009572, 3300009536, and 3300010936).”

Additionally, in the original article, the two primer sets used for nested nifH PCR were listed in the incorrect order and included an incorrect reference. A correction has been made to Methods, Nucleic Acid Extraction, Amplification, and Sequencing, Paragraph 3:

“The nifH gene was amplified using nested degenerate nifH primers (Zehr and McReynolds, 1989; Zani et al., 2000). The first round contained 1X PCR buffer, 0.1U Platinum High Fidelity Taq polymerase (Invitrogen), 200 μmol L−1 dNTPs, 3% BSA, 4 mmol L−1 Mg2+, 1 μL DNA or cDNA, and 1 μmol L−1 nifH3 and nifH4 primers (Zani et al., 2000). Reaction conditions were: 94°C for 7 min, followed by 30 cycles of 94°C for 1 min, 57°C for 1 min, and 72°C for 1 min, and a final 72°C extension for 7 min. The second round of nifH PCR used the same components and thermocycling conditions as the first round, except the DNA extract was replaced with 1 μL of the amplified product generated during the first round PCR reaction, and custom primers were used, consisting of gene-specific sites (nifH1 and nifH2), dual- indexed barcodes, Illumina linkers, and a sequencing primer binding region, similar to those described by Kozich et al. (2013; Table S1). PCR negative controls and filter blank samples were included in PCR reactions.”

Finally, there was a mistake in the legend for Supplementary Table 1 as published. This table listed the incorrect nifH primer names. The correct legend appears below.

Table S1: Dual-index barcoded, forward and reverse nifH primers (5′ -> 3′) used in this study. Sample barcodes are shown in bold. Forward and reverse nifH PCR primers are indicated by nifH1 (TGYGAYCCNAARGCNGA) and nifH2 (ADNGCCATCATYTCNCC; note the misprint of this primer in the original manuscript by Zani et al., 2000). NNNN indicate Illumina linker regions: AATGATACGGCGACCACCGAGATCTACAC (forward) and CAAGCAGAAGACGGCATACGAGAT (reverse). Blue text indicates the binding site for sequencing primers, which were designed to optimize melting temperature during sequencing, as described by Kozich et al. (2013).

The authors apologize for these errors and state that they do not change the scientific conclusions of the article in any way.

Conflict of interest statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

 References Kozich J. J. Westcott S. L. Baxter N. T. Highlander S. K. Schloss P. D. (2013). Development of a dual-index sequencing strategy and curation pipeline for analyzing amplicon sequence data on the MiSeq Illumina sequencing platform. Appl. Environ. Microbiol. 79, 5112–5120. 10.1128/AEM.01043-1323793624 Zani S. Mellon M. T. Collier J. L. Zehr J. P. (2000). Expression of nifH genes in natural microbial assemblages in Lake George, New York, detected by reverse transcriptase PCR. Appl. Environ. Microbiol. 66, 3119–3124. 10.1128/AEM.66.7.3119-3124.200010877818 Zehr J. P. McReynolds L. A. (1989). Use of degenerate oligonucleotides for amplification of the nifH gene from the marine cyanobacterium Trichodesmium thiebautii. Appl. Environ. Microbiol. 55, 2522–2526. 2513774