<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Microbiol.</journal-id>
<journal-title>Frontiers in Microbiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Microbiol.</abbrev-journal-title>
<issn pub-type="epub">1664-302X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fmicb.2017.01715</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Microbiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Chalcone Attenuates <italic>Staphylococcus aureus</italic> Virulence by Targeting Sortase A and Alpha-Hemolysin</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name><surname>Zhang</surname> <given-names>Bing</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="author-notes" rid="fn004"><sup>&#x02020;</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/394219/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Teng</surname> <given-names>Zihao</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="author-notes" rid="fn004"><sup>&#x02020;</sup></xref>
</contrib>
<contrib contrib-type="author">
<name><surname>Li</surname> <given-names>Xianhe</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/434936/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Lu</surname> <given-names>Gejin</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/434762/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Deng</surname> <given-names>Xuming</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/377156/overview"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Niu</surname> <given-names>Xiaodi</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="author-notes" rid="fn001"><sup>&#x0002A;</sup></xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Wang</surname> <given-names>Jianfeng</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="author-notes" rid="fn002"><sup>&#x0002A;</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/434710/overview"/>
</contrib>
</contrib-group>
<aff id="aff1"><sup>1</sup><institution>Key Laboratory of Zoonosis, Ministry of Education, College of Veterinary Medicine, Jilin University</institution> <country>Changchun, China</country></aff>
<aff id="aff2"><sup>2</sup><institution>Center of Infection and Immunity, The First Hospital, Jilin University</institution> <country>Changchun, China</country></aff>
<author-notes>
<fn fn-type="edited-by"><p>Edited by: Hui Wu, University of Alabama at Birmingham, United States</p></fn>
<fn fn-type="edited-by"><p>Reviewed by: Shashank Gupta, Brown University, United States; Devendra Hiraman Dusane, The Ohio State University, United States</p></fn>
<fn fn-type="corresp" id="fn001"><p>&#x0002A;Correspondence: Xiaodi Niu <email>niuxd&#x00040;jlu.edu.cn</email></p></fn>
<fn fn-type="corresp" id="fn002"><p>Jianfeng Wang <email>wjf927&#x00040;jlu.edu.cn</email></p></fn>
<fn fn-type="other" id="fn003"><p>This article was submitted to Infectious Diseases, a section of the journal Frontiers in Microbiology</p></fn>
<fn fn-type="other" id="fn004"><p>&#x02020;These authors have contributed equally to this work.</p></fn></author-notes>
<pub-date pub-type="epub">
<day>06</day>
<month>09</month>
<year>2017</year>
</pub-date>
<pub-date pub-type="collection">
<year>2017</year>
</pub-date>
<volume>8</volume>
<elocation-id>1715</elocation-id>
<history>
<date date-type="received">
<day>27</day>
<month>04</month>
<year>2017</year>
</date>
<date date-type="accepted">
<day>24</day>
<month>08</month>
<year>2017</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#x000A9; 2017 Zhang, Teng, Li, Lu, Deng, Niu and Wang.</copyright-statement>
<copyright-year>2017</copyright-year>
<copyright-holder>Zhang, Teng, Li, Lu, Deng, Niu and Wang</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/"><p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p></license>
</permissions>
<abstract><p><italic>Staphylococcus aureus</italic> (<italic>S</italic>.aureus) resistance, considered a dilemma for the clinical treatment of this bacterial infection, is becoming increasingly intractable. Novel anti-virulence strategies will undoubtedly provide a path forward in combating these resistant bacterial infections. Sortase A (SrtA), an enzyme responsible for anchoring virulence-related surface proteins, and alpha-hemolysin (Hla), a pore-forming cytotoxin, have aroused great scientific interest, as they have been regarded as targets for promising agents against <italic>S. aureus</italic> infection. In this study, we discovered that chalcone, a natural small compound with little anti-<italic>S. aureus</italic> activity, could significantly inhibit SrtA activity with an IC<sub>50</sub> of 53.15 &#x003BC;M and Hla hemolysis activity with an IC<sub>50</sub> of 17.63 &#x003BC;M using a fluorescence resonance energy transfer (FRET) assay and a hemolysis assay, respectively. In addition, chalcone was proven to reduce protein A (SpA) display in intact bacteria, binding to fibronectin, formation of biofilm and <italic>S. aureus</italic> invasion. Chalcone could down-regulate the transcriptional levels of the <italic>hla</italic> gene and the <italic>agrA</italic> gene, thus leading to a reduction in the expression of Hla and significant protection against Hla-mediated A549 cell injury; more importantly, chalcone could also reduce mortality in infected mice. Additionally, molecular dynamics simulations and mutagenesis assays were used to identify the mechanism of chalcone against SrtA, which implied that the inhibitory activity lies in the bond between chalcone and SrtA residues Val168, Ile182, and Arg197. Taken together, the <italic>in vivo</italic> and <italic>in vitro</italic> experiments suggest that chalcone is a potential novel therapeutic compound for <italic>S. aureus</italic> infection via targeting SrtA and Hla.</p></abstract>
<kwd-group>
<kwd><italic>Staphylococcus aureus</italic></kwd>
<kwd>sortase A</kwd>
<kwd>alpha-hemolysin</kwd>
<kwd>chalcone</kwd>
<kwd>inhibitor</kwd>
</kwd-group>
<counts>
<fig-count count="7"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="46"/>
<page-count count="12"/>
<word-count count="7957"/>
</counts>
</article-meta>
</front>
<body>
<sec sec-type="intro" id="s1">
<title>Introduction</title>
<p><italic>Staphylococcus aureus</italic> (<italic>S. aureus</italic>) is the etiologic agent of a wide range of clinical infections, including bacteremia, infective endocarditis, and osteoarticular infections, as well as skin and soft tissue infections and metastatic abscess formation (Lowy, <xref ref-type="bibr" rid="B24">1998</xref>; Coates et al., <xref ref-type="bibr" rid="B8">2014</xref>). The continuous emergence of <italic>S. aureus</italic> strains developing a resistance to antibiotics, such as methicillin-resistant <italic>S. aureus</italic> (MRSA) and vancomycin-resistant <italic>S. aureus</italic> (VASA), has been largely responsible for the severe clinical complications and increase in the incidence rate of unfavorable prognoses (Ippolito et al., <xref ref-type="bibr" rid="B18">2010</xref>; Gould, <xref ref-type="bibr" rid="B15">2013</xref>). Simultaneously, there are few high-efficiency antibiotics in the drug discovery pipeline. Thus, treatment options are severely limited. The pressing challenge is the identification of new drug targets and the discovery of new agents against <italic>S. aureus</italic> infection.</p>
<p>A formidable array of secreted exotoxins and surface proteins anchored in the cell wall plays a crucial role in the pathogenic process of <italic>S. aureus</italic> (Dinges et al., <xref ref-type="bibr" rid="B9">2000</xref>; Wardenburg et al., <xref ref-type="bibr" rid="B43">2007</xref>). Among all of the virulence factors, sortase and alpha-hemolysin (Hla) generate the most interest. Interest in sortase as a target for the establishment of anti-virulence strategies primarily stems from studies in which loss of the gene encoding sortase led to the decreased virulence of <italic>S. aureus</italic> in a mouse model of <italic>S. aureus</italic> infection (Albus et al., <xref ref-type="bibr" rid="B1">1991</xref>; Mazmanian et al., <xref ref-type="bibr" rid="B26">2000</xref>). As the so-called &#x0201C;house-keeping&#x0201D; sortase, sortase A (SrtA) plays a critical role in the anchoring of surface proteins of <italic>S. aureus</italic> to the cell wall envelope. Surface proteins of Gram-positive bacteria, as one of the virulence factors, play a significant part in the process of invading the host. One of the shared features of these proteins that mediate bacterial adhesion and evade host immune defenses is that they all contain LPXTG (Leu-Pro-X-Thr-Gly) sorting signals, which SrtA can identify and use to catalyze the anchor further (Fischetti et al., <xref ref-type="bibr" rid="B12">1990</xref>; Scott and Barnett, <xref ref-type="bibr" rid="B40">2006</xref>). Soon after SrtA was discovered and cloned, many studies reported that the <italic>in vivo</italic> inhibition of SrtA could be measured. Subsequently, a number of SrtA inhibitors, including natural products and synthetic small molecules, among others, were identified (Clancy et al., <xref ref-type="bibr" rid="B6">2010</xref>; Zhang et al., <xref ref-type="bibr" rid="B45">2014</xref>, <xref ref-type="bibr" rid="B44">2016</xref>; Lin et al., <xref ref-type="bibr" rid="B22">2015</xref>).</p>
<p>Another important target, Hla, which is encoded by the <italic>hla</italic> gene and is generally secreted late in the exponential phase of growth, is a water-soluble pore-forming cytotoxin leading to the damage and death of cells, such as erythrocytes and epithelial cells, owing to its lytic property (Berube and Bubeck, <xref ref-type="bibr" rid="B3">2013</xref>). Previous studies reported that Hla damaged the air-blood barrier of the lung in a rat model, and similar to sortase, <italic>S. aureus</italic> lacking Hla exhibited an obvious attenuated pathogenicity in a mouse model of <italic>S. aureus</italic> infection (Mcelroy et al., <xref ref-type="bibr" rid="B27">1999</xref>; Wardenburg et al., <xref ref-type="bibr" rid="B43">2007</xref>). A number of previous studies have shown that inhibitors targeting Hla could significantly prevent MASA infection, indicating a novel and effective strategy for combating <italic>S. aureus</italic> (Ragle et al., <xref ref-type="bibr" rid="B36">2010</xref>).</p>
<p>Notably, an anti-virulence strategy targeting sortase or Hla was able to disrupt the pathogenesis of bacterial infections without a direct interference with bacterial growth (Levy et al., <xref ref-type="bibr" rid="B20">1976</xref>) and, thus, may be less likely to induce selective pressures and may slow down the development of drug resistance. In addition, we reasoned that a strategy simultaneously targeting both sortase and Hla could cause a double blow to <italic>S. aureus</italic> infection and thereby represent a more effective anti-infection treatment. In this study, we first found that one class of dietary compound, called chalcone (Figure <xref ref-type="fig" rid="F1">1A</xref>), could be a promising inhibitor for targeting both <italic>S. aureus</italic> SrtA and Hla and then systematically evaluated the inhibitory activity of chalcone with a fluorescence resonance energy transfer (FRET) assay and a hemolysis assay, respectively, where chalcone was found to significantly neutralize SrtA activity and inhibit Hla production. The therapeutic effect in a <italic>S. aureus</italic> infection mouse model was found to be obvious as well. With these approaches, we provide powerful evidence that chalcone is a potential agent for the treatment of <italic>S. aureus</italic> infection via targeting SrtA and Hla.</p>
<fig id="F1" position="float">
<label>Figure 1</label>
<caption><p>Chalcone inhibits <italic>S. aureus</italic> SrtA activity. <bold>(A)</bold> The inhibitory effect of chalcone on <italic>S. aureus</italic> SrtA activity. After pre-incubation with various concentrations of chalcone, followed by adding the model substrate peptide Dabcyl-QALPETGEE-Edans, a microplate reader was used to determine the catalytic activity of each sample. <bold>(B)</bold> The growth curve of <italic>S. aureus</italic> treated with the indicated concentrations of chalcone.</p></caption>
<graphic xlink:href="fmicb-08-01715-g0001.tif"/>
</fig>
</sec>
<sec sec-type="methods" id="s2">
<title>Methods</title>
<sec>
<title>Bacterial strains, growth conditions, and reagents</title>
<p><italic>Staphylococcus aureus</italic> strain USA 300 and <italic>S. aureus</italic> &#x00394;SrtA strain USA 300 &#x00394;SrtA, obtained from our lab, were used in the present study and cultured in brain-heart infusion (BHI) broth (Sigma) at 37&#x000B0;C. Chalcone was purchased from the Tianjin Yifang S&#x00026;T Co., Ltd. (Tianjin, China). The fluorescent peptide Dabcyl-QALPETGEE-Edans was purchased from GL Biochem (Shanghai, China).</p>
</sec>
<sec>
<title>Construction of plasmids encoding wild-type (WT)-SrtA, V168A-SrtA, I182A-SrtA, and R197A-SrtA</title>
<p>The DNA sequence encoding the WT-SrtA protein was amplified from <italic>S. aureus</italic> USA 300 genomic DNA and used as a template along with the corresponding primers (Table <xref ref-type="table" rid="T1">1</xref>) to amplify the <italic>S. aureus</italic> SrtA sequence through PCR. The PCR products were digested with Nde1 and BamH1 and then cloned into the pGEX-6P-1 expression vector. The pGEX-6P-1-<italic>srtA</italic> plasmid encoding WT-SrtA was generated after the sequence was confirmed by DNA sequencing. Site-directed mutagenesis for V168A-SrtA, I182A-SrtA, and R197A-SrtA was carried out using the QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA). The mutagenic primer pairs employed to produce the three mutants are listed in Table <xref ref-type="table" rid="T1">1</xref>.</p>
<table-wrap position="float" id="T1">
<label>Table 1</label>
<caption><p>Oligonucleotide primers used in this study.</p></caption>
<table frame="hsides" rules="groups">
<thead><tr>
<th valign="top" align="left"><bold>Primer name</bold></th>
<th valign="top" align="left"><bold>Oligonucleotide(5&#x02013;3)<xref ref-type="table-fn" rid="TN1"><sup>a</sup></xref></bold></th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">WT-SrtA-F</td>
<td valign="top" align="left">GCG<underline>GGATCC</underline>CAAGCTAAACCTCAAATTCC</td>
</tr>
<tr>
<td valign="top" align="left">WT-SrtA-R</td>
<td valign="top" align="left">CCG<underline>CTCGAG</underline>TTATTTGACTTCTGTAGCTACAA</td>
</tr>
<tr>
<td valign="top" align="left">V168A-SrtA-F</td>
<td valign="top" align="left">CCTACAGATGTAGGA<underline>GCG</underline>CTAGATGAACAAAAAGG</td>
</tr>
<tr>
<td valign="top" align="left">V168A-SrtA-R</td>
<td valign="top" align="left">CCTTTTTGTTCATCTAG<underline>CGC</underline>TCCTACATCTGTAGG</td>
</tr>
<tr>
<td valign="top" align="left">I182A-SrtA-F</td>
<td valign="top" align="left">GATAAACAATTAACATTA<underline>GCG</underline>ACTTGTGATGATTACAATG</td>
</tr>
<tr>
<td valign="top" align="left">I182A-SrtA-R</td>
<td valign="top" align="left">CATTGTAATCATCACAAGT<underline>CGC</underline>TAATGTTAATTGTTTATC</td>
</tr>
<tr>
<td valign="top" align="left">R197A-SrtA-F</td>
<td valign="top" align="left">GACAGGCGTTTGGGAAAAA<underline>GCG</underline>AAAATCTTTGTAGCTACAG</td>
</tr>
<tr>
<td valign="top" align="left">R197A-SrtA-R</td>
<td valign="top" align="left">CTGTAGCTACAAAGATTTT<underline>CGC</underline>TTTTTCCCAAACGCCTGTC</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="TN1">
<label>a</label>
<p><italic>Restriction endonuclease recognition sites or mutated codons are underlined</italic>.</p></fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec>
<title>Expression and purification of WT-SrtA, V168A-SrtA, I182A-SrtA, and R197A-SrtA</title>
<p>WT-SrtA and all mutant constructs were transformed into <italic>Escherichia coli</italic> BL21 (DE3) cells. Subsequently, the transformants were grown and selected in Luria-Bertani (LB) media with ampicillin (100 mg/L) at 37&#x000B0;C. To induce protein expression, 1 mM IPTG (Sigma) was added into the bacteria suspension when the OD (600 nm) reached 0.6&#x02013;0.8, followed by overnight growth at 16&#x000B0;C. The bacteria were harvested through centrifugation at 3,000 &#x000D7; g for 30 min at 4&#x000B0;C and resuspended in the reaction buffer (50 mM Tris-HCl, 5 mM CaCl<sub>2</sub> and 150 mM NaCl, pH 7.5). The cell debris was removed through centrifugation at 10,000 &#x000D7; g for 1 h at 4&#x000B0;C after sonication. The supernatant was applied to a self-packaged GST-affinity column (2 ml glutathione Sepharose 4B) (GE Amersham Biosciences, Piscataway, NJ, USA). First, the reaction buffer was used to remove the unbound contaminating proteins, then Precision Protease was used to digest the GST-tagged protein at 4&#x000B0;C overnight. Finally, the reaction buffer was used again to wash off the target protein. The point mutations V168A-SrtA, I182A-SrtA, and R197A-SrtA were expressed and purified similarly to WT-SrtA.</p>
</sec>
<sec>
<title>WT and mutant SrtA activity measurement</title>
<p>To measure the activity of WT and mutant SrtA, a FRET assay was used. As detailed earlier (Tonthat et al., <xref ref-type="bibr" rid="B41">1999</xref>), 100 &#x003BC;l of a mixture consisting of the reaction buffer, purified proteins and different concentrations of chalcone were added in the appropriate order to 96-well plates and incubated for 30 min at 37&#x000B0;C. Subsequently, upon the addition of the fluorescent peptide substrate Dabcyl-QALPETGEE-Edans, the reaction was initiated, and after incubation for 1 h at 37&#x000B0;C, the fluorescence was read using emission and excitation wavelengths of 350 and 520 nm, respectively.</p>
</sec>
<sec>
<title><italic>Anti-S. aureus</italic> activity of chalcone</title>
<p>The minimum inhibitory concentration (MIC) of chalcone against <italic>S. aureus</italic> was determined by broth microdilution according to the NCCLS guideline M<sub>31</sub>-A<sub>2</sub>. For growth curve plotting, 1 ml of the overnight bacterial cultures was transferred (1: 50) to BHI broth containing different concentrations of chalcone. The absorbance reading was taken at OD (600 nm)<sub>.</sub></p>
</sec>
<sec>
<title>Protein A (SpA)-related fluorescence analysis</title>
<p>Overnight cultures of <italic>S. aureus</italic> wild-type strain (WT strain) were inoculated 1: 1000 into fresh BHI broth and grown to an OD (600 nm) of 1.0 with chalcone or dimethyl sulfoxide (DMSO, as the solvent control) at 37&#x000B0;C. Meanwhile, the USA300 &#x00394;SrtA strain (WT&#x00394;SrtA strain) was used as the positive control. The bacteria were fixed with a 4% formaldehyde solution for 20 min after centrifugal collection (3,000 &#x000D7; g for 5 min) and washed twice with PBS. The bacteria were then resuspended in PBS containing a 1: 25 dilution of FITC-labeled goat anti-rabbit IgG (eBioscience) and incubated for 2.5 h at room temperature. Subsequently, the cells were washed three times with PBS and added to poly-L-lysine-coated glass slides. The SpA-related fluorescence was observed using a confocal laser-scanning microscope (Olympus, Shanghai, China).</p>
</sec>
<sec>
<title>Fibronectin-binding assay</title>
<p>The WT strain was grown in BHI broth to an OD (600 nm) of 0.5 with chalcone or DMSO in a shaking incubator with a shaker rate of 190 rpm at 37&#x000B0;C; the WT&#x00394;SrtA strain was used as a positive control. The bacteria were collected centrifugally (3,000 &#x000D7; g for 5 min), and after washing with PBS three times, the cells were resuspended using PBS and adjusted to an OD (600 nm) of 1.0. Fibronectin from bovine plasma with a concentration of 2 &#x003BC;g/ml was added into 96-well flat-bottom polystyrene microtiter plates, 100 &#x003BC;l in every well, and incubated overnight at 4&#x000B0;C. After washing three times with PBS, 100 &#x003BC;l of bovine serum albumin (BSA) at a concentration of 5% was added into the plate and incubated for 2 h at 37&#x000B0;C. The plates were washed three times afterwards, then 100 &#x003BC;l of the bacterial suspension was added and incubated for 2 h at 37&#x000B0;C. Subsequently, after removing the suspension and washing three times with PBS, 100 &#x003BC;l of crystal violet with a concentration of 0.4% was added and incubated for 30 min at 37&#x000B0;C. The absorbance of the plates was then read at 570 nm with a microplate reader (Tecan, Austria) after the plates were washed again and dried.</p>
</sec>
<sec>
<title>Biofilm formation assay</title>
<p>The WT strain was grown in BHI broth to an OD (600 nm) of 0.6 with chalcone or DMSO with a shaker rate of 190 rpm at 37&#x000B0;C (the WT&#x00394;SrtA strain was used as the positive control), and then, 10 &#x003BC;l of the bacterial solution was added into the 96-well flat-bottom polystyrene microtiter plates containing 290 ml BHI of broth and 3% (w/v) sucrose with or without chalcone. The mixture was incubated anaerobically under still culture conditions for 18 h at 37&#x000B0;C. After incubation, the liquid containing the bacteria and medium was removed, followed by the addition of 100 &#x003BC;l of 10% formaldehyde solution, which was then left overnight at room temperature to fix the biofilm. Subsequently, the formaldehyde was removed, and each well was stained with 100 &#x003BC;l of 0.1% v/v crystal violet for 30 min at room temperature. After rinsing with double distilled water and drying, 200 &#x003BC;l of 33% acetic acid was added to each well and all of the contents were mixed manually. The absorbance of the plates was subsequently read at 490 nm.</p>
</sec>
<sec>
<title>Cell invasion assays</title>
<p>J774 cells were suspended in DMEM / HIGH GLUCOSE supplemented with 10% heat-inactivated fetal bovine serum (HI-FBS; Invitrogen), and approximately 3 &#x000D7; 10<sup>5</sup> cells were seeded into each well of 24-well flat-bottom polystyrene microtiter plates containing 12 mm diameter coverslips overnight (37&#x000B0;C, 5% CO<sub>2</sub>). The WT strain was grown in BHI broth to an OD (600 nm) of 1.0 with chalcone or DMSO in a shaking incubator with a shaker rate of 190 rpm at 37&#x000B0;C; the WT&#x00394;SrtA strain was used as the positive control. The bacteria were then adjusted to an OD (600 nm) of 1.0, and 1 ml of the bacterial solution was added into each well and incubated for 60 min at 37&#x000B0;C. After each well was washed three times with PBS, 1 ml of DMEM / HIGH GLUCOSE supplemented with 300 &#x003BC;g / ml gentamicin was added and incubated for 30 min at 37&#x000B0;C. The J774 cells on the coverslips were then lysed in the sterile distilled water and plated onto BHI broth agar plates for CFU after washing three times with PBS. The plates were placed overnight at 37&#x000B0;C.</p>
</sec>
<sec>
<title>Molecular modeling</title>
<p>In this work, the initial structure of SrtA was obtained from the X-ray crystallography 3D structure (PDB code: 3CI5). To obtain the starting structure of the ligand/SrtA complex for a molecular dynamics (MD) simulation, a standard docking procedure for a rigid protein and a flexible ligand was performed with AutoDock 4 (Morris et al., <xref ref-type="bibr" rid="B29">2009</xref>; Hu et al., <xref ref-type="bibr" rid="B17">2010</xref>). Subsequently, the molecular dynamics simulation of the complex&#x00027;s systems was performed, and the details of the processes of the computational biology method were described in a previous report (Dong et al., <xref ref-type="bibr" rid="B10">2013</xref>; Lv et al., <xref ref-type="bibr" rid="B25">2013</xref>; Niu et al., <xref ref-type="bibr" rid="B30">2013</xref>).</p>
</sec>
<sec>
<title>Binding affinity determination of ligands with proteins</title>
<p>In our paper, the fluorescence-quenching method was used to measure the binding constants (<italic>K</italic><sub><italic>A</italic></sub>) of ligands with proteins. A 280-nm excitation wavelength with a 5-nm bandpass and a 345-nm emission wavelength with a 10-nm bandpass were used for the measurements. Details of the measurements were described previously (Bandyopadhyay et al., <xref ref-type="bibr" rid="B2">2002</xref>; Jurasekova et al., <xref ref-type="bibr" rid="B19">2009</xref>).</p>
</sec>
<sec>
<title>Hemolysis assay</title>
<p>Overnight cultures of the WT strain were inoculated 1: 100 into fresh BHI broth and grown to an OD (600 nm) of 0.3 at 37&#x000B0;C. DMSO or different concentrations of chalcone were then added for further culture. To determine the effect of chalcone on the hemolysis activity of <italic>S. aureus</italic>, 1 ml of supernatant was harvested (3,000 &#x000D7; g, 5 min), and 100 &#x003BC;l of the bacterial culture supernatants were incubated with rabbit erythrocytes whose final concentration was 2.5% in PBS at 37&#x000B0;C for 20 min, after which the samples were centrifuged (10,000 &#x000D7; g, 1 min). Finally, the release of hemoglobin was measured at OD (543 nm).</p>
<p>To determine the effect of chalcone on hemolysis induced by the bacterial culture supernatants, the bacterial supernatants were pre-cultured with different concentrations of chalcone as described above.</p>
</sec>
<sec>
<title>Western blotting assay</title>
<p>An equal volume of the bacterial culture supernatants that were harvested in the hemolysis assay was resolved using SDS-PAGE, and the proteins were transferred onto PVDF membranes. After blocking in 5% non-fat milk for 2 h, the membranes were incubated with a primary rabbit anti-Hla antibody (Sigma-Aldrich) diluted 1: 8,000 for 2 h and a horseradish peroxidase-conjugated secondary antibody (Proteintech) diluted 1: 4,000 for 2 h. The signals were visualized on a Tanon-4200 imager using Amersham ECL Western blotting detection reagents (GE Healthcare, Buckinghamshire, UK).</p>
</sec>
<sec>
<title>Real-time RT-PCR assay</title>
<p>The WT strain with DMSO or various concentrations of chalcone was cultured and grown to an OD (600 nm) of 2.5 at 37&#x000B0;C. As described previously (Qiu et al., <xref ref-type="bibr" rid="B35">2011</xref>), the total RNA from the cultured bacteria was isolated and then reverse transcribed into cDNA using the Takara RNA PCR kit (AMV), ver. 3.0 (Takara, Kyoto, Japan). According to the manufacturer&#x00027;s instructions, the PCR reactions were performed in 25-&#x003BC;l volumes using SYBR Premix Ex Taq TM (Takara). The 7000 Sequence Detection System (Applied Biosystems, Courtaboeuf, France) was used to assess the PCR amplification. All primer pairs used for this assay conformed with a previous study (Qiu et al., <xref ref-type="bibr" rid="B35">2011</xref>). It is worth noting that the housekeeping gene, <italic>gyrBRNA</italic>, was used as an endogenous control to normalize the expressional levels between the samples.</p>
</sec>
<sec>
<title>Live/dead and cytotoxicity assays</title>
<p>Hla, as a vital factor, has been shown to participate in mediating A549 cell injury and death (Bubeck and Olaf, <xref ref-type="bibr" rid="B4">2008</xref>). For this reason, A549 cells were cultured and transferred into 96-well flat-bottom polystyrene microtiter plates at a density of 2 &#x000D7; 10<sup>4</sup> cells per well in 200 &#x003BC;l of culture medium and incubated with the bacterial suspensions harvested above. After a 5-h incubation at 37&#x000B0;C, the Live/Dead (green/red) reagent (Roche) and the Cytotoxicity Detection kit (LDH, Roche) were used to assess the therapeutic effect of chalcone on A549 cells. The images of the Live/Dead cells were acquired using a confocal laser-scanning microscope, and the release of LDH was determined on a microplate reader (Tecan, Austria) at 490 nm.</p>
</sec>
<sec>
<title>Animal experiments</title>
<p>The mice (6- to 8-week-old-female C57BL/6J) used for the animal experiments were obtained from the Experimental Animal Center of Jilin University. The animal experiments were approved by and conducted in accordance with the guidelines of the Animal Care and Use Committee of Jilin University. Overnight cultures of <italic>S. aureus</italic> were inoculated 1: 100 into fresh BHI broth and grown to an OD (600 nm) of 0.6 at 37&#x000B0;C. After centrifugal collection (3,000 &#x000D7; g for 5 min) and washing three times with PBS, the bacteria were resuspended in PBS to the required concentration for survival studies. Bacteria (4 &#x000D7; 10<sup>8</sup> CFUs) were dropped into the left nare of the mice. To investigate the therapeutic effect of chalcone, the mice were treated with a subcutaneous injection of chalcone of 150 mg/kg after infection with <italic>S. aureus</italic> and then at 12-h intervals thereafter. The control mice were treated with equal volumes of DMSO simultaneously. The mortality analysis was monitored after 96 h, with ten mice contained in each experimental group.</p>
</sec>
<sec>
<title>Statistical analysis</title>
<p>The statistical significance of the treated and control group were assessed using the log-rank tests for the survival curves, and for other assays, a Student&#x00027;s <italic>t</italic>-test was used. The differences were analyzed using SPSS 13.0 (SPSS Inc., Chicago, IL, USA) statistical software, and the differences were considered statistically significant when <italic>P</italic> &#x0003C; 0.05. The data are presented as the mean &#x000B1; SD.</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>Results</title>
<sec>
<title>Chalcone inhibits the activity of SrtA and the expression of Hla</title>
<p>Chalcone (Figure <xref ref-type="fig" rid="F1">1A</xref>), one of the effective components of herbal plants, has been identified to be a remarkable inhibitor against bacteria virulence factors (Wallockrichards et al., <xref ref-type="bibr" rid="B42">2015</xref>; Li et al., <xref ref-type="bibr" rid="B21">2016</xref>). In this study, chalcone was shown to be a potential inhibitor against <italic>S. aureus</italic> SrtA and Hla. A FRET assay was used to determine the inhibitory activity of chalcone against SrtA, and the result indicated that the inhibition of SrtA activity was significant in the presence of various concentrations of chalcone (Figure <xref ref-type="fig" rid="F1">1A</xref>). We determined that the half maximal inhibitory concentration (IC<sub>50</sub>) of chalcone was 53.15 &#x003BC;M. It is worth noting that the minimum inhibitory concentration (MIC) of chalcone against the tested <italic>S. aureus</italic> strain was &#x0003E;4,864 &#x003BC;M. Meanwhile, the growth of <italic>S. aureus</italic> USA 300 was not visibly affected by chalcone at concentrations sufficient to inhibit SrtA (Figure <xref ref-type="fig" rid="F1">1B</xref>).</p>
<p>Furthermore, a hemolysis assay was used to determine the effect of chalcone on the hemolysis activity of the bacterial cultural supernatants. The results showed that chalcone at the concentrations tested in this study could significantly decrease the hemolysis activity of <italic>S. aureus</italic> in a dose-dependent manner when co-cultured with USA 300 strain (Figures <xref ref-type="fig" rid="F2">2A,B</xref>). Notably, minimal hemolysis was detected when the strain was cultured with 38 &#x003BC;M chalcone, and the IC<sub>50</sub> value for chalcone-induced inhibition of Hla was 17.63 &#x003BC;M. In addition, pre-incubation with chalcone had almost no effect on the hemolytic activities of the bacterial culture supernatants (Figures <xref ref-type="fig" rid="F2">2A,B</xref>), implying that chalcone-induced inhibition of Hla might act by means of blocking its expression. To verify this, a Western blotting assay with the bacterial culture supernatants harvested above and a real-time RT-PCR assay were performed. In line with our conjecture, the Hla levels in the supernatants were reduced in a dose-independent manner (Figure <xref ref-type="fig" rid="F2">2C</xref>), and under our experimental conditions, the transcription levels of the <italic>hla</italic> gene and the <italic>agrA</italic> gene in USA 300 were both down-regulated by chalcone in a dose-independent manner (Figure <xref ref-type="fig" rid="F2">2D</xref>). Taken together, our results established that chalcone was able to effectively inhibit SrtA activity and the expression of Hla while exerting little antimicrobial activity, implying that chalcone could represent an effective anti-infective agent for <italic>S. aureus</italic> infection.</p>
<fig id="F2" position="float">
<label>Figure 2</label>
<caption><p>Chalcone inhibits <italic>S. aureus</italic> Hla expression. <bold>(A)</bold> The hemolysis activity of culture supernatants by <italic>S. aureus</italic> co-cultured with chalcone. <bold>(B)</bold> Bacterial supernatants pre-incubated with chalcone and then the hemolysis activity was determined. <bold>(C)</bold> Western blotting assay to detect the Hla expression in the bacterial culture supernatants by <italic>S. aureus</italic> co-cultured with or without chalcone. <bold>(D)</bold> The relative gene expression of the <italic>hla</italic> gene and the <italic>agrA</italic> gene in <italic>S. aureus</italic> exposed to chalcone at different concentrations. Three independent experiments were performed to obtain stable results. &#x0002A;<italic>P</italic> &#x0003C; 0.05 vs. the WT group and &#x0002A;&#x0002A;<italic>P</italic> &#x0003C; 0.01 vs. the WT group.</p></caption>
<graphic xlink:href="fmicb-08-01715-g0002.tif"/>
</fig>
</sec>
<sec>
<title>Chalcone influences the SpA display in intact cells</title>
<p><italic>Staphylococcus aureus</italic> SrtA anchors many different surface proteins in the cell wall, including SpA, a multifunctional molecule responsible for binding the Fc&#x003B3; portion of host immunoglobulins (Falugi et al., <xref ref-type="bibr" rid="B11">2013</xref>). Therefore, SpA is vital for immune evasion, and because of its function, a change in the amount of SpA in the cell wall after the addition of chalcone requires investigation. In this assay, <italic>S. aureus</italic> cultured with or without chalcone was stained with FITC-labeled goat anti-rabbit IgG, which made the cells display a green color whose strength was determined by the amount of SpA in the cell wall. With the aid of confocal laser-scanning microscope, the content variation of SpA in the cell wall was investigated. The result showed that the WT&#x00394;SrtA strain, used as a control, displayed much less SpA on its surface compared with the WT strain, and as expected, 76 &#x003BC;M chalcone present in the cell culture caused significant reductions in the SpA display (Figure <xref ref-type="fig" rid="F3">3</xref>). These consequences indicated that chalcone was capable of disturbing the assembly of sortase-mediated SpA in the cell wall.</p>
<fig id="F3" position="float">
<label>Figure 3</label>
<caption><p>Effects of chalcone on SpA display in <italic>S. aureus</italic>. A confocal laser-scanning microscope was used to view the binding of FITC-labeled Ig to SpA. The strength of the green color represents the amount of the SpA anchored to the surface of bacteria. Scale bar, 1 &#x003BC;m.</p></caption>
<graphic xlink:href="fmicb-08-01715-g0003.tif"/>
</fig>
</sec>
<sec>
<title>Chalcone reduces the adherence of <italic>S. aureus</italic> to fibronectin</title>
<p>In the previous study, we have drawn the conclusion that chalcone can visibly inhibit the SrtA-catalyzed transpeptidation at relatively low concentrations. The fibronectin-binding proteins FnBPA and FnBPB are LPXTG proteins expressed by <italic>S. aureus</italic>. Fibronectin (Fn) is regarded as a bridge between the bacterial adhesion FnBP and the mammalian cell integrin, accelerating the process of phagocytosis, thereby stimulating the internalization of bacteria; consequently, Fn and FnBPs play a vital role in the process of invading host cells (Foster and H&#x000F6;&#x000F6;k, <xref ref-type="bibr" rid="B14">1998</xref>; Roche et al., <xref ref-type="bibr" rid="B37">2003</xref>). Because FnBPs anchored by <italic>S. aureus</italic> SrtA can make bacteria invasive, if their display in the cell wall is blocked by weakening SrtA activity, then bacterial invasion would be decreased. For this reason, we employed Fn-binding assays to determine if chalcone could reduce the adherence of <italic>S. aureus</italic> to Fn. As expected, the WT&#x00394;SrtA strain had a minimum adhesion rate to Fn owing to the damage to its Fn-binding function and no inhibition was observed in the samples treated with chalcone (Figure <xref ref-type="fig" rid="F4">4A</xref>). However, when the WT strain was treated with chalcone at different concentrations, the adhesion rates decreased in turn, respectively, indicating that the effect occurred in a dose-dependent manner. The variance between the 38 &#x003BC;M chalcone group and the WT group was a very significant difference, as was the 76 &#x003BC;M chalcone group (Figure <xref ref-type="fig" rid="F4">4A</xref>).</p>
<fig id="F4" position="float">
<label>Figure 4</label>
<caption><p>Chalcone reduces the adhesion of <italic>S. aureus</italic> to Fn, biofilm formation and <italic>S. aureus</italic> invasion. <bold>(A)</bold> Adhesion rate of <italic>S. aureus</italic> to Fn in the presence of different concentrations of chalcone. The WT&#x00394;SrtA strain was incubated with 76 &#x003BC;M chalcone. <bold>(B)</bold> Photographs of biofilms grown in 96-well flat-bottom polystyrene microtiter plates. <bold>(C)</bold> Quantification of the biofilm mass. <bold>(D)</bold> Chalcone weakened <italic>S. aureus</italic> invasion. Bacteria and J774 cells were cultured with chalcone at different concentrations at 37&#x000B0;C for 1 h, followed by gentamicin addition and incubation at 37&#x000B0;C for 30 min, after which number of intracellular bacteria was determined. Three independent experiments were performed to obtain stable results. &#x0002A;<italic>P</italic> &#x0003C; 0.05 vs. the WT group, &#x0002A;&#x0002A;<italic>P</italic> &#x0003C; 0.01 vs. the WT group and NS represents no significance.</p></caption>
<graphic xlink:href="fmicb-08-01715-g0004.tif"/>
</fig>
</sec>
<sec>
<title>Chalcone reduced biofilm formation</title>
<p>Bacteria enhance their ability to resist antibiotics and other antimicrobial agents by embedding in biofilms (Pugliese and Favero, <xref ref-type="bibr" rid="B34">2002</xref>; Cerca et al., <xref ref-type="bibr" rid="B5">2005</xref>; H&#x000F8;iby et al., <xref ref-type="bibr" rid="B16">2010</xref>). Biofilm phenotypes are promoted by the FnBPs, the major cell wall autolysin or the <italic>icaADBC</italic>-encoded polysaccharide intercellular adhesin/poly-N-acetylglucosamine (PIA/PNAG) (O&#x00027;Neill et al., <xref ref-type="bibr" rid="B32">2007</xref>, <xref ref-type="bibr" rid="B31">2008</xref>; Clarissa Pozzi et al., <xref ref-type="bibr" rid="B7">2012</xref>). To investigate whether chalcone hindered biofilm formation, <italic>S. aureus</italic> biofilm formation was determined with or without chalcone. After dye treatment, the WT&#x00394;SrtA group was much more lightly stained than the WT group, and the visible difference between the biofilms formed under the conditions of untreated and treated with 76 &#x003BC;M chalcone was quite significant (Figure <xref ref-type="fig" rid="F4">4B</xref>). These results were in accordance with those of the quantitative analysis (Figure <xref ref-type="fig" rid="F4">4C</xref>). In summary, chalcone reduced biofilm formation, suggesting that the inhibitory effect of chalcone on <italic>S. aureus</italic> SrtA had occurred.</p>
</sec>
<sec>
<title>Chalcone weakened the <italic>S. aureus</italic> invasion</title>
<p>SrtA function is normally important for the display of sortase-mediated surface proteins, thus enabling bacteria to invade the host cells. To examine how chalcone affects <italic>S. aureus</italic> invasion, J774 cells were cultured with bacteria and chalcone at different concentrations. Not surprisingly, the numbers of bacteria entering the cells in the WT&#x00394;SrtA group showed a significant decrease compared with the WT group (Figure <xref ref-type="fig" rid="F4">4D</xref>). Consistent with the hypothesis, the addition of a dose of chalcone to the experimental system significantly decreased the quantity of bacteria, indicating that chalcone weakened the <italic>S. aureus</italic> invasion by inhibiting SrtA activity (Figure <xref ref-type="fig" rid="F4">4D</xref>).</p>
</sec>
<sec>
<title>Molecular dynamics simulation for SrtA-chalcone</title>
<p>Through the computational biology method, the potential binding mode of chalcone with SrtA in the active site was explored in this study. The chalcone was bound to SrtA, and according to the binding mode given (Figures <xref ref-type="fig" rid="F5">5A,B</xref>), it was clear that chalcone could bind to SrtA via Van der Waals and electrostatic interactions. During the time course of the simulation, chalcone could localize to the catalytic pocket of SrtA (residue 160&#x02013;200). In detail, the binding model of chalcone with SrtA revealed that chalcone could form strong interactions with Val166, Gly167, Val168, Ile182, Val193, and Arg197, respectively. The complex was found to reach equilibrium at 100 ns based on the analysis of the root-mean-square deviations (RMSD) of the backbone C<sub>&#x003B1;</sub> atoms (Figure <xref ref-type="fig" rid="F5">5C</xref>), which indicated that the complex system has reached equilibrium.</p>
<fig id="F5" position="float">
<label>Figure 5</label>
<caption><p>The 3D structural determination of a SrtA with chalcone complex by a molecular modeling method and the inhibitory effects of chalcone against WT-SrtA and SrtA mutants. <bold>(A)</bold> The structure of SrtA-chalcone. <bold>(B)</bold> The interaction of chalcone with the key residues of SrtA. <bold>(C)</bold> The RMSD displayed by the backbone atoms of the protein during MD simulations of SrtA-Chalcone is presented. <bold>(D)</bold> Decomposition of the binding energy on a per-residue basis at the binding sites of the SrtA-chalcone complex. <bold>(E)</bold> WT-SrtA and SrtA mutants (V168A-SrtA, I182A-SrtA and R197A-SrtA) were incubated with 76 &#x003BC;M chalcone, and the catalytic activity of the recombinant SrtA was determined as described in Figure <xref ref-type="fig" rid="F1">1A</xref>. &#x0002A;&#x0002A;<italic>P</italic> &#x0003C; 0.01 vs. the WT group.</p></caption>
<graphic xlink:href="fmicb-08-01715-g0005.tif"/>
</fig>
<p>To explore the energy contributions from the residues of the binding sites in the SrtA- chalcone complex, the energy decomposition was calculated for the SrtA-chalcone complex system. Val168, Ile182 and Arg197 had a strong total binding energy contribution, with a &#x00394;<italic>E</italic><sub><italic>total</italic></sub> of &#x0003C; -1.0 kcal/mol (Figure <xref ref-type="fig" rid="F5">5D</xref>). In addition, residues Gly167 and Trp194 also had the appreciable total binding energy contribution, with a &#x00394;<italic>E</italic><sub><italic>total</italic></sub> of &#x0003C; -0.8 kcal/mol. These results suggested that these five residues were key residues for chalcone.</p>
<p>To confirm these theoretical results, the total binding free energy for the SrtA- chalcone complex and their detailed energy contributions calculated according to the MM-PBSA approach are summarized in Table <xref ref-type="table" rid="T2">2</xref>. According to the calculation results, the binding free energy, &#x00394;<italic>G</italic><sub><italic>bind</italic></sub>, of the interaction between chalcone and the protein decreased in the following order: WT-SrtA &#x0003E; V168A-SrtA &#x0003E; R197A-SrtA &#x0003E; I182A-SrtA, which means that WT-SrtA had the strongest ability to bind to chalcone. Using fluorescence spectroscopy quenching, we measured the &#x00394;<italic>G</italic><sub><italic>bind</italic></sub> and the number of binding sites between chalcone and the three mutants, and these results were highly consistent with those obtained by computational methods (Table <xref ref-type="table" rid="T2">2</xref>). To further validate the simulation results, three mutants, V168A-SrtA, I182A-SrtA, and R197A-SrtA, were constructed for the FRET assays. As expected, when compared with WT-SrtA, chalcone was significantly less sensitive for these three mutants (Figure <xref ref-type="fig" rid="F5">5E</xref>). These results indicated that the information generated by the MD simulation on the SrtA-Chalcone complex was reliable. Due to the binding of inhibitor, chalcone, with the activity region (residues of Gly167, Val168, Ile182, Cys184, Trp194, and Arg197), the biology activity of SrtA was inhibited.</p>
<table-wrap position="float" id="T2">
<label>Table 2</label>
<caption><p>The binding free energy (kcal/mol) of WT-Chalcone, V168A-Chalcone, I182A-Chalcone, and R197A-Chalcone systems based on computational method and the values of the binding constants (<italic>K</italic><sub><italic>A</italic></sub>) based on the fluorescence spectroscopy quenching.</p></caption>
<table frame="hsides" rules="groups">
<thead><tr>
<th valign="top" align="left"><bold>Proteins</bold></th>
<th valign="top" align="center"><bold>WT-SrtA</bold></th>
<th valign="top" align="center"><bold>V168A</bold></th>
<th valign="top" align="center"><bold>I182A</bold></th>
<th valign="top" align="center"><bold>R197A</bold></th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">The binding energy</td>
<td valign="top" align="center">&#x02212;7.82 &#x000B1; 0.9</td>
<td valign="top" align="center">&#x02212;5.5 &#x000B1; 0.4</td>
<td valign="top" align="center">&#x02212;4.7 &#x000B1; 0.5</td>
<td valign="top" align="center">&#x02212;5.1 &#x000B1; 0.6</td>
</tr>
<tr>
<td valign="top" align="left"><italic>K</italic><sub>A</sub> (1 &#x000D7; 10<sup>4</sup>) L&#x000B7;mol<sup>&#x02212;1</sup></td>
<td valign="top" align="center">6.1 &#x000B1; 0.5</td>
<td valign="top" align="center">3.8 &#x000B1; 0.4</td>
<td valign="top" align="center">4.1 &#x000B1; 0.8</td>
<td valign="top" align="center">4.0 &#x000B1; 0.7</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec>
<title>Chalcone protects A549 cells from Hla-mediated injury</title>
<p>In our co-culture system, the potential protective effect of chalcone on the Hla-induced injury of A549 cells was determined. In the Live/Dead assay, uninfected cells retained green fluorescence (Figure <xref ref-type="fig" rid="F6">6A</xref>), and inversely, injured cells retained red fluorescence. As expected, 38 &#x003BC;M chalcone showed an obvious reduction in cell injury, with almost no cytotoxic effect observed in A549 cells (Figures <xref ref-type="fig" rid="F6">6B&#x02013;E</xref>). Simultaneously, the LDH assay showed that treatment with chalcone could significantly decrease the release of LDH into the supernatants in a dose-independent manner compared with the control group, indicating less cell death (Figure <xref ref-type="fig" rid="F6">6E</xref>). Above all, the results showed that chalcone had a protective effect on Hla&#x02013;mediated A549 cell injury.</p>
<fig id="F6" position="float">
<label>Figure 6</label>
<caption><p>Chalcone protects A549 cells from injury mediated by <italic>S. aureus</italic> Hla. Live/Dead reagent-A549 cells were observed with fluorescent imaging. <bold>(A)</bold> The untreated A549 cells. <bold>(B)</bold> A549 cells treated with 38 &#x003BC;M chalcone only. <bold>(C)</bold> A549 cells infected with <italic>S. aureus</italic> culture supernatants harvested in the absence of chalcone. <bold>(D)</bold> A549 cells treated with <italic>S. aureus</italic> culture supernatants harvested in the presence of 38 &#x003BC;M chalcone. <bold>(E)</bold> The LDH release by A549 cells treated with <italic>S. aureus</italic> culture supernatants harvested previously and 38 &#x003BC;M chalcone only, respectively. Scale bar, 10 &#x003BC;m. &#x0002A;&#x0002A;<italic>P</italic> &#x0003C; 0.01 vs. the WT group.</p></caption>
<graphic xlink:href="fmicb-08-01715-g0006.tif"/>
</fig>
</sec>
<sec>
<title>Chalcone protected mice from fatal <italic>S. aureus</italic> infection</title>
<p>To investigate the effect of chalcone on the survival rate of mice inoculated with <italic>S. aureus</italic>, we performed survival experiments. Ninety-six hours after infection with 4 &#x000D7; 10<sup>8</sup> CFUs of bacteria, only 20% of the WT-infected mice survived, in contrast to the WT&#x00394;SrtA group in which the survival rate was 100% (Figure <xref ref-type="fig" rid="F7">7</xref>). In the chalcone-treated group, the survival rate was significantly higher than in the group without treatment (Figure <xref ref-type="fig" rid="F7">7</xref>). The death of mice in the WT&#x0002B;chalcone group occurred only at 36, 48, and 72 h in the whole process of infection (Figure <xref ref-type="fig" rid="F7">7</xref>). These findings suggested that chalcone could prolong survival of the mice in <italic>S. aureus</italic>&#x02013;induced infection.</p>
<fig id="F7" position="float">
<label>Figure 7</label>
<caption><p>Effects of chalcone on survival rates after 96 hours in C57BL/6J mice. Mice were infected with 4 &#x000D7; 10<sup>8</sup> CFUs of <italic>S. aureus</italic> and the WT&#x00394;SrtA strain. Treatment with chalcone (150 mg/kg, twice a day) was initiated after infection. &#x0002A;&#x0002A;<italic>P</italic> &#x0003C; 0.01 vs. the WT group.</p></caption>
<graphic xlink:href="fmicb-08-01715-g0007.tif"/>
</fig>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<title>Discussion</title>
<p><italic>Staphylococcus aureus</italic> is a major human pathogen and is also a leading cause of sepsis and infective endocarditis. The continuous spread of antibiotic-resistant strains, such as MRSA and VRSA makes treatment very difficult (Lowy, <xref ref-type="bibr" rid="B24">1998</xref>; Petti and Fowler, <xref ref-type="bibr" rid="B33">2003</xref>; Menichetti, <xref ref-type="bibr" rid="B28">2005</xref>), and new valid strategies are greatly needed to address this severe situation. The virulence factors of bacteria, such as adhesins, invasins and toxins, among others, facilitate infection by evading the immune response and leading to colonization, spread and tissue damage (Lowy, <xref ref-type="bibr" rid="B24">1998</xref>; Foster, <xref ref-type="bibr" rid="B13">2005</xref>; Rooijakkers et al., <xref ref-type="bibr" rid="B38">2005</xref>). In addition, previous studies have demonstrated that the vast majority of these various virulence factors are nonessential for bacterial survival and are crucial in the process of targeting host cells and causing disease (Lowy, <xref ref-type="bibr" rid="B24">1998</xref>; Berube and Bubeck, <xref ref-type="bibr" rid="B3">2013</xref>). Some previous studies have also demonstrated that <italic>S. aureus</italic> lacking the genes encoding SrtA or Hla will show a weakened bacterial virulence (Albus et al., <xref ref-type="bibr" rid="B1">1991</xref>; Mcelroy et al., <xref ref-type="bibr" rid="B27">1999</xref>; Mazmanian et al., <xref ref-type="bibr" rid="B26">2000</xref>; Wardenburg et al., <xref ref-type="bibr" rid="B43">2007</xref>). For this reason, therapeutic agents targeting virulence factors, such as SrtA and Hla, which do not threaten survival, may not lead to the development of resistance as quickly as conventional antibiotics typically do, and this will have important implications for <italic>S. aureus</italic> infection. Some agents targeting <italic>S. aureus</italic> SrtA or Hla have been found previously (Liu et al., <xref ref-type="bibr" rid="B23">2015</xref>; Zhou et al., <xref ref-type="bibr" rid="B46">2015</xref>; Zhang et al., <xref ref-type="bibr" rid="B44">2016</xref>). However, as these compounds are targeted only at one kind of virulence factor, the limitations for clinical treatment will certainly exist. A hypothesis was then proposed as to whether we could find an agent targeting SrtA and Hla simultaneously to produce a better therapeutic effect.</p>
<p>The scope of screening for SrtA and Hla inhibitors was wide, involving natural, synthetic and high-throughput screening methodologies. We sought to find inhibitors from natural small molecule compounds, from which chalcone, of the flavonoid class of natural products (Figure <xref ref-type="fig" rid="F1">1A</xref>), with relatively simple structures and various functions (Sahu et al., <xref ref-type="bibr" rid="B39">2012</xref>), was discovered. First, a FRET assay and a hemolysis assay were used to identify the inhibition of chalcone on SrtA and Hla, respectively. After incubating <italic>S. aureus</italic> with chalcone at a certain concentration, the SrtA catalytic activity, hemolysis ratio and Hla expression in the bacterial culture supernatant were all decreased (Figures <xref ref-type="fig" rid="F1">1A</xref>, <xref ref-type="fig" rid="F2">2A&#x02013;C</xref>). Additionally, chalcone indeed affected the transcriptional levels of the <italic>hly</italic> gene and the <italic>agrA</italic> gene (Figure <xref ref-type="fig" rid="F2">2D</xref>), indicating that the decreased expression of Hla might be caused by the decreased expression of the genes. In addition, the decreased expression of Hla conferred significant protection against Hla-mediated A549 cell injury (Figure <xref ref-type="fig" rid="F6">6</xref>). We also found that the inhibitory effect of chalcone against SrtA reduced the SpA display in the cell wall (Figure <xref ref-type="fig" rid="F3">3</xref>), decreased the adherence of <italic>S. aureus</italic> to fibronectin (Figure <xref ref-type="fig" rid="F4">4A</xref>) and resulted in the lower biofilm formation (Figures <xref ref-type="fig" rid="F4">4B,C</xref>). In addition, as far as we know, our study is the first to use a cell invasion assay to evaluate the inhibitory activity of a natural compound on SrtA, which showed that the quantity of bacterial entry into cells was significantly decreased by chalcone (Figure <xref ref-type="fig" rid="F4">4D</xref>). To explore the interaction mechanism between chalcone and SrtA, a molecular dynamics simulation for a SrtA-chalcone complex system was carried out. By means of molecular dynamics simulation, it was found that chalcone could localize to the catalytic pocket of SrtA (residues 160&#x02013;200), which is very close to the binding site of substrate. Due to the binding of chalcone to SrtA, the binding of substrate to SrtA was blocked, leading to the loss of biological activity of SrtA (Figure <xref ref-type="fig" rid="F5">5</xref>). It is worth mentioning that just at a much lower concentration than the MIC, chalcone could significantly stop <italic>S. aureus</italic> SrtA-mediated transpeptidation and the hemolysis activity of Hla <italic>in vitro</italic> by inhibiting SrtA activity and the expression of Hla, respectively, instead of killing bacteria directly (Figure <xref ref-type="fig" rid="F1">1B</xref>), which means a less selective pressure for bacteria and a lower risk of drug resistance. More importantly, a C57BL/6J mouse model was established to determine the therapeutic effect of chalcone <italic>in vivo</italic>, and treatment with chalcone significantly attenuated the virulence of <italic>S. aureus</italic> and protected mice from infection caused by the bacteria (Figure <xref ref-type="fig" rid="F7">7</xref>). To the best of our knowledge, this is the first report of the discovery and proof of an inhibitor targeting <italic>S. aureus</italic> SrtA and Hla simultaneously, and thus, this kind of inhibitor can be considered as a novel promising candidate against <italic>S. aureus</italic> infection.</p>
<p>In conclusion, our study discovered that the natural small compound chalcone could effectively inhibit <italic>S. aureus</italic> SrtA activity and the expression of Hla by occupying the sites of the enzyme to prevent anchoring of surface proteins and decreasing transcription levels of the <italic>hla</italic> gene and the <italic>agrA</italic> gene, thereby attenuating <italic>S. aureus</italic> virulence both <italic>in vitro</italic> and <italic>in vivo</italic>. These findings could be the foundation for further design of novel anti-infection agents, and a SrtA-Hla-centered strategy has emerged accordingly, thus making a contribution for opening a new horizon for the treatment of <italic>S. aureus</italic> infection.</p>
</sec>
<sec id="s5">
<title>Author contributions</title>
<p>JW and XN conceived and designed the experiments. BZ, ZT, XL, and GL performed the experiments. XD contributed reagents/materials/analysis tools. JW, BZ, and XD wrote the paper.</p>
<sec>
<title>Conflict of interest statement</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
</sec>
</body>
<back>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Albus</surname> <given-names>A.</given-names></name> <name><surname>Arbeit</surname> <given-names>R. D.</given-names></name> <name><surname>Lee</surname> <given-names>J. C.</given-names></name></person-group> (<year>1991</year>). <article-title>Virulence of <italic>Staphylococcus aureus</italic> mutants altered in type 5 capsule production</article-title>. <source>Infect. Immun.</source> <volume>59</volume>, <fpage>1008</fpage>&#x02013;<lpage>1014</lpage>. <pub-id pub-id-type="pmid">1847696</pub-id></citation></ref>
<ref id="B2">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Bandyopadhyay</surname> <given-names>S.</given-names></name> <name><surname>Valder</surname> <given-names>C. R.</given-names></name> <name><surname>Huynh</surname> <given-names>H. G.</given-names></name> <name><surname>Ren</surname> <given-names>H.</given-names></name> <name><surname>Allison</surname> <given-names>W. S.</given-names></name></person-group> (<year>2002</year>). <article-title>The beta G156C substitution in the F1-ATPase from the thermophilic Bacillus PS3 affects catalytic site cooperativity by destabilizing the closed conformation of the catalytic site</article-title>. <source>Biochemistry</source> <volume>41</volume>, <fpage>14421</fpage>&#x02013;<lpage>14429</lpage>. <pub-id pub-id-type="doi">10.1021/bi026243g</pub-id><pub-id pub-id-type="pmid">12450409</pub-id></citation></ref>
<ref id="B3">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Berube</surname> <given-names>B. J.</given-names></name> <name><surname>Bubeck</surname> <given-names>W. J.</given-names></name></person-group> (<year>2013</year>). <article-title><italic>Staphylococcus aureus</italic> &#x003B1;-Toxin: nearly a century of intrigue</article-title>. <source>Toxins (Basel)</source> <volume>5</volume>, <fpage>1140</fpage>&#x02013;<lpage>1166</lpage>. <pub-id pub-id-type="doi">10.3390/toxins5061140</pub-id><pub-id pub-id-type="pmid">23888516</pub-id></citation></ref>
<ref id="B4">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Bubeck</surname> <given-names>W. J.</given-names></name> <name><surname>Olaf</surname> <given-names>S.</given-names></name></person-group> (<year>2008</year>). <article-title>Vaccine protection against <italic>Staphylococcus aureus</italic> pneumonia</article-title>. <source>J. Exp. Med.</source> <volume>205</volume>, <fpage>287</fpage>&#x02013;<lpage>294</lpage>. <pub-id pub-id-type="doi">10.1084/jem.20072208</pub-id></citation></ref>
<ref id="B5">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Cerca</surname> <given-names>N.</given-names></name> <name><surname>Martins</surname> <given-names>S.</given-names></name> <name><surname>Cerca</surname> <given-names>F.</given-names></name> <name><surname>Jefferson</surname> <given-names>K. K.</given-names></name> <name><surname>Pier</surname> <given-names>G. B.</given-names></name> <name><surname>Oliveira</surname> <given-names>R.</given-names></name> <etal/></person-group>. (<year>2005</year>). <article-title>Cerca, N. Comparative assessment of antibiotic susceptibility of coagulase negative staphylococci in biofilm versus planktonic culture as assessed by bacterial enumeration or rapid XTT colorimetry</article-title>. <source>J. Antimicrob. Chemother</source>. <volume>56</volume>, <fpage>331</fpage>&#x02013;<lpage>336</lpage>. <pub-id pub-id-type="doi">10.1093/jac/dki217</pub-id></citation></ref>
<ref id="B6">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Clancy</surname> <given-names>K. W.</given-names></name> <name><surname>Melvin</surname> <given-names>J. A.</given-names></name> <name><surname>Mccafferty</surname> <given-names>D. G.</given-names></name></person-group> (<year>2010</year>). <article-title>Sortase transpeptidases: insights into mechanism, substrate specificity, and inhibition</article-title>. <source>Biopolymers</source> <volume>94</volume>, <fpage>385</fpage>&#x02013;<lpage>396</lpage>. <pub-id pub-id-type="doi">10.1002/bip.21472</pub-id><pub-id pub-id-type="pmid">20593474</pub-id></citation></ref>
<ref id="B7">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Clarissa Pozzi</surname> <given-names>E. M. W.</given-names></name> <name><surname>Justine Rudkin</surname> <given-names>K.</given-names></name> <name><surname>Carolyn Schaeffer</surname> <given-names>R.</given-names></name> <name><surname>Amanda Lohan</surname> <given-names>J.</given-names></name> <name><surname>Pin</surname> <given-names>T.</given-names></name> <name><surname>Brendan Loftus</surname> <given-names>J.</given-names></name> <etal/></person-group>. (<year>2012</year>). <article-title>Methicillin resistance alters the biofilm phenotype and attenuates virulence in <italic>Staphylococcus aureus</italic> device-associated infections</article-title>. <source>PLoS Pathog.</source> <volume>8</volume>:<fpage>e1002626</fpage>. <pub-id pub-id-type="doi">10.1371/journal.ppat.1002626</pub-id><pub-id pub-id-type="pmid">22496652</pub-id></citation></ref>
<ref id="B8">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Coates</surname> <given-names>R.</given-names></name> <name><surname>Moran</surname> <given-names>J.</given-names></name> <name><surname>Horsburgh</surname> <given-names>M. J.</given-names></name></person-group> (<year>2014</year>). <article-title>Staphylococci: colonizers and pathogens of human skin</article-title>. <source>Future Microbiol.</source> <volume>9</volume>, <fpage>75</fpage>&#x02013;<lpage>91</lpage>. <pub-id pub-id-type="doi">10.2217/fmb.13.145</pub-id><pub-id pub-id-type="pmid">24328382</pub-id></citation></ref>
<ref id="B9">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Dinges</surname> <given-names>M. M.</given-names></name> <name><surname>Orwin</surname> <given-names>P. M.</given-names></name> <name><surname>Schlievert</surname> <given-names>P. M.</given-names></name></person-group> (<year>2000</year>). <article-title>Exotoxins of <italic>Staphylococcus aureus</italic></article-title>. <source>Clin. Microbiol. Rev.</source> <volume>13</volume>, <fpage>16</fpage>&#x02013;<lpage>34</lpage>, table of contents. <pub-id pub-id-type="doi">10.1128/CMR.13.1.16-34.2000</pub-id><pub-id pub-id-type="pmid">10627489</pub-id></citation></ref>
<ref id="B10">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Dong</surname> <given-names>J.</given-names></name> <name><surname>Qiu</surname> <given-names>J.</given-names></name> <name><surname>Zhang</surname> <given-names>Y.</given-names></name> <name><surname>Lu</surname> <given-names>C.</given-names></name> <name><surname>Dai</surname> <given-names>X.</given-names></name> <name><surname>Wang</surname> <given-names>J.</given-names></name> <etal/></person-group>. (<year>2013</year>). <article-title>Oroxylin A inhibits hemolysis via hindering the self-assembly of &#x003B1;-hemolysin heptameric transmembrane pore</article-title>. <source>PLoS Comput. Biol.</source> <volume>9</volume>:<fpage>e1002869</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pcbi.1002869</pub-id><pub-id pub-id-type="pmid">23349625</pub-id></citation></ref>
<ref id="B11">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Falugi</surname> <given-names>F.</given-names></name> <name><surname>Kim</surname> <given-names>H. K.</given-names></name> <name><surname>Missiakas</surname> <given-names>D. M.</given-names></name> <name><surname>Schneewind</surname> <given-names>O.</given-names></name></person-group> (<year>2013</year>). <article-title>Role of protein a in the evasion of host adaptive immune responses by <italic>Staphylococcus aureus</italic></article-title>. <source>MBio</source> <volume>4</volume>:<fpage>e00575</fpage>. <pub-id pub-id-type="doi">10.1128/mBio.00575-13</pub-id><pub-id pub-id-type="pmid">23982075</pub-id></citation></ref>
<ref id="B12">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Fischetti</surname> <given-names>V. A.</given-names></name> <name><surname>Pancholi</surname> <given-names>V.</given-names></name> <name><surname>Schneewind</surname> <given-names>O.</given-names></name></person-group> (<year>1990</year>). <article-title>Conservation of a hexapeptide sequence in the anchor region of surface proteins from Gram-positive cocci</article-title>. <source>Mol. Microbiol.</source> <volume>4</volume>, <fpage>1603</fpage>&#x02013;<lpage>1605</lpage>. <pub-id pub-id-type="doi">10.1111/j.1365-2958.1990.tb02072.x</pub-id><pub-id pub-id-type="pmid">2287281</pub-id></citation></ref>
<ref id="B13">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Foster</surname> <given-names>T. J.</given-names></name></person-group> (<year>2005</year>). <article-title>Immune evasion by staphylococci</article-title>. <source>Nat. Rev. Microbiol.</source> <volume>3</volume>, <fpage>948</fpage>&#x02013;<lpage>958</lpage>. <pub-id pub-id-type="doi">10.1038/nrmicro1289</pub-id><pub-id pub-id-type="pmid">16322743</pub-id></citation></ref>
<ref id="B14">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Foster</surname> <given-names>T. J.</given-names></name> <name><surname>H&#x000F6;&#x000F6;k</surname> <given-names>M.</given-names></name></person-group> (<year>1998</year>). <article-title>Surface protein adhesins of <italic>Staphylococcus aureus</italic></article-title>. <source>Trends Microbiol.</source> <volume>6</volume>:<fpage>484</fpage>. <pub-id pub-id-type="doi">10.1016/S0966-842X(98)01400-0</pub-id><pub-id pub-id-type="pmid">10036727</pub-id></citation></ref>
<ref id="B15">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Gould</surname> <given-names>I. M.</given-names></name></person-group> (<year>2013</year>). <article-title>Treatment of bacteraemia: meticillin-resistant <italic>Staphylococcus aureus</italic> (MRSA) to vancomycin-resistant <italic>S. aureus</italic> (VRSA)</article-title>. <source>Int. J. Antimicrob. Agents</source> <volume>42</volume>, <fpage>23</fpage>&#x02013;<lpage>30</lpage>. <pub-id pub-id-type="doi">10.1016/j.ijantimicag.2013.04.006</pub-id><pub-id pub-id-type="pmid">23664580</pub-id></citation></ref>
<ref id="B16">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>H&#x000F8;iby</surname> <given-names>N.</given-names></name> <name><surname>Bjarnsholt</surname> <given-names>T.</given-names></name> <name><surname>Givskov</surname> <given-names>M.</given-names></name> <name><surname>Molin</surname> <given-names>S.</given-names></name> <name><surname>Ciofu</surname> <given-names>O.</given-names></name></person-group> (<year>2010</year>). <article-title>Antibiotic resistance of bacterial biofilms</article-title>. <source>Int. J. Antimicrob. Agents</source> <volume>35</volume>, <fpage>322</fpage>&#x02013;<lpage>332</lpage>. <pub-id pub-id-type="doi">10.1016/j.ijantimicag.2009.12.011</pub-id><pub-id pub-id-type="pmid">20149602</pub-id></citation></ref>
<ref id="B17">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Hu</surname> <given-names>R.</given-names></name> <name><surname>Barbault</surname> <given-names>F.</given-names></name> <name><surname>Maurel</surname> <given-names>F.</given-names></name> <name><surname>Delamar</surname> <given-names>M.</given-names></name> <name><surname>Zhang</surname> <given-names>R.</given-names></name></person-group> (<year>2010</year>). <article-title>Molecular dynamics simulations of 2-Amino-6-arylsulphonylbenzonitriles analogues as HIV inhibitors: interaction modes and binding free energies</article-title>. <source>Chem. Biol. Drug Des.</source> <volume>76</volume>, <fpage>518</fpage>&#x02013;<lpage>526</lpage>. <pub-id pub-id-type="doi">10.1111/j.1747-0285.2010.01028.x</pub-id><pub-id pub-id-type="pmid">20942836</pub-id></citation></ref>
<ref id="B18">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ippolito</surname> <given-names>G.</given-names></name> <name><surname>Leone</surname> <given-names>S.</given-names></name> <name><surname>Lauria</surname> <given-names>F. N.</given-names></name> <name><surname>Nicastri</surname> <given-names>E.</given-names></name> <name><surname>Wenzel</surname> <given-names>R. P.</given-names></name> <name><surname>Ippolito</surname> <given-names>G.</given-names></name></person-group> (<year>2010</year>). <article-title>Methicillin-resistant <italic>Staphylococcus aureus</italic>: the superbug</article-title>. <source>Int. J. Infect. Dis.</source> <volume>14</volume>(<supplement>Suppl. 4</supplement>), <fpage>S7</fpage>&#x02013;<lpage>S11</lpage>. <pub-id pub-id-type="doi">10.1016/j.ijid.2010.05.003</pub-id><pub-id pub-id-type="pmid">20851011</pub-id></citation></ref>
<ref id="B19">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Jurasekova</surname> <given-names>Z.</given-names></name> <name><surname>Marconi</surname> <given-names>G.</given-names></name> <name><surname>Sanchez-Cortes</surname> <given-names>S.</given-names></name> <name><surname>Torreggiani</surname> <given-names>A.</given-names></name></person-group> (<year>2009</year>). <article-title>Spectroscopic and molecular modeling studies on the binding of the flavonoid luteolin and human serum albumin</article-title>. <source>Biopolymers</source> <volume>91</volume>, <fpage>917</fpage>&#x02013;<lpage>927</lpage>. <pub-id pub-id-type="doi">10.1002/bip.21278</pub-id><pub-id pub-id-type="pmid">19603495</pub-id></citation></ref>
<ref id="B20">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Levy</surname> <given-names>S. B.</given-names></name> <name><surname>Fitzgerald</surname> <given-names>G. B.</given-names></name> <name><surname>Macone</surname> <given-names>A. B.</given-names></name></person-group> (<year>1976</year>). <article-title>Spread of antibiotic-resistant plasmids from chicken to chicken and from chicken to man</article-title>. <source>Nature</source> <volume>260</volume>, <fpage>40</fpage>&#x02013;<lpage>42</lpage>. <pub-id pub-id-type="doi">10.1038/260040a0</pub-id><pub-id pub-id-type="pmid">772441</pub-id></citation></ref>
<ref id="B21">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Li</surname> <given-names>H.</given-names></name> <name><surname>Chen</surname> <given-names>Y.</given-names></name> <name><surname>Zhang</surname> <given-names>B.</given-names></name> <name><surname>Niu</surname> <given-names>X.</given-names></name> <name><surname>Song</surname> <given-names>M.</given-names></name> <name><surname>Luo</surname> <given-names>Z.</given-names></name> <etal/></person-group>. (<year>2016</year>). <article-title>Inhibition of sortase A by chalcone prevents <italic>Listeria monocytogenes</italic> infection</article-title>. <source>Biochem. Pharmacol.</source> <volume>106</volume>, <fpage>19</fpage>&#x02013;<lpage>29</lpage>. <pub-id pub-id-type="doi">10.1016/j.bcp.2016.01.018</pub-id><pub-id pub-id-type="pmid">26826492</pub-id></citation></ref>
<ref id="B22">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Lin</surname> <given-names>W.</given-names></name> <name><surname>Bi</surname> <given-names>C.</given-names></name> <name><surname>Cai</surname> <given-names>H.</given-names></name> <name><surname>Liu</surname> <given-names>B.</given-names></name> <name><surname>Zhong</surname> <given-names>X.</given-names></name> <name><surname>Deng</surname> <given-names>X.</given-names></name> <etal/></person-group>. (<year>2015</year>). <article-title>The therapeutic effect of chlorogenic acid against <italic>Staphylococcus aureus</italic> infection through sortase A inhibition</article-title>. <source>Front. Microbiol.</source> <volume>6</volume>:<fpage>1031</fpage>. <pub-id pub-id-type="doi">10.3389/fmicb.2015.01031</pub-id></citation></ref>
<ref id="B23">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname> <given-names>S.</given-names></name> <name><surname>Zhou</surname> <given-names>X.</given-names></name> <name><surname>Li</surname> <given-names>W.</given-names></name> <name><surname>Zhang</surname> <given-names>H.</given-names></name> <name><surname>Zhang</surname> <given-names>B.</given-names></name> <name><surname>Li</surname> <given-names>G.</given-names></name> <etal/></person-group>. (<year>2015</year>). <article-title>Diosmetin inhibits the expression of alpha-hemolysin in <italic>Staphylococcus aureus</italic></article-title>. <source>Antonie Van Leeuwenhoek</source> <volume>108</volume>:<fpage>383</fpage>. <pub-id pub-id-type="doi">10.1007/s10482-015-0491-6</pub-id></citation></ref>
<ref id="B24">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Lowy</surname> <given-names>F. D.</given-names></name></person-group> (<year>1998</year>). <article-title><italic>Staphylococcus aureus</italic> infections</article-title>. <source>N. Eng. J. Med.</source> <volume>339</volume>, <fpage>2026</fpage>&#x02013;<lpage>2027</lpage>. <pub-id pub-id-type="pmid">9709046</pub-id></citation></ref>
<ref id="B25">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Lv</surname> <given-names>Z.</given-names></name> <name><surname>Wang</surname> <given-names>H. S.</given-names></name> <name><surname>Niu</surname> <given-names>X. D.</given-names></name></person-group> (<year>2013</year>). <article-title>Molecular dynamics simulations reveal insight into key structural elements of aaptamines as sortase inhibitors with free energy calculations</article-title>. <source>Chem. Phys. Lett.</source> <volume>585</volume>, <fpage>171</fpage>&#x02013;<lpage>177</lpage>. <pub-id pub-id-type="doi">10.1016/j.cplett.2013.08.097</pub-id></citation></ref>
<ref id="B26">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Mazmanian</surname> <given-names>S. K.</given-names></name> <name><surname>Liu</surname> <given-names>G.</given-names></name> <name><surname>Jensen</surname> <given-names>E. R.</given-names></name> <name><surname>Lenoy</surname> <given-names>E.</given-names></name> <name><surname>Schneewind</surname> <given-names>O.</given-names></name></person-group> (<year>2000</year>). <article-title><italic>Staphylococcus aureus</italic> sortase mutants defective in the display of surface proteins and in the pathogenesis of animal infections</article-title>. <source>Proc. Natl. Acad. Sci. U.S.A.</source> <volume>97</volume>, <fpage>5510</fpage>&#x02013;<lpage>5515</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.080520697</pub-id><pub-id pub-id-type="pmid">10805806</pub-id></citation></ref>
<ref id="B27">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Mcelroy</surname> <given-names>M. C.</given-names></name> <name><surname>Harty</surname> <given-names>H. R.</given-names></name> <name><surname>Hosford</surname> <given-names>G. E.</given-names></name> <name><surname>Boylan</surname> <given-names>G. M.</given-names></name> <name><surname>Pittet</surname> <given-names>J. F.</given-names></name> <name><surname>Foster</surname> <given-names>T. J.</given-names></name></person-group> (<year>1999</year>). <article-title>Alpha-toxin damages the air-blood barrier of the lung in a rat model of <italic>Staphylococcus aureus</italic>-induced pneumonia</article-title>. <source>Infect. Immun.</source> <volume>67</volume>:<fpage>5541</fpage>. <pub-id pub-id-type="pmid">10496947</pub-id></citation></ref>
<ref id="B28">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Menichetti</surname> <given-names>F.</given-names></name></person-group> (<year>2005</year>). <article-title>Current and emerging serious Gram-positive infections</article-title>. <source>Clin. Microbiol. Infect.</source> <volume>11</volume>(<supplement>Suppl. S3</supplement>), <fpage>22</fpage>&#x02013;<lpage>28</lpage>. <pub-id pub-id-type="doi">10.1111/j.1469-0691.2005.01138.x</pub-id><pub-id pub-id-type="pmid">15811021</pub-id></citation></ref>
<ref id="B29">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Morris</surname> <given-names>G. M.</given-names></name> <name><surname>Huey</surname> <given-names>R.</given-names></name> <name><surname>Lindstrom</surname> <given-names>W.</given-names></name> <name><surname>Sanner</surname> <given-names>M. F.</given-names></name> <name><surname>Belew</surname> <given-names>R. K.</given-names></name> <name><surname>Goodsell</surname> <given-names>D. S.</given-names></name> <etal/></person-group>. (<year>2009</year>). <article-title>AutoDock4 and AutoDockTools4: automated docking with selective receptor flexibility</article-title>. <source>J. Comput. Chem.</source> <volume>30</volume>, <fpage>2785</fpage>&#x02013;<lpage>2791</lpage>. <pub-id pub-id-type="doi">10.1002/jcc.21256</pub-id><pub-id pub-id-type="pmid">19399780</pub-id></citation></ref>
<ref id="B30">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Niu</surname> <given-names>X.</given-names></name> <name><surname>Qiu</surname> <given-names>J.</given-names></name> <name><surname>Wang</surname> <given-names>X.</given-names></name> <name><surname>Gao</surname> <given-names>X.</given-names></name> <name><surname>Dong</surname> <given-names>J.</given-names></name> <name><surname>Wang</surname> <given-names>J.</given-names></name> <etal/></person-group>. (<year>2013</year>). <article-title>Molecular insight into the inhibition mechanism of cyrtominetin to &#x003B1;-hemolysin by molecular dynamics simulation</article-title>. <source>Eur. J. Med. Chem.</source> <volume>62</volume>, <fpage>320</fpage>&#x02013;<lpage>328</lpage>. <pub-id pub-id-type="doi">10.1016/j.ejmech.2013.01.008</pub-id><pub-id pub-id-type="pmid">23376250</pub-id></citation></ref>
<ref id="B31">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>O&#x00027;Neill</surname> <given-names>E.</given-names></name> <name><surname>Pozzi</surname> <given-names>C.</given-names></name> <name><surname>Houston</surname> <given-names>P.</given-names></name> <name><surname>Humphreys</surname> <given-names>H.</given-names></name> <name><surname>Robinson</surname> <given-names>D. A.</given-names></name> <name><surname>Loughman</surname> <given-names>A.</given-names></name> <etal/></person-group>. (<year>2008</year>). <article-title>A novel <italic>Staphylococcus aureus</italic> biofilm phenotype mediated by the fibronectin-binding proteins, FnBPA and FnBPB</article-title>. <source>J. Bacteriol.</source> <volume>190</volume>, <fpage>3835</fpage>&#x02013;<lpage>3850</lpage>. <pub-id pub-id-type="doi">10.1128/JB.00167-08</pub-id><pub-id pub-id-type="pmid">18375547</pub-id></citation></ref>
<ref id="B32">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>O&#x00027;Neill</surname> <given-names>E.</given-names></name> <name><surname>Pozzi</surname> <given-names>C.</given-names></name> <name><surname>Houston</surname> <given-names>P.</given-names></name> <name><surname>Smyth</surname> <given-names>D.</given-names></name> <name><surname>Humphreys</surname> <given-names>H.</given-names></name> <name><surname>Robinson</surname> <given-names>D. A.</given-names></name> <etal/></person-group>. (<year>2007</year>). <article-title>Association between methicillin susceptibility and biofilm regulation in <italic>Staphylococcus aureus</italic> isolates from device-related infections</article-title>. <source>J. Clin. Microbiol.</source> <volume>45</volume>:<fpage>1379</fpage>. <pub-id pub-id-type="doi">10.1128/JCM.02280-06</pub-id><pub-id pub-id-type="pmid">17329452</pub-id></citation></ref>
<ref id="B33">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Petti</surname> <given-names>C. A.</given-names></name> <name><surname>Fowler</surname> <given-names>V. G.</given-names> <suffix>Jr.</suffix></name></person-group> (<year>2003</year>). <article-title><italic>Staphylococcus aureus</italic> bacteremia and endocarditis</article-title>. <source>Cardiol. Clin.</source> <volume>21</volume>:<fpage>219</fpage>. <pub-id pub-id-type="doi">10.1016/S0733-8651(03)00030-4</pub-id><pub-id pub-id-type="pmid">12874895</pub-id></citation></ref>
<ref id="B34">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Pugliese</surname> <given-names>G.</given-names></name> <name><surname>Favero</surname> <given-names>M. S.</given-names></name></person-group> (<year>2002</year>). <article-title>biofilms: survival mechanisms of clinically relevant microorganisms</article-title>. <source>Clin. Microbiol. Rev.</source> <volume>15</volume>:<fpage>167</fpage>. <pub-id pub-id-type="doi">10.1128/CMR.15.2.167-193.2002</pub-id></citation></ref>
<ref id="B35">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Qiu</surname> <given-names>J.</given-names></name> <name><surname>Li</surname> <given-names>H.</given-names></name> <name><surname>Meng</surname> <given-names>H.</given-names></name> <name><surname>Hu</surname> <given-names>C.</given-names></name> <name><surname>Li</surname> <given-names>J.</given-names></name> <name><surname>Luo</surname> <given-names>M.</given-names></name> <etal/></person-group>. (<year>2011</year>). <article-title>Impact of luteolin on the production of alpha-toxin by <italic>Staphylococcus aureus</italic></article-title>. <source>Lett. Appl. Microbiol.</source> <volume>53</volume>:<fpage>238</fpage>. <pub-id pub-id-type="doi">10.1111/j.1472-765X.2011.03098.x</pub-id><pub-id pub-id-type="pmid">21671964</pub-id></citation></ref>
<ref id="B36">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ragle</surname> <given-names>B. E.</given-names></name> <name><surname>Karginov</surname> <given-names>V. A.</given-names></name> <name><surname>Bubeck</surname> <given-names>W. J.</given-names></name></person-group> (<year>2010</year>). <article-title>Prevention and treatment of <italic>Staphylococcus aureus</italic> pneumonia with a -cyclodextrin derivative</article-title>. <source>Antimicrob. Agents Chemother.</source> <volume>54</volume>, <fpage>298</fpage>&#x02013;<lpage>304</lpage>. <pub-id pub-id-type="doi">10.1128/AAC.00973-09</pub-id><pub-id pub-id-type="pmid">19805564</pub-id></citation></ref>
<ref id="B37">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Roche</surname> <given-names>F. M.</given-names></name> <name><surname>Massey</surname> <given-names>R.</given-names></name> <name><surname>Peacock</surname> <given-names>S. J.</given-names></name> <name><surname>Day</surname> <given-names>N. P.</given-names></name> <name><surname>Visai</surname> <given-names>L.</given-names></name> <name><surname>Speziale</surname> <given-names>P.</given-names></name> <etal/></person-group>. (<year>2003</year>). <article-title>Characterization of novel LPXTG-containing proteins of <italic>Staphylococcus aureus</italic> identified from genome sequences</article-title>. <source>Microbiology</source> <volume>149</volume>(<issue>Pt 3</issue>), <fpage>643</fpage>. <pub-id pub-id-type="doi">10.1099/mic.0.25996-0</pub-id><pub-id pub-id-type="pmid">12634333</pub-id></citation></ref>
<ref id="B38">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Rooijakkers</surname> <given-names>S. H. M.</given-names></name> <name><surname>Kessel</surname> <given-names>K. P. M. V.</given-names></name> <name><surname>Strijp</surname> <given-names>J. A. G. V.</given-names></name></person-group> (<year>2005</year>). <article-title>Staphylococcal innate immune evasion</article-title>. <source>Trends Microbiol.</source> <volume>13</volume>:<fpage>596</fpage>. <pub-id pub-id-type="doi">10.1016/j.tim.2005.10.002</pub-id><pub-id pub-id-type="pmid">16242332</pub-id></citation></ref>
<ref id="B39">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Sahu</surname> <given-names>N. K.</given-names></name> <name><surname>Balbhadra</surname> <given-names>S. S.</given-names></name> <name><surname>Choudhary</surname> <given-names>J.</given-names></name> <name><surname>Kohli</surname> <given-names>D. V.</given-names></name></person-group> (<year>2012</year>). <article-title>Exploring pharmacological significance of chalcone scaffold: a review</article-title>. <source>Curr. Med. Chem.</source> <volume>19</volume>, <fpage>209</fpage>&#x02013;<lpage>225</lpage>. <pub-id pub-id-type="doi">10.2174/092986712803414132</pub-id><pub-id pub-id-type="pmid">22320299</pub-id></citation></ref>
<ref id="B40">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Scott</surname> <given-names>J. R.</given-names></name> <name><surname>Barnett</surname> <given-names>T. C.</given-names></name></person-group> (<year>2006</year>). <article-title>Surface proteins of gram-positive bacteria and how they get there</article-title>. <source>Annu. Rev. Microbiol.</source> <volume>60</volume>, <fpage>397</fpage>&#x02013;<lpage>423</lpage>. <pub-id pub-id-type="doi">10.1146/annurev.micro.60.080805.142256</pub-id><pub-id pub-id-type="pmid">16753030</pub-id></citation></ref>
<ref id="B41">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Tonthat</surname> <given-names>H.</given-names></name> <name><surname>Liu</surname> <given-names>G.</given-names></name> <name><surname>Mazmanian</surname> <given-names>S. K.</given-names></name> <name><surname>Faull</surname> <given-names>K. F.</given-names></name> <name><surname>Schneewind</surname> <given-names>O.</given-names></name></person-group> (<year>1999</year>). <article-title>Purification and characterization of sortase, the transpeptidase that cleaves surface proteins of <italic>Staphylococcus aureus</italic> at the LPXTG motif</article-title>. <source>Proc. Natl. Acad. Sci. U.S.A.</source> <volume>96</volume>:<fpage>12424</fpage>. <pub-id pub-id-type="doi">10.1073/pnas.96.22.12424</pub-id></citation></ref>
<ref id="B42">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Wallockrichards</surname> <given-names>D. J.</given-names></name> <name><surname>Marleswright</surname> <given-names>J.</given-names></name> <name><surname>Clarke</surname> <given-names>D. J.</given-names></name> <name><surname>Maitra</surname> <given-names>A.</given-names></name> <name><surname>Dodds</surname> <given-names>M.</given-names></name> <name><surname>Hanley</surname> <given-names>B.</given-names></name> <etal/></person-group>. (<year>2015</year>). <article-title>Molecular basis of <italic>Streptococcus mutans</italic> sortase A inhibition by the flavonoid natural product trans-chalcone</article-title>. <source>Chem. Commun.</source> <volume>51</volume>:<fpage>10483</fpage>. <pub-id pub-id-type="doi">10.1039/C5CC01816A</pub-id></citation></ref>
<ref id="B43">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Wardenburg</surname> <given-names>J. B.</given-names></name> <name><surname>Patel</surname> <given-names>R. J.</given-names></name> <name><surname>Schneewind</surname> <given-names>O.</given-names></name></person-group> (<year>2007</year>). <article-title>Surface proteins and exotoxins are required for the pathogenesis of <italic>Staphylococcus aureus</italic> pneumonia</article-title>. <source>Infect. Immun.</source> <volume>75</volume>, <fpage>1040</fpage>&#x02013;<lpage>1044</lpage>. <pub-id pub-id-type="doi">10.1128/IAI.01313-06</pub-id></citation></ref>
<ref id="B44">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>B.</given-names></name> <name><surname>Wang</surname> <given-names>X.</given-names></name> <name><surname>Wang</surname> <given-names>L.</given-names></name> <name><surname>Chen</surname> <given-names>S.</given-names></name> <name><surname>Shi</surname> <given-names>D.</given-names></name> <name><surname>Wang</surname> <given-names>H.</given-names></name></person-group> (<year>2016</year>). <article-title>Molecular mechanism of the flavonoid natural product dryocrassin ABBA against <italic>Staphylococcus aureus</italic> sortase A</article-title>. <source>Molecules</source> <volume>21</volume>:<fpage>1428</fpage>. <pub-id pub-id-type="doi">10.3390/molecules21111428</pub-id><pub-id pub-id-type="pmid">27792196</pub-id></citation></ref>
<ref id="B45">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>J.</given-names></name> <name><surname>Liu</surname> <given-names>H.</given-names></name> <name><surname>Zhu</surname> <given-names>K.</given-names></name> <name><surname>Gong</surname> <given-names>S.</given-names></name> <name><surname>Dramsi</surname> <given-names>S.</given-names></name> <name><surname>Wang</surname> <given-names>Y. T.</given-names></name> <etal/></person-group>. (<year>2014</year>). <article-title>Antiinfective therapy with a small molecule inhibitor of <italic>Staphylococcus aureus</italic> sortase</article-title>. <source>Proc. Natl. Acad. Sci. U.S.A.</source> <volume>111</volume>, <fpage>13517</fpage>&#x02013;<lpage>13522</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.1408601111</pub-id><pub-id pub-id-type="pmid">25197057</pub-id></citation></ref>
<ref id="B46">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zhou</surname> <given-names>X.</given-names></name> <name><surname>Liu</surname> <given-names>S.</given-names></name> <name><surname>Li</surname> <given-names>W.</given-names></name> <name><surname>Zhang</surname> <given-names>B.</given-names></name> <name><surname>Liu</surname> <given-names>B.</given-names></name> <name><surname>Liu</surname> <given-names>Y.</given-names></name> <etal/></person-group>. (<year>2015</year>). <article-title>Phloretin derived from apple can reduce alpha-hemolysin expression in methicillin-resistant <italic>Staphylococcus aureus</italic> USA300</article-title>. <source>World J. Microbiol. Biotechnol.</source> <volume>31</volume>, <fpage>1259</fpage>&#x02013;<lpage>1265</lpage>. <pub-id pub-id-type="doi">10.1007/s11274-015-1879-1</pub-id><pub-id pub-id-type="pmid">26026280</pub-id></citation></ref>
</ref-list>
<fn-group>
<fn fn-type="financial-disclosure"><p><bold>Funding.</bold> This work was supported by the National Key Technology R&#x00026;D Program (No. 2016YFD05013), the National Basic Research Program of China (grant 2013CB127205) and the Project Funded by China Postdoctoral Science Foundation (Project No. 2016M591486).</p>
</fn>
</fn-group>
</back>
</article>