The soil microbiome is assumed to play a crucial role for plant growth and health in terms of acquiring water and nutrients, acting antagonistically against soil-borne plant pests and pathogens, as well as inducing plant defense responses against pathogens (Berendsen et al., 2012). Negative effects of the soil microbiome on plant growth and yield were also revealed, especially at sites with monocultures and with lack of sustainable management practices (Magarey, 1999; Seigies and Pritts, 2006; Wu et al., 2015; Zhao et al., 2016). This is likely due to a reduced microbial diversity because of the repeated monoculturing (Howe et al., 2014).

Apple plants cultivated repeatedly at the same site have often been reported to show reduced shoot and root growth. It is assumed that pathogenic microorganisms increased in abundance in response to plant root exudations of previous cultures (Badri and Vivanco, 2009; Mazzola and Manici, 2012; Yim et al., 2013; Nicola et al., 2017). This so-called apple replant disease (ARD) has severe consequences in terms of economic losses in tree nurseries and apple production worldwide.

A recent study employing transcriptomic analysis in roots of apple rootstock M26 plants grown in ARD soils compared to Gamma-sterilized soil discovered that the expression of plant genes associated with plant defense, i.e., phytoalexin production genes was increased while genes involved in the primary metabolism were less expressed (Weiß et al., 2017) indicating plant response to soil-borne pathogens. Possible ARD causing organisms identified from cultivation dependent approaches included actinomycetes (Otto et al., 1994), Pythium sp. (Hoestra, 1994; Emmett et al., 2014), Cylindrocarpon sp., Phytophthora sp., Rhizoctonia solani (Mazzola, 1998; Tewoldemedhin et al., 2011; Kelderer et al., 2012) and nematodes, e.g., the soil endoparasitic nematode Pratylenchus penetrans (Mai et al., 1994). Several recent studies employed total community (TC-) DNA-based approaches to identify these pathogens, but rather showed microbial community shifts in ARD soils after soil treatments that restored apple growth (Yim et al., 2013; Sun et al., 2014; Franke-Whittle et al., 2015; Nicola et al., 2017). Because the etiology of ARD is complex, conventional soil fumigants with a broad spectrum of biocides such as chloropicrin, 1.2 dichloropropane, 1.3 dichloropropene, methyl bromide and Basamid® granules were shown to be the most effective treatments against ARD (Mai and Abawi, 1978; Brown and Koutoulis, 2008; Yim et al., 2013; Nicola et al., 2017). However, those chemical substances were reported to be toxic, and their application is no longer allowed in many countries (Ruzo, 2006; Porter et al., 2010).

For environmentally friendly approaches, crop rotation or treating replant disease (RD) soil using several Brassicaceae species (biofumigation) or Tagetes (nematode repelling) demonstrated promising effects against disease-causing organisms in soils (Sarwar et al., 1998; Topp et al., 1998; Mattner et al., 2008; Marahatta et al., 2012; Pino et al., 2016), and subsequently reduced RD symptoms on plant growth (Seigies and Pritts, 2006; Mazzola et al., 2015; Yim et al., 2016). Effects of biofumigation originate from plant secondary metabolites glucosinolates (GS) that are hydrolyzed mainly by plant myrosinase enzymes (reviewed by Halkier and Gershenzon, 2006), subsequently releasing several compounds depending on soil properties (Halkier and Gershenzon, 2006), such as isothiocyanates (ITC), nitriles, thiocyanates, epithionitriles, and oxazolidine-2-thiones (Brown et al., 1991; Kirkegaard and Sarwar, 1998). Among GS-degraded products, volatile ITCs were shown to be responsible for suppression of weeds (Sarwar et al., 1998; Malik et al., 2008; Mattner et al., 2008), soil-borne plant pests and pathogens in different crop systems (Borek et al., 1998; Peterson et al., 1998; Matthiessen and Shackleton, 2005; Bones and Rossiter, 2006; Mazzola et al., 2007; Mattner et al., 2008; Aires et al., 2009; Agerbirk and Olsen, 2012; Neubauer et al., 2014). On the other hand, Tagetes plants are renowned to exhibit toxicity in soils due to their thiophene contents (Hooks et al., 2010; Saha et al., 2012). Highly suppressed growth of several soil-borne plant pathogenic fungi such as R. solani and Fusarium solani mediated by these biocidal compounds was demonstrated via in vitro evaluations (Saha et al., 2012).

In our previous field study, the effects of pre-treatments of RD soils with the soil fumigant Basamid, biofumigation with Brassica juncea and Raphanus sativus and growing Tagetes plants at the two sites K and A on plant performance were investigated. Findings revealed that effects of the different treatments evaluated by field growth of apple rootstock M106 plants were site-dependent. At site K, shoot fresh mass (SFM) of the M106 plants significantly increased by 155, 148, 165, and 175% in treated soils with Basamid, B. juncea, R. sativus, and Tagetes, respectively, relative to the corresponding RD soil. At site A, a moderate effect was observed only for the RD soil cropped with Tagetes, with 52% increment in SFM (Yim et al., 2016). Changes in the bacterial and fungal community composition based on DGGE fingerprint analysis revealed a treatment- and site-dependent pattern (Yim et al., 2016), calling for deeper molecular investigations and characterization of these differences.

In the present study, a detailed analysis of the changes of soil bacterial and fungal community composition at the two sites was performed, focusing on diversity and relative abundances at different taxonomic levels in response to the treatments by means of Miseq® Illumina® sequencing. This study identified soil bacterial and fungal taxa affected by the different soil treatments (Basamid, B. juncea, R. sativus, and Tagetes) at the two sites under field conditions, and linked these microbial responders to ARD suppression.

The two RD sites K (53° 41′ 58.51″ N, 9° 41′ 34.12″ E) and A (53° 42′ 18.81″ N, 9° 48′ 16.74″ E) that had been used for producing rose and apple rootstocks, respectively, were submitted to different treatments under field conditions during the years 2012 and 2013 with permission by the owners. The sites differ in soil chemical and physical properties as described in Yim et al. (2016). Briefly, site K (sandy soil) has a higher proportion in organic matter and sand than site A (slightly loamy sand). Five treatments and three biological replicates (plots) per treatment were randomized in blocks on an area of 1,000 m² per site (45 m² per replicate). Parcels replanted with apple rootstocks M4 and M111 in May 2012 and 2013, respectively, served as untreated RD soils. The rootstocks were harvested each year in November. For treatment with Brassicaceae plants, seeds from two species, B. juncea ‘Terra Plus’ (12 kg ha⁻¹) and R. sativus ‘Defender’ (30 kg ha⁻¹) were sown onto RD soils twice, in April/May and in June/July (2012 and 2013). The plants at full flowering, about 8 weeks after sowing were cut at the soil line, chopped and subsequently incorporated into the soils using Humus WM Flail mulchers (Humus®, Bermatingen, Germany) and a common rotary cultivator (Yim et al., 2016). For treatment with Tagetes patula ‘Nemamix,’ 10 kg ha⁻¹ seeds were sown once per year in 2012 and 2013, in April/May. In both years, the plants grew until November before they were plowed. Seeds of B. juncea, R. sativus, and Tagetes were supplied by P. H. Petersen Saatzucht Lundsgaard GmbH, Germany. A chemical soil fumigant treatment with Basamid® granules (97% Dazomet) was performed once in August 2013 at a dose of 400 kg ha⁻¹ (ProfiFlor GmbH, Stommeln, Germany) applied when the second biofumigation was carried out (end of August 2013).

Four weeks after the Basamid and biofumigation treatments, bulk soils were sampled the same day in September 2013 using a 3.5 cm diameter core soil sampler at 0–20 cm depth. The sampling schedule and procedures were the same as for the treatments with Tagetes and untreated RD. At the sampling date, the flowering Tagetes plants had not been incorporated into the soil. The homogenized and sieved (mesh sizes ≤ 2 mm) soil samples were submitted to TC-DNA extraction and purification as described in Yim et al. (2016). In brief, 0.5 g of soil was used for TC-DNA extraction after a harsh cell lysis.

Amplicon sequencing for bacteria and fungi was implemented via Miseq® Illumina® (Illumina, San Diego, CA, USA) sequencing. For the bacterial 16S rRNA gene fragments, an initial PCR amplification step was performed using a set of primer pairs 341F (CCTAYGGGRBGCASCAG) and 806R (GGACTACHVGGGTWTCTAAT) to flank the approximate 460 bp variable V3-V4 regions as described by Nunes et al. (2016). Regarding the ITS regions for fungi, primers gITS7 (GTGARTCATCGARTCTTTG) and ITS4 (TCCTCCGCTTATTGATATGC) were applied to obtain the fragments of interest (Ihrmark et al., 2012). Purification and size-selection of products of more than 100 bp from a second amplification step using the same primers with attachment of adaptors and barcode tags was performed with Agencourt AMPure XP beads (Beckman Coulter, Brea, CA, USA) according to the manufacturer's instructions. The samples were then pooled and adjusted to equimolar concentrations measured using a Qubit Fluorometer (Life Technologies, Carlsbad, CA, USA), concentrated using the DNA Clean and Concentrator™-5 kit (Zymo Research, Irvine, CA, USA), and finally subjected to 2 × 250 bp paired-end high-throughput sequencing on an Illumina® MiSeq® platform.

Amplicon sequences were analyzed using qiime_pipe (https://github.com/maasha/qiime_pipe) with default settings, which performs sample demultiplexing, quality-based sequence trimming, primer removal and paired-end reads assembly prior to annotation workflow (Caporaso et al., 2010). Annotation procedure for bacterial sequences is derived from previously described work (Nunes et al., 2016). Chimera check was done with UCHIME (Edgar et al., 2011) and Operational Taxonomic Units (OTUs) were picked at 97% sequence identity level. OTU representative sequences were selected by the highest abundance within the cluster and assigned to taxonomy using the RDP classifier, with a confidence threshold of 80%. Read contingency tables were exported at the species level in order to define OTUs. For fungi, if a sequence had the same bit score to more than one species hypothesis (SH) in the UNITE version 7.0 database (Koljalg et al., 2013) of Megablast (Camacho et al., 2009), then it was assigned to the most abundant SH in the dataset. Selected OTUs were based on the assigned sequences that were more than 95% similarity to any SH or had greater than 100 bp alignment length. Illumina sequencing data were deposited at the NCBI sequence read archive under the accession number PRJNA352771.

Changes in bacterial and fungal community composition and relative abundances based on Illumina sequencing of 16S rRNA gene or ITS fragments amplified from TC-DNAs extracted from soils after treatments with Basamid, B. juncea, R. sativus, and Tagetes were investigated via comparison to corresponding untreated RD soils at two sites in order to identify causes for the differentially improved plant growth in treated soils.

The observed differences in soil bacterial and fungal community compositions between the two RD sites were in line with our previous findings (Yim et al., 2015, 2016). The two RD sites differed in soil type, soil physical and chemical properties and soil cultivation and management history (Yim et al., 2015, 2016). Different soil microbiomes with different capacities in RD development of the two studied sites were in line with previous observations of soil microbiomes being shaped by different plant species or genotypes (St. Laurent et al., 2010; Uroz et al., 2016), soil types and soil amendments like mineral nutrients (Bakker et al., 2015).

Also the soil treatments differed in their efficacy in a site dependent way (Figures 1, 3; Tables 3, 7). This is most likely due to the fact that ITCs, the toxic compounds released from the treatments with Basamid (methyl-ITC), B. juncea (allyl-ITC) and R. sativus (4-methylthio-3-butenyl-ITC) differed in their profiles and concentrations depending on the site (Yim et al., 2016). Variations in toxicity of different ITC compounds against tested pathogens were previously reported (Neubauer et al., 2014).

The analyzed samples were taken 4 weeks after different treatments (B. juncea, R. sativus, and Basamid). Thus, changes in relative abundance of bacteria and fungi in treated soils with B. juncea and R. sativus can possibly be explained with the effects of plant root exudation (Bertin et al., 2003; Berg and Smalla, 2009; Schreiter et al., 2014), toxicity of ITCs released from the treatments (Neubauer et al., 2014; Hanschen et al., 2015), a huge amount of plant biomass incorporation into treated soils as well as nutrients released from plant biomass degradation as previously reported (Bakker et al., 2015; Yim et al., 2016). Flavonoids and other phenolic compounds were also reported to be present in Brassicaceae tissues (Antonious et al., 2009; Cartea et al., 2011) and were shown to influence the soil microbiome (Weston and Mathesius, 2013). Analyses with samples taken at different time points could resolve responders that were affected by those different effects. Regarding the Basamid treatments, altering soil bacterial and fungal relative abundances possibly resulted from combinations of a direct toxic effect of methyl-ITC released from the treatment, recolonization and niche competition of taxa recovering from the treatments (Ridge and Theodorou, 1972; Neumann et al., 1983; Hibbing et al., 2010).

Microbial taxa associated with apple RD symptoms were not consistently detected in the recent TC-DNAs based studies in apple RD soils (Sun et al., 2014; Franke-Whittle et al., 2015; Yim et al., 2015; Nicola et al., 2017). For example, several bacterial genera such as Gp5, Gp6, Gp9, Geobacter (Nicola et al., 2017), Gemmatimonas, Devosia, Sphingomonas (Franke-Whittle et al., 2015), Phenylobacterium and Lysobacter (Sun et al., 2014; Franke-Whittle et al., 2015) and the fungal genera Cryptococcus, Mortierella, and Tricharina (Nicola et al., 2017) were not commonly identified to be linked with apple RD incidence among studies in which their relative abundances were negatively correlated with growth of apple plants. In the present study, the bacterial genus Flavitalea and the fungal genera unclassified Pleosporales, Cryptococcus, and Mucor could be associated with RD incidence with M106 plants as indicated by a negative correlation to the shoot or root growth (Tables 4, 8). In contrast, the bacterial genera Arthrobacter, Curtobacterium, Terrimonas, Ferruginibacter and the fungal genera unclassified Sordariomycetes, unclassified Sordariales and Podospora revealed a positive correlation to the shoot or root growth of M106 plants.

The positive and negative correlations of the fungal genera Podospora and Cryptococcus, respectively, to plant growth in the present study were in agreement with the observations by Franke-Whittle et al. (2015) who analyzed microbial communities at different apple replant disease sites. The relative abundances of several bacterial genera, like Arthrobacter, Terrimonas, and Ferruginibacter and fungal genera, for instance Podospora that were positively and significantly correlated with growth of the apple M106 plants (Tables 4, 8) were lower in RD soils treated with Basamid, B. juncea, R. sativus, and Tagetes at site A than at site K (Tables 3, 7). These differences might contribute to explain the lower effectiveness of these treatments at site A revealed by the growth of M106 plants. Thus, knowing RD site specificities such as its local selected microbiomes influenced by soil properties, soil quality, and pedoclimatic conditions is an important point before choosing the right RD management strategies. Such sequence approaches used in the present work are important in identifying potential bioindicators in the RD soils (Nunes et al., 2016; Schöler et al., 2017).

The effects of the Tagetes treatment on soil bacterial and fungal community composition (Tables 2, 6; Figures 1, 3) and relative abundances of different fungal and bacterial genera (Tables 3, 7) were lower than those resulting from B. juncea and R. sativus treatments. This might at least partially be due to the fact that samples were taken when Tagetes plants were still growing in 2013, thus only root exudates, but not plowed plant biomass could contribute to the observed effects. Shifts in bacterial and fungal relative abundances in the Tagetes-treated soils would probably have been higher if the analyzed samples had been taken 4 weeks after plant tissue incorporation. In 2012, however, the total plant biomass from Tagetes was incorporated into the soil. Therefore, several bacterial and fungal groups were significantly altered in abundance by this treatment, although site-dependently (Tables 3, 7). Tagetes are known as nematode-repellent plants due to their sulfur-containing heterocyclic compounds, thiophenes, produced by plant roots (Marotti et al., 2010; Marahatta et al., 2012; Saha et al., 2012). In the present study, soil-borne plant endoparasitic nematode Pratylenchus sp. which has previously been reported to be associated with apple RD soil (Mai et al., 1994) was strongly reduced in Tagetes-treated soil compared with the untreated RD soils, especially at site A (Table S6). Besides thiophenes, terpenoids including dihydrotagetone, piperitone and α-terpineol were predominantly identified in leaves and flowers of Tagetes (Saha et al., 2012). The thiophenes and terpenoids showed highly suppressive potential for several soil-borne and foliar plant pathogenic fungi of several crops such as finger millet (Pyricularia grisea), French bean (R. solani, F. solani, and Sclerotium rolfsii), pea (Fusarium oxysporum), and tomato (Alternaria solani) in an in vitro study (Saha et al., 2012). Despite the less pronounced changes in soil bacterial and fungal community composition in soils cropped with Tagetes plants compared to other treatments (Tables 3, 7; Figures 1, 3), interestingly, the growth of the indicator plants, M106, showed comparable effects among all treatments at site K (Table S1). Therefore, soil-borne pathogenic nematodes were possibly one of the causal ARD agents in the analyzed soils that were suppressed by the Tagetes treatment.

The stronger effect observed on fungal community compositions in RD soils treated with B. juncea and R. sativus compared to bacteria (Figures 1, 3; Tables 2, 6) confirmed the observations made in several other studies when the soils were submitted to products containing ITCs (Hollister et al., 2013; Hu et al., 2015). Interestingly, at site K, a higher effect on soil fungi and a lower effect on soil bacteria in RD soils treated with B. juncea, R. sativus, and Tagetes (R-values, Tables 2, 6) was found in line with the biomass of apple rootstock M106 plants being significantly higher only at this site as well (Table S1; Yim et al., 2016). This shows that soil at site K was more affected by RD, pointing to a more important role of fungi in RD incidences, as stated earlier by Mazzola (1998).

Bacterial or fungal responders to the soil treatments applied in this study were treatment- and site-dependent. Most importantly, pre-RD soil treatments improved apple growth as previously published (Yim et al., 2016). The positive and significant effects of the different RD soil treatments on growth of the M106 plants at site K were associated with alterations of both bacterial and fungal communities in the treated RD soils. Since more significant changes involved increased abundances of the respective genera, a certain number of beneficial bacterial and fungal genera is possibly required to enhance the plant growth and to counteract plant-pathogens. The enriched bacterial and fungal groups detected should be further studied with regard to their potential roles in overcoming RD. The negative correlation with growth of the M106 plants as well as the high relative abundance of the fungal order Pleosporales in the untreated RD soils was possibly an indication of a potential fungal pathogenic group in the analyzed soils. Overall, the present study revealed shifts in the bacterial and even more pronounced in the fungal communities in response to the treatments of RD soils, and the relative abundances of numerous taxa that were positively correlated to apple plant growth were identified.

BY: Implementing the project; sampling soil from the field, TC-DNA extraction, analyzing and interpreting data of the work and writing the manuscript (MS). HN: Contributing in the project experimental design, providing the nematode data and contributing to improve the MS. AW: Contributing in the project experimental design, soil sampling and performing the field experiment. SJ: Performing Miseq Illumina sequencing, data analyzing and contributing in writing the MS and final approval of the version to be published. SS: Contributing in writing the MS and final approval of the version to be published. TW: Substantial contributions to the conception or design of the work, interpretation of data, writing the MS and final approval of the version to be published. As well as be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. KS: Substantial contributions to the conception or design of the work, interpretation of data, writing the MS and final approval of the published version.