<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Microbiol.</journal-id>
<journal-title>Frontiers in Microbiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Microbiol.</abbrev-journal-title>
<issn pub-type="epub">1664-302X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fmicb.2017.01329</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Microbiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Bypassing the Need for the Transcriptional Activator EarA through a Spontaneous Deletion in the BRE Portion of the <italic>fla</italic> Operon Promoter in <italic>Methanococcus maripaludis</italic></article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name><surname>Ding</surname> <given-names>Yan</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/456313/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Berezuk</surname> <given-names>Alison</given-names></name>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/439498/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Khursigara</surname> <given-names>Cezar M.</given-names></name>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/164497/overview"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Jarrell</surname> <given-names>Ken F.</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="author-notes" rid="fn001"><sup>&#x002A;</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/157666/overview"/>
</contrib>
</contrib-group>
<aff id="aff1"><sup>1</sup><institution>Department of Biomedical and Molecular Sciences, Queen&#x2019;s University, Kingston</institution> <country>ON, Canada</country></aff>
<aff id="aff2"><sup>2</sup><institution>Department of Molecular and Cellular Biology, University of Guelph, Guelph</institution> <country>ON, Canada</country></aff>
<author-notes>
<fn fn-type="edited-by"><p>Edited by: <italic>Julie Anne Maupin-Furlow, University of Florida, United States</italic></p></fn>
<fn fn-type="edited-by"><p>Reviewed by: <italic>Hua Xiang, Institute of Microbiology (CAS), China; Eveline Peeters, Vrije Universiteit Brussel, Belgium</italic></p></fn>
<fn fn-type="corresp" id="fn001"><p>&#x002A;Correspondence: <italic>Ken F. Jarrell, <email>jarrellk@queensu.ca</email></italic></p></fn>
<fn fn-type="other" id="fn002"><p>This article was submitted to Microbial Physiology and Metabolism, a section of the journal Frontiers in Microbiology</p></fn></author-notes>
<pub-date pub-type="epub">
<day>17</day>
<month>07</month>
<year>2017</year>
</pub-date>
<pub-date pub-type="collection">
<year>2017</year>
</pub-date>
<volume>08</volume>
<elocation-id>1329</elocation-id>
<history>
<date date-type="received">
<day>19</day>
<month>04</month>
<year>2017</year>
</date>
<date date-type="accepted">
<day>30</day>
<month>06</month>
<year>2017</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#x00A9; 2017 Ding, Berezuk, Khursigara and Jarrell.</copyright-statement>
<copyright-year>2017</copyright-year>
<copyright-holder>Ding, Berezuk, Khursigara and Jarrell</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/"><p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p></license>
</permissions>
<abstract>
<p>In <italic>Methanococcus maripaludis</italic>, the euryarchaeal archaellum regulator A (EarA) is required for the transcription of the <italic>fla</italic> operon, which is comprised of a series of genes which encode most of the proteins needed for the formation of the archaeal swimming organelle, the archaellum. In mutants deleted for <italic>earA</italic> (&#x0394;<italic>earA</italic>), there is almost undetectable transcription of the <italic>fla</italic> operon, Fla proteins are not synthesized and the cells are non-archaellated. In this study, we have isolated a spontaneous mutant of a &#x0394;<italic>earA</italic> mutant in which the restoration of the transcription and translation of the <italic>fla</italic> operon (using <italic>flaB2</italic>, the second gene of the operon, as a reporter), archaella formation and swarming motility were all restored even in the absence of EarA. Analysis of the DNA sequence from the <italic>fla</italic> promoter of this spontaneous mutant revealed a deletion of three adenines within a string of seven adenines in the transcription factor B recognition element (BRE). When the three adenine deletion in the BRE was regenerated in a stock culture of the &#x0394;<italic>earA</italic> mutant, very similar phenotypes to that of the spontaneous mutant were observed. Deletion of the three adenines in the <italic>fla</italic> promoter BRE resulted in the mutant BRE having high sequence identity to BREs from promoters that have strong basal transcription level in <italic>Mc. maripaludis</italic> and <italic>Methanocaldococcus jannaschii</italic>. These data suggest that EarA may help recruit transcription factor B to a weak BRE in the <italic>fla</italic> promoter of wild-type cells but is not required for transcription from the <italic>fla</italic> promoter with a strong BRE, as in the three adenine deletion version in the spontaneous mutant.</p>
</abstract>
<kwd-group>
<kwd>BRE deletion</kwd>
<kwd>archaellum</kwd>
<kwd>EarA</kwd>
<kwd>promoter</kwd>
<kwd><italic>fla</italic> operon</kwd>
<kwd>archaea</kwd>
</kwd-group>
<counts>
<fig-count count="6"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="41"/>
<page-count count="10"/>
<word-count count="0"/>
</counts>
</article-meta>
</front>
<body>
<sec><title>Introduction</title>
<p>In the third domain of life, the Archaea, the transcription machinery is composed of a multi-subunit RNA polymerase that shares homology to the eukaryotic RNA polymerase II, as well as two general transcription factors: the TATA-box binding protein (TBP) and transcription factor B (TFB) (<xref ref-type="bibr" rid="B5">Bell and Jackson, 2001</xref>; <xref ref-type="bibr" rid="B18">Jun et al., 2011</xref>; <xref ref-type="bibr" rid="B14">Gehring et al., 2016</xref>). The corresponding DNA elements of a basal archaeal promoter includes a purine-rich transcription factor B recognition element (BRE), which is recognized by the TFB, immediately followed by a TATA box centered at a distance of 26/27 bp upstream of the transcription start site (TSS) (<xref ref-type="bibr" rid="B35">Soppa, 1999</xref>; <xref ref-type="bibr" rid="B3">Bartlett, 2005</xref>; <xref ref-type="bibr" rid="B14">Gehring et al., 2016</xref>). To initiate transcription, TBP first binds to TATA box. This is followed by the binding of TFB to the DNA-TBP complex by recognition of the BRE sequence (<xref ref-type="bibr" rid="B6">Bell et al., 1999</xref>) and, finally, the recruitment of RNA polymerase to initiate transcription (<xref ref-type="bibr" rid="B5">Bell and Jackson, 2001</xref>). Mutations in either the TATA box or BRE can decrease transcription levels by reducing recruitment of TBP and TFB (<xref ref-type="bibr" rid="B3">Bartlett, 2005</xref>).</p>
<p>Although Archaea use a eukaryote-like basal transcription machinery, the genome structure and its transcription regulation are more like that found in Bacteria. In Archaea, a cluster of genes is co-transcribed into a poly-cistronic mRNA under the control of a single promoter, which can be regulated by repressors and/or activators (<xref ref-type="bibr" rid="B30">Peeters et al., 2013</xref>). Transcriptional activators typically bind to sites located upstream of the BRE and help in the recruitment of TBP or TFB. In contrast, repressors can bind to either the promoter region where they interfere with TFB or TBP binding by steric hindrance, or downstream of the promoter, sometimes even after the TSS, to prevent RNA polymerase recruitment or transcription elongation (<xref ref-type="bibr" rid="B4">Bell, 2005</xref>; <xref ref-type="bibr" rid="B30">Peeters et al., 2013</xref>; <xref ref-type="bibr" rid="B19">Karr, 2014</xref>). Transcriptional activators are often associated with promoters that have TATA box or BRE sequences that deviate from consensus sequences (<xref ref-type="bibr" rid="B27">Ochs et al., 2012</xref>; <xref ref-type="bibr" rid="B30">Peeters et al., 2013</xref>). They are believed to help overcome poor binding of TBP or TFB to weak TATA and BRE sequences to activate transcription (<xref ref-type="bibr" rid="B28">Ouhammouch et al., 2003</xref>; <xref ref-type="bibr" rid="B32">Peng et al., 2009</xref>; <xref ref-type="bibr" rid="B27">Ochs et al., 2012</xref>).</p>
<p>The methanogen <italic>Methanococcus maripaludis</italic> is a member of the phylum Euryarchaeota and a model organism for studies in Archaea. Here, the <italic>fla</italic> operon, encoding the components of the archaeal swimming organelle, the archaellum (<xref ref-type="bibr" rid="B17">Jarrell and Albers, 2012</xref>; <xref ref-type="bibr" rid="B1">Albers and Jarrell, 2015</xref>), begins with <italic>flaB1-B3</italic> encoding the three major structural proteins (archaellins), followed by the <italic>fla</italic>-associated genes <italic>flaC-J</italic> (<xref ref-type="bibr" rid="B7">Chaban et al., 2007</xref>). Transcription of the <italic>fla</italic> operon is controlled by the transcriptional activator EarA (<xref ref-type="bibr" rid="B12">Ding et al., 2016b</xref>). Deletion of <italic>earA</italic> results in almost undetectable transcription of the <italic>fla</italic> operon and a corresponding disappearance of FlaB2 protein and archaella production (<xref ref-type="bibr" rid="B12">Ding et al., 2016b</xref>). Immediately upstream of the BRE in the <italic>fla</italic> promoter, four 6 bp consensus sequences were identified as EarA binding sites. When all four EarA binding sites were eliminated in the genome of wild-type <italic>Mc. maripaludis</italic>, similar phenotypes were observed as in the &#x0394;<italic>earA</italic> mutant (<xref ref-type="bibr" rid="B12">Ding et al., 2016b</xref>). Recently, we have shown that EarA homologs from selected archaellated methanogens could successfully complement the function of EarA in the <italic>Mc. maripaludis</italic> &#x0394;<italic>earA</italic> mutant, indicating that the EarA regulatory model is likely widespread in the methanogen <italic>fla</italic> promoters (<xref ref-type="bibr" rid="B10">Ding et al., 2017</xref>).</p>
<p>In addition to the direct control of transcription of the <italic>fla</italic> operon by EarA, transcription of the <italic>fla</italic> operon was also found to be regulated under several growth conditions. Global transcriptome analysis of <italic>Mc. maripaludis</italic> showed that the transcription of the <italic>fla</italic> operon is up-regulated when H<sub>2</sub> is limited and down-regulated under leucine starvation, for example (<xref ref-type="bibr" rid="B16">Hendrickson et al., 2008</xref>). In addition, we recently showed that transcription of the <italic>fla</italic> operon was severely impaired in cells grown at temperatures greater than 38&#x00B0;C (<xref ref-type="bibr" rid="B11">Ding et al., 2016a</xref>). The mechanism behind the regulation of the <italic>fla</italic> promoter under the above conditions, including any possible involvement of EarA or other putative transcriptional activators or repressors, is yet to be reported.</p>
<p>In this study, we isolated a spontaneous mutant of the &#x0394;<italic>earA</italic> mutant in which transcription of the <italic>fla</italic> operon, production of archaellins and archaellation were all restored to near wild-type levels, despite the absence of EarA. Analysis of the <italic>fla</italic> promoter region of this mutant revealed a deletion of three adenines in the BRE. Recreation of the three adenine deletion in the original &#x0394;<italic>earA</italic> mutant by molecular biology techniques resulted in very similar archaella-related phenotypes as observed in the spontaneous mutant. Examination of the <italic>fla</italic> promoter wild-type BRE and the three adenine deletion BRE revealed that the mutant BRE were highly similar to BRE sequences associated with promoters with strong basal transcription levels in both <italic>Mc. maripaludis</italic> and a related hyperthermophilic methanogen <italic>Methanocaldococcus jannaschii</italic>.</p>
</sec>
<sec id="s1" sec-type="materials|methods">
<title>Materials and Methods</title>
<sec><title>Strains and Culture Conditions</title>
<p><italic>Methanococcus maripaludis</italic> &#x0394;<italic>hpt</italic> (Mm900) (<xref ref-type="bibr" rid="B26">Moore and Leigh, 2005</xref>), <italic>Mc. maripaludis</italic> &#x0394;<italic>hpt</italic>&#x0394;<italic>earA</italic> (&#x0394;<italic>earA</italic>, <xref ref-type="bibr" rid="B12">Ding et al., 2016b</xref>) and mutant strains derived from them were routinely cultured in 120 mL sealed serum bottles containing 10 mL Balch medium III under a headspace of H<sub>2</sub>:CO<sub>2</sub> (80:20) with shaking at 35&#x00B0;C (<xref ref-type="bibr" rid="B2">Balch et al., 1979</xref>). <italic>Escherichia coli</italic> TOP10 cells were cultured in Luria-Bertani (LB) broth or LB agar in the presence of 100 &#x03BC;g/mL ampicillin for plasmid selection at 37&#x00B0;C. Strains used in this study are listed in <bold>Table <xref ref-type="table" rid="T1">1</xref></bold>.</p>
<table-wrap position="float" id="T1">
<label>Table 1</label>
<caption><p>Strains and plasmids used in this study.</p></caption>
<table cellspacing="5" cellpadding="5" frame="hsides" rules="groups">
<thead>
<tr>
<th valign="top" align="left">Strains or plasmids</th>
<th valign="top" align="left">Description</th>
<th valign="top" align="left">Reference</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left" colspan="2"><bold><italic>Methanococcus maripaludis</italic> strains</bold></td>
<td valign="top" align="left"></td>
</tr>
<tr>
<td valign="top" align="left">Mm900</td>
<td valign="top" align="left"><italic>Mc. maripaludis</italic> S2 &#x0394;<italic>hpt</italic>, wild-type strain in this study</td>
<td valign="top" align="left"><xref ref-type="bibr" rid="B26">Moore and Leigh, 2005</xref></td>
</tr>
<tr>
<td valign="top" align="left">&#x0394;<italic>earA</italic></td>
<td valign="top" align="left">Mm900 &#x0394;<italic>earA<sub>Mma</sub></italic></td>
<td valign="top" align="left"><xref ref-type="bibr" rid="B12">Ding et al., 2016b</xref></td>
</tr>
<tr>
<td valign="top" align="left">&#x0394;<italic>earA-sp</italic></td>
<td valign="top" align="left">A spontaneous mutant derived from &#x0394;<italic>earA</italic> in which the transcription of <italic>flaB2</italic> was restored</td>
<td valign="top" align="left">This study</td>
</tr>
<tr>
<td valign="top" align="left">&#x0394;<italic>3A</italic></td>
<td valign="top" align="left">A mutant created from &#x0394;<italic>earA</italic> in which three adenines were deleted from the BRE region of the <italic>fla</italic> promoter</td>
<td valign="top" align="left">This study</td>
</tr>
<tr>
<td valign="top" align="left"><bold><italic>Escherichia coli</italic> strains</bold></td>
<td valign="top" align="left"></td>
<td valign="top" align="left"></td>
</tr>
<tr>
<td valign="top" align="left">TOP10</td>
<td valign="top" align="left">F<sup>-</sup> <italic>mcrA &#x0394;</italic>(<italic>mrr-hsdRMS-mcrBC</italic>) <italic>&#x03C6;80lacZ&#x0394;M15 &#x0394;lacX74 nupG recA1 araD139 &#x0394;</italic>(<italic>ara-leu</italic>)<italic>7697 galE15 galK16 rpsL</italic>(Str<sup>R</sup>) <italic>endA1</italic> aaa<sup>-</sup></td>
<td valign="top" align="left">Invitrogen</td>
</tr>
<tr>
<td valign="top" align="left"><bold>Plasmids</bold></td>
<td valign="top" align="left"></td>
<td valign="top" align="left"></td></tr>
<tr>
<td valign="top" align="left">pCRPrtNeo</td>
<td valign="top" align="left"><italic>hmv</italic> promoter-<italic>hpt</italic> fusion plus Neo<sup>r</sup> cassette in pCR2.1Topo; Amp<sup>r</sup></td>
<td valign="top" align="left"><xref ref-type="bibr" rid="B26">Moore and Leigh, 2005</xref></td>
</tr>
<tr>
<td valign="top" align="left">pKJ1273</td>
<td valign="top" align="left">pCRPrtNeo containing &#x223C;2 kb region from <italic>fla</italic> promoter in which three adenines in the BRE region were deleted</td>
<td valign="top" align="left">This study</td></tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec><title>Identification of a Spontaneous Mutant Strain (&#x0394;<italic>earA-sp</italic>) Derived from &#x0394;<italic>earA</italic> in Which the Expression of FlaB2 Was Restored</title>
<p>Immediately after its generation, the &#x0394;<italic>earA</italic> mutant was streaked three times for purity, and one colony was grown overnight and frozen as the stock culture at -80&#x00B0;C. Western blot analysis confirmed the cessation of FlaB2 expression in the &#x0394;<italic>earA</italic> strain at this stage (<xref ref-type="bibr" rid="B11">Ding et al., 2016a</xref>). The &#x0394;<italic>earA</italic> strain was also maintained in the lab via weekly subculture in Balch medium III statically at 37&#x00B0;C. After 6 months of sub-culturing, western blotting experiments revealed that the expression of FlaB2 was restored. PCR experiments determined that this strain still had the deletion of <italic>earA,</italic> so the restoration of FlaB2 expression was not a result of strain contamination. The newly isolated strain was named as &#x0394;<italic>earA-sp</italic> (<italic>sp</italic> for spontaneous).</p>
</sec>
<sec><title>Sequence Analysis of the <italic>fla</italic> Promoter Region in the &#x0394;<italic>earA-sp</italic> Strain</title>
<p>The <italic>fla</italic> promoter region spanning from -348 bp upstream of the TSS of the <italic>fla</italic> promoter to 162 bp downstream of the TSS from the &#x0394;<italic>earA-sp</italic> strain was PCR amplified using primer pair P1-For/P1-Rev (<bold>Table <xref ref-type="table" rid="T2">2</xref></bold>) and washed &#x0394;<italic>earA-sp</italic> cells as template (<xref ref-type="bibr" rid="B12">Ding et al., 2016b</xref>). The sequence of the PCR products was aligned with the corresponding region of the <italic>Mc. maripaludis</italic> S2 genome (NCBI version CAF31274.1) using Clustal Omega to detect the presence of any mutation (<xref ref-type="bibr" rid="B15">Goujon et al., 2010</xref>; <xref ref-type="bibr" rid="B34">Sievers et al., 2011</xref>).</p>
<table-wrap position="float" id="T2">
<label>Table 2</label>
<caption><p>Primers used in this study.</p></caption>
<table cellspacing="5" cellpadding="5" frame="hsides" rules="groups">
<thead>
<tr>
<th valign="top" align="left">Primers</th>
<th valign="top" align="left">Sequence</th>
<th valign="top" align="left">Restriction site incorporated (underlined)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left" colspan="2"><bold>Promoter-substitution primers</bold></td></tr>
<tr>
<td valign="top" align="left">P-fus-F</td>
<td valign="top" align="left">AGTC<underline>GGATCC</underline>ATACATCAGTTTGACAGGAC</td>
<td valign="top" align="left">BamHI</td></tr>
<tr>
<td valign="top" align="left">P-fus-R</td>
<td valign="top" align="left">GACT<underline>GGATCC</underline>CAGCAAATGATGCATTAACG</td>
<td valign="top" align="left">BamHI</td>
</tr>
<tr>
<td valign="top" align="left" colspan="2"><bold>Sequencing primers for promoter-substitution mutant screening</bold></td></tr>
<tr>
<td valign="top" align="left">P1-For</td>
<td valign="top" align="left">TTTATAGATTCTGGATGTTCAAATGC</td>
<td valign="top" align="left"></td></tr>
<tr>
<td valign="top" align="left">P1-Rev</td>
<td valign="top" align="left">ATCAAGGTACCAATTCCAGAAGC</td>
<td valign="top" align="left"></td>
</tr>
<tr>
<td valign="top" align="left">earA-seq-F</td>
<td valign="top" align="left">TGGATACGGTAAGTTCCATCG</td>
<td valign="top" align="left"></td>
</tr>
<tr>
<td valign="top" align="left">earA-seq-R</td>
<td valign="top" align="left">CAACTTCGAGAATAGTGTCTCC</td>
<td valign="top" align="left"></td>
</tr>
<tr>
<td valign="top" align="left"><bold>qRT-PCR primers</bold></td>
<td valign="top" align="left"></td>
<td valign="top" align="left"></td>
</tr>
<tr>
<td valign="top" align="left">B2-qRT-PCR-For</td>
<td valign="top" align="left">GCTGCAATAGACATGAATCAGG</td>
<td valign="top" align="left"></td>
</tr>
<tr>
<td valign="top" align="left">B2-qRT-PCR-Rev</td>
<td valign="top" align="left">GACCAGTTTACAGTTGTAGTGTTG</td>
<td valign="top" align="left"></td>
</tr>
<tr>
<td valign="top" align="left">slp-qRT-PCR-For</td>
<td valign="top" align="left">GGTACTGAAGCATACGAAGGAG</td>
<td valign="top" align="left"></td>
</tr>
<tr>
<td valign="top" align="left">slp-qRT-PCR-Rev</td>
<td valign="top" align="left">GCTACAACTTTACCGTCTTTTAAGAG</td>
<td valign="top" align="left"></td></tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec><title>Construction of Plasmids Used for the &#x0394;<italic>3A</italic> Mutant Strain Generation</title>
<p>A mutant strain harboring the same three adenine deletion in the <italic>fla</italic> promoter BRE region as found in the &#x0394;<italic>earA-sp</italic> strain was generated in the &#x0394;<italic>earA</italic> mutant that showed no production of FlaB2 by western blotting. Briefly, an &#x223C;2 kb DNA fragment containing the <italic>fla</italic> promoter region missing the three adenines in the BRE was PCR amplified with primers P-fus-F and P-fus-R (<bold>Table <xref ref-type="table" rid="T2">2</xref></bold>) and washed &#x0394;<italic>earA-sp</italic> strain cells as template. The PCR product was digested with BamHI and cloned into BamHI digested pCRPrtNeo (<xref ref-type="bibr" rid="B26">Moore and Leigh, 2005</xref>) to create plasmid pKJ1273. Sequencing of the insert in pKJ1273 confirmed the three adenine deletion in BRE and no other changes. To generate the &#x0394;<italic>3A</italic> mutant strain, pKJ1273 was transformed into &#x0394;<italic>earA</italic> using a PEG-based method (<xref ref-type="bibr" rid="B38">Tumbula et al., 1994</xref>). The transformation mixture was cultured overnight without selection and then sub-cultured in McCas medium containing 1 mg/ml of neomycin for selection of cells in which pKJ1273 was integrated into the genome. After two passages in medium with neomycin selection, cells were cultured in McCas medium without neomycin to allow a second recombination event that would excise the pCRPrtNeo vector backbone, and this culture was plated onto McCas agar with 250 &#x03BC;g/mL 8-azahypoxanthine to kill any cells in which the vector backbone had remained integrated. Single colonies were picked and cultured in Balch medium III for western blot analysis of FlaB2 expression. For colonies in which the FlaB2 expression was restored, PCR was conducted to amplify both the <italic>earA</italic> gene region and the <italic>fla</italic> promoter region using primers listed in <bold>Table <xref ref-type="table" rid="T2">2</xref></bold> and washed cells as template. The size of the PCR amplicons of the <italic>earA</italic> gene region was analyzed by electrophoresis through 0.8% agarose gels to confirm the deletion in <italic>earA</italic>. The PCR products of the <italic>fla</italic> promoter region from seven colonies that produced FlaB2 and four colonies that did not produce FlaB2 were sequenced. One of the colonies that produced FlaB2 and contained the deletion of the targeted three adenines in the BRE region was restreaked for purity and designated as &#x0394;<italic>3A</italic>.</p>
</sec>
<sec><title>Western Blot Analysis of FlaB2 Expression in <italic>Mc. maripaludis</italic> Strains</title>
<p>The presence of the archaellin FlaB2 in the wild-type and various mutant strains of <italic>Mc. maripaludis</italic> was analyzed by western blot with an anti-FlaB2 antibody as previously described (<xref ref-type="bibr" rid="B7">Chaban et al., 2007</xref>).</p>
</sec>
<sec><title>Quantitative RT-PCR (qRT-PCR) Analysis of the <italic>flaB2</italic> Transcription Level in <italic>Mc. maripaludis</italic> Strains</title>
<p>Total RNA from an <italic>Mc. maripaludis</italic> overnight cell culture was extracted using a High Pure RNA Isolation Kit (Roche Life Science) following a modified Gram negative bacteria RNA extraction protocol with an additional DNase treatment using a TURBO DNA-free Kit (Ambion) at 37&#x00B0;C for 30 min. Ten nanograms of total RNA from each extraction was converted into cDNA using an iScript<sup>TM</sup> cDNA Synthesis Kit (Bio-Rad) with random hexamer primers. To detect the transcript level of <italic>flaB2</italic>, gene specific primers were constructed to amplify <italic>flaB2</italic> and the <italic>slp</italic> gene that encodes the S-layer protein (the latter was used as the reference) [<bold>Table <xref ref-type="table" rid="T2">2</xref></bold>, (<xref ref-type="bibr" rid="B11">Ding et al., 2016a</xref>)]. qRT-PCR experiments were performed as previously described (<xref ref-type="bibr" rid="B11">Ding et al., 2016a</xref>). Triplicates were included in each experiment, and three biological repeats were conducted.</p>
</sec>
<sec><title>Swarming Motility Analysis of <italic>Mc. maripaludis</italic> Strains on Semi-Solid Agar</title>
<p>Five microliters of overnight cell cultures of each <italic>Mc. maripaludis</italic> strain (OD<sub>600</sub> normalized to 1.0) grown in Balch Medium III were stabbed into Balch Medium III plates containing 0.25% agar (w/v) (<xref ref-type="bibr" rid="B13">Ding et al., 2015</xref>). Plates were incubated anaerobically in a canister under an atmosphere of H<sub>2</sub>:CO<sub>2</sub> (80:20) at 37&#x00B0;C for 4 days.</p>
</sec>
<sec><title>Electron Microscopy Analysis of <italic>Mc. maripaludis</italic> Strains</title>
<p>Cells grown overnight in Balch medium III were centrifuged and the pellets washed briefly with 2% NaCl (w/v), and resuspended in 2% NaCl. Cell resuspensions were loaded on 200-mesh carbon-coated copper grids. After adhesion to the grid for 1 min, cells were washed with 2% NaCl and then stained with 2% (w/v) phosphotungstic acid, pH 7.0. Samples were examined with a Philips CM-10 transmission electron microscope at 80 kV and images were taken with a SIS/Olympus Morada 11-megapixel charge-coupled device camera under standard operating conditions.</p>
</sec>
</sec>
<sec><title>Results</title>
<sec><title>Isolation and Identification of a Spontaneous Mutant of the &#x0394;<italic>earA</italic> Strain in Which FlaB2 Expression Was Restored</title>
<p>In <italic>Mc. maripaludis</italic>, the transcription of the <italic>fla</italic> operon is dependent on the transcription activator EarA (<xref ref-type="bibr" rid="B12">Ding et al., 2016b</xref>). In the absence of EarA, as in the &#x0394;<italic>earA</italic> strain, the archaellin FlaB2 (encoded by the second gene in the <italic>fla</italic> operon) is not detected in western blots (<bold>Figure <xref ref-type="fig" rid="F1">1A</xref></bold>) and cells are non-archaellated. However, continuous weekly transfer of the &#x0394;<italic>earA</italic> strain for about 6 months resulted in the isolation of a mutant form of the &#x0394;<italic>earA</italic> strain in which FlaB2 synthesis was restored (<bold>Figure <xref ref-type="fig" rid="F1">1B</xref></bold>). This spontaneous mutant was designated as &#x0394;<italic>earA-sp</italic>. The deletion of the <italic>earA</italic> gene in &#x0394;<italic>earA-sp</italic> was still present, as confirmed by PCR analysis of this strain compared to the original &#x0394;<italic>earA</italic> strain and Mm900 cells. As shown in <bold>Figure <xref ref-type="fig" rid="F1">1C</xref></bold>, both &#x0394;<italic>earA</italic> and the &#x0394;<italic>earA</italic>-<italic>sp</italic> cells had the expected smaller amplicon size obtained in PCR using primers flanking the deletion area of <italic>earA</italic> compared with amplicons obtained using Mm900 or &#x0394;<italic>flaB2</italic> cells as template, ruling out the possibility that the restoration of FlaB2 in &#x0394;<italic>earA</italic>-<italic>sp</italic> was due to contamination with the wild-type Mm900 strain or any other <italic>Mc. maripaludis</italic> strain with an intact <italic>earA</italic>.</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption><p>Western blot analysis of wild-type cells, the &#x0394;<italic>earA</italic> strain and a spontaneous mutant of the &#x0394;<italic>earA</italic> strain<italic>, &#x0394;earA-sp,</italic> in which the expression of FlaB2 was restored. <bold>(A)</bold> Wild-type cells (Mm900) produce FlaB2 readily detected in western blots using FlaB2-specific antibodies. In the &#x0394;<italic>earA</italic> strain, where the gene encoding the transcriptional activator EarA required for the transcription of the <italic>fla</italic> operon has been deleted, no FlaB2 was detected. <bold>(B)</bold> In the spontaneous mutant &#x0394;<italic>earA-sp</italic>, the expression of FlaB2 was restored. <bold>(C)</bold> Confirmation of the deletion of <italic>earA</italic> in &#x0394;<italic>earA-sp</italic> and &#x0394;<italic>3A</italic> mutants. PCR products obtained using &#x0394;<italic>earA</italic>, &#x0394;<italic>earA-sp</italic> and &#x0394;<italic>3A</italic> mutant cells as templates with primers amplifying the flanking area of the <italic>earA</italic> gene were smaller than those obtained using wild-type and &#x0394;<italic>flaB2</italic> cells as template with the same primer pair, confirming that <italic>earA</italic> was deleted in the &#x0394;<italic>earA-sp</italic> and &#x0394;<italic>3A</italic> mutants.</p></caption>
<graphic xlink:href="fmicb-08-01329-g001.tif"/>
</fig>
<p>As an initial step in an effort to determine how these cells had regained the ability to transcribe the <italic>fla</italic> operon genes without EarA, we amplified and sequenced a &#x223C;500 bp region encompassing the <italic>fla</italic> promoter from &#x0394;<italic>earA-sp</italic> [from -348 nt to +162 nt with respect to the TSS; (<xref ref-type="bibr" rid="B12">Ding et al., 2016b</xref>)]. Analysis of the sequencing data showed that the four EarA binding sites (<xref ref-type="bibr" rid="B12">Ding et al., 2016b</xref>) upstream of the <italic>fla</italic> promoter remained intact, as did the TATA box, but in a stretch of seven adenines in the BRE found immediately upstream of the TATA box, three out of the seven adenines were missing in the &#x0394;<italic>earA-sp</italic> strain (<bold>Figure <xref ref-type="fig" rid="F2">2</xref></bold>). No other changes were found in the sequence of the PCR product amplified from the <italic>fla</italic> promoter region in the &#x0394;<italic>earA-sp</italic> strain.</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption><p>DNA sequence alignment of the <italic>fla</italic> promoter region from the &#x0394;<italic>earA</italic> and &#x0394;<italic>earA-sp</italic> strains showed a three adenine deletion in the BRE region. The four EarA binding sites (sites 1&#x2013;4), BRE, TATA box, and ribosome binding site (RBS) are boxed in the figure. The transcription start site (TSS) and the start codon of the first gene in the <italic>fla</italic> operon, <italic>flaB1</italic>, are also indicated.</p></caption>
<graphic xlink:href="fmicb-08-01329-g002.tif"/>
</fig>
</sec>
<sec><title>Construction of a &#x0394;<italic>3A</italic> Mutant in Which the Three Adenine Deletion in the BRE Was Recreated</title>
<p>It is possible that mutations other than the three adenine deletion in the <italic>fla</italic> promoter region could have occurred elsewhere in the genome of &#x0394;<italic>earA-sp</italic> that were solely, or partially, responsible for the restoration of FlaB2 production. To explore if the three adenine deletion detected in the <italic>fla</italic> promoter region in the &#x0394;<italic>earA-sp</italic> strain alone would result in the restoration of expression of FlaB2 in the absence of EarA, a mutant which carried the same three adenine deletion mutation in the <italic>fla</italic> promoter region as that in &#x0394;<italic>earA</italic>-<italic>sp</italic>, was generated from the original stock &#x0394;<italic>earA</italic> strain that did not synthesize FlaB2. Since the size difference in the <italic>fla</italic> promoter region of &#x0394;<italic>earA</italic> and the generated three adenine mutant would be only three nucleotides, we did not try to screen mutants by PCR analysis. Instead, we used western blotting to screen for FlaB2 production, since if the deletion of the three adenines was responsible for restoration of transcription of the <italic>fla</italic> operon, transformants bearing this deletion would be readily identified from transformants that had retained the wild-type seven adenine sequence in the BRE region. Western blotting of a random number of transformant colonies appearing on 8-azahypoxanthine plates identified both ones that did and did not synthesize detectable amounts of FlaB2. The sequence of the <italic>fla</italic> promoter of four colonies where FlaB2 production was detected and seven colonies in which FlaB2 production was not detected were determined. In each of the colonies in which no FlaB2 was detected by western blotting, a wild-type <italic>fla</italic> promoter sequence, i.e., with seven consecutive adenines in the BRE, was found. In each of the four colonies that were found to produce FlaB2, the <italic>fla</italic> promoter was identical to the wild-type sequence except for the three adenine deletion in the BRE (data not shown). One of the transformant colonies that produced FlaB2 and had the three adenine deletion in the BRE was designated &#x0394;<italic>3A</italic> and studied further. As shown in <bold>Figure <xref ref-type="fig" rid="F3">3A</xref></bold>, FlaB2 production in the &#x0394;<italic>earA</italic>-<italic>sp</italic> strain was near wild-type levels. In contrast, in the &#x0394;<italic>3A</italic> cells, the expression level of FlaB2 was lower than that from the &#x0394;<italic>earA-sp</italic> strain. PCR analysis of the &#x0394;<italic>3A</italic> cells confirmed that these cells still possessed the deletion in <italic>earA</italic> (<bold>Figure <xref ref-type="fig" rid="F1">1C</xref></bold>).</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption><p>The translation and transcription of <italic>flaB2</italic> was restored in the &#x0394;<italic>earA-sp</italic> and &#x0394;<italic>3A</italic> mutants. <bold>(A)</bold> Western blot analysis showed that FlaB2 was expressed in both &#x0394;<italic>earA-sp</italic> and &#x0394;<italic>3A</italic> mutants, as well as in the wild-type cells but not in the &#x0394;<italic>earA</italic> mutant or in a mutant deleted for <italic>flaB2</italic>. <bold>(B)</bold> The transcription of <italic>flaB2</italic> was restored in &#x0394;<italic>earA-sp</italic> and &#x0394;<italic>3A</italic> strains, as detected by qRT-PCR experiments. While transcripts for <italic>flaB2</italic> were barely detectable in the &#x0394;<italic>earA</italic> mutant, <italic>flaB2</italic> transcription in the &#x0394;<italic>earA-sp</italic> and &#x0394;<italic>3A</italic> strains exceeded that of wild-type cells. Error bar shows standard derivation from nine data sets from three biological repeats, each of which were performed with triplicates.</p></caption>
<graphic xlink:href="fmicb-08-01329-g003.tif"/>
</fig>
</sec>
<sec><title>Transcription of <italic>flaB2</italic> in the &#x0394;<italic>earA-sp</italic> and &#x0394;<italic>3A</italic> Strains Was Restored</title>
<p>Restoration of FlaB2 synthesis in the &#x0394;<italic>earA-sp</italic> and &#x0394;<italic>3A</italic> strains as demonstrated by the western blot results indicated that transcription of <italic>flaB2</italic> was occurring in both mutant strains. A direct measure of the transcript level of <italic>flaB2</italic> in these two mutants as well as control strains was obtained in qRT-PCR experiments (<bold>Figure <xref ref-type="fig" rid="F3">3B</xref></bold>). As expected, <italic>flaB2</italic> transcripts were not detected in the &#x0394;<italic>flaB2</italic> strain and were barely detectable in the &#x0394;<italic>earA</italic> strain. In contrast, the transcription level of <italic>flaB2</italic> was increased over 4-fold and 2.5-fold in the &#x0394;<italic>earA-sp</italic> and the &#x0394;<italic>3A</italic> strains, respectively, compared to that detected in wild-type cells. The relatively higher transcription level of <italic>flaB2</italic> in the &#x0394;<italic>earA</italic>-<italic>sp</italic> cells compared to the &#x0394;<italic>3A</italic> cells was consistent with production of FlaB2 in the two strains detected in the western blot. However, the production of FlaB2 in the &#x0394;<italic>3A</italic> cells was lower than in wild-type cells even though <italic>flaB2</italic> transcription was higher.</p>
</sec>
<sec><title>&#x0394;<italic>earA-sp</italic> and &#x0394;<italic>3A</italic> Strains Were Archaellated</title>
<p>qRT-PCR and western blot analyses demonstrated that transcription and translation of <italic>flaB2</italic> had been restored in the &#x0394;<italic>earA</italic>-<italic>sp</italic> and &#x0394;<italic>3A</italic> strains. To determine if the transcription and translation of the entire <italic>fla</italic> operon was restored in the two mutant stains resulting in assembly of archaella, cells were examined by electron microscopy. As shown in <bold>Figure <xref ref-type="fig" rid="F4">4</xref></bold>, archaella were observed on the cell surface of both &#x0394;<italic>earA-sp</italic> and &#x0394;<italic>3A</italic> cells, as well as the wild-type cells, but not on &#x0394;<italic>flaB2</italic> or &#x0394;<italic>earA</italic> cells.</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption><p>Electron micrographs illustrating archaella on the surface of &#x0394;<italic>earA-sp</italic> and &#x0394;<italic>3A</italic> mutants, as well as wild-type cells. As expected, the &#x0394;<italic>flaB2</italic> and &#x0394;<italic>earA</italic> mutants were non-archaellated. Bars equal 500 nm.</p></caption>
<graphic xlink:href="fmicb-08-01329-g004.tif"/>
</fig>
</sec>
<sec><title>&#x0394;<italic>earA-sp</italic> and &#x0394;<italic>3A</italic> Strains Had Swarming Motility</title>
<p>To further determine if the archaella observed on &#x0394;<italic>earA-sp</italic> and &#x0394;<italic>3A</italic> cells were functional, swarming motility assays were performed. Overnight cultures of &#x0394;<italic>earA-sp,</italic> &#x0394;<italic>3A</italic>, as well as Mm900, &#x0394;<italic>flaB2</italic>, and &#x0394;<italic>earA</italic> strains were inoculated onto semi-solid Balch medium III agar. After incubation at 37&#x00B0;C for 4 days Mm900, &#x0394;<italic>earA-sp</italic> and &#x0394;<italic>3A</italic> cells were clearly motile although the motility of the &#x0394;<italic>3A</italic> cells was less than the other two strains (<bold>Figure <xref ref-type="fig" rid="F5">5</xref></bold>). The non-archaellated strains, &#x0394;<italic>flaB2</italic> and &#x0394;<italic>earA</italic>, remained at the inoculation spot, as expected. The swarming data are consistent with data from western blot, qRT-PCR, and EM analyses.</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption><p>Swarming assay demonstrating the motility of the &#x0394;<italic>earA-sp</italic> and &#x0394;<italic>3A</italic> mutants. Overnight cell cultures were normalized with respect to their OD<sub>600</sub> and the same amount of cells were inoculated onto Balch medium III plates containing 0.25% agar and incubated for 4 days at 37&#x00B0;C.</p></caption>
<graphic xlink:href="fmicb-08-01329-g005.tif"/>
</fig>
</sec>
</sec>
<sec><title>Discussion</title>
<p>Previous studies have shown that the euryarchaeal archaellum regulator EarA was critical for transcription of the <italic>fla</italic> operon in <italic>Mc. maripaludis</italic> via its binding to at least one of four consensus sequences located immediately upstream of the BRE and TATA box of the <italic>fla</italic> promoter. In a &#x0394;<italic>earA</italic> mutant, transcription of the <italic>fla</italic> operon is barely detectable and cells are non-archaellated (<xref ref-type="bibr" rid="B12">Ding et al., 2016b</xref>). In this study, we have isolated a spontaneous mutant of a &#x0394;<italic>earA</italic> strain in which the transcription of the <italic>fla</italic> operon and archaellation were restored. Analysis of the DNA sequence of the <italic>fla</italic> promoter region in this mutant, designated &#x0394;<italic>earA-sp,</italic> revealed a deletion of three adenines in the BRE region. Recreation of the three adenine deletion in the stock strain of the &#x0394;<italic>earA</italic> mutant also led to restoration of <italic>fla</italic> operon transcription and archaellation, indicating that this small deletion in the BRE overcame the requirement for EarA for activation of transcription of the <italic>fla</italic> operon. However, the expression of FlaB2 detected by western blotting was lower in the recreated strain than in the spontaneous mutant &#x0394;<italic>earA-sp,</italic> suggesting that the three adenine deletion may not be the sole change in the &#x0394;<italic>earA-sp</italic> strain affecting transcription of the <italic>fla</italic> operon. However, it seems clear from our studies on the directed mutant &#x0394;<italic>3A</italic> strain, that the deletion of three adenines in the BRE of the <italic>fla</italic> operon promoter is sufficient on its own to result in all the phenotypes related to archaellation observed in the spontaneous mutant.</p>
<p>Since there is virtually no transcription detected from the native <italic>fla</italic> promoter if <italic>earA</italic> is deleted, it suggests that the <italic>fla</italic> promoter is intrinsically very weak or inactive. Two key elements that determine promoter strength in Archaea are the sequences of the TATA box and BRE (<xref ref-type="bibr" rid="B3">Bartlett, 2005</xref>). The TATA box is the site of binding of the TATA-binding protein TBP while the BRE sequence is the site of binding for TFB (<xref ref-type="bibr" rid="B30">Peeters et al., 2013</xref>). While relatively few transcriptional activators have been studied in Archaea, the mechanism of activation in these limited studies has been shown to involve recruitment of TBP or TFB to the TATA box or BRE (<xref ref-type="bibr" rid="B19">Karr, 2014</xref>). Consensus TATA box sequences vary for different subgroups of Archaea and mutations in the TATA box can reduce transcription efficiency (<xref ref-type="bibr" rid="B35">Soppa, 1999</xref>; <xref ref-type="bibr" rid="B3">Bartlett, 2005</xref>; <xref ref-type="bibr" rid="B39">van de Werken et al., 2006</xref>). For protein promoters in <italic>Mcc. jannaschii</italic>, the TATA box was determined to be TWTATATA (where W = A or T) (<xref ref-type="bibr" rid="B41">Zhang et al., 2009</xref>), very similar to the TTTATATA proposed previously for the promoters of stable RNA genes in <italic>Methanococcus vannielii</italic> (<xref ref-type="bibr" rid="B37">Thomm and Wich, 1988</xref>) and featuring the methanogen characteristic of strict alterations of T and A in contrast to TATA boxes in other major archaeal groups (<xref ref-type="bibr" rid="B35">Soppa, 1999</xref>). One of the best-studied archaeal transcriptional activators, Ptr2 of <italic>Mcc. jannaschii</italic>, binds to multiple sequences upstream of BRE in the rubredoxin 2 gene and has its stimulatory effect due to direct recruitment of TBP (<xref ref-type="bibr" rid="B28">Ouhammouch et al., 2003</xref>, <xref ref-type="bibr" rid="B29">2005</xref>). Adding binding sites for Ptr2 upstream of heterologous promoters with sub-optimal TATA box sequences resulted in significant transcriptional activation (<xref ref-type="bibr" rid="B29">Ouhammouch et al., 2005</xref>). Analysis of the TATA box of the <italic>fla</italic> operon in <italic>Mc. maripaludis</italic> revealed a strong identity to the consensus sequence, including the alternating T and A stretch TATATAT, suggesting binding of TBP should not be impaired.</p>
<p>The 6&#x2013;7 nucleotide long BRE sequences are the major site of binding for TFB, with positions -3 and -6 of BRE (relative to the TATA box) showing the strongest specificity determinants (<xref ref-type="bibr" rid="B33">Qureshi and Jackson, 1998</xref>; <xref ref-type="bibr" rid="B23">Littlefield et al., 1999</xref>). There are no BRE consensus sequences reported for halophiles and methanogens (<xref ref-type="bibr" rid="B39">van de Werken et al., 2006</xref>). However, in <italic>Mcc. jannaschii</italic>, a hyperthermophilic relative of <italic>Mc. maripaludis</italic>, two studies have identified promoter sequences on a whole genome basis (<xref ref-type="bibr" rid="B20">Li et al., 2008</xref>; <xref ref-type="bibr" rid="B41">Zhang et al., 2009</xref>). The first study used the binding of TBP and TFB in EMSA studies to identify promoters (<xref ref-type="bibr" rid="B20">Li et al., 2008</xref>). These studies had a strong bias for strong promoters, especially for promoters of tRNA genes with only small percentage of promoters for protein genes being retrieved. These studies led to the identification of an extended BRE element sequence of 9&#x2013;10 nucleotides (MRCCGAAAAG where M = A, C and R = A, G). The second study focused on identification of promoters for protein-encoding genes (<xref ref-type="bibr" rid="B41">Zhang et al., 2009</xref>). It was found for <italic>Mcc. jannaschii</italic> protein gene promoters that there was a greater variability in the BRE than in the TATA box (<xref ref-type="bibr" rid="B41">Zhang et al., 2009</xref>). The identified promoters for protein-encoding genes were shown to bind the general transcription factors less tightly than tRNA gene promoters. Notably, base frequencies at several BRE positions considered important for TFB binding were significantly different from the <italic>in vitro</italic> selected promoters (mostly for tRNA genes) in the earlier study. Examination of the BRE sequences in both protein-encoding genes and tRNA genes revealed that most had internal stretches of 3&#x2013;5 adenines, far less than the seven adenines in the wild-type <italic>fla</italic> operon promoter. Interestingly, the <italic>fla</italic> operon BRE element has a G at position -1, the most commonly found base at that position in the strong tRNA gene BRE (<bold>Figure <xref ref-type="fig" rid="F6">6A</xref></bold>), while in protein-encoding genes the most common base at -1 is C (<xref ref-type="bibr" rid="B41">Zhang et al., 2009</xref>).</p>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption><p>Promoter sequence analysis of the wild-type and mutated <italic>fla</italic> promoters and other archaeal promoters. <bold>(A)</bold> Promoter sequences of <italic>fla</italic> promoter (<italic>fla</italic>), mutated <italic>fla</italic> promoter with the three adenine deletion in the BRE (Sp/3A), <italic>glnA</italic> promoter (glnA), and <italic>nifH</italic> promoter (nifH) from <italic>Methanococcus maripaludis</italic>, as well as the conserved promoter sequence from the tRNA<sup>lys</sup> gene of <italic>Methanocaldococcus</italic> <italic>jannaschii</italic> (Mja). <bold>(B)</bold> BRE/TATA box sequences of the <italic>fla</italic> operon promoters of selected Methanococcales.</p></caption>
<graphic xlink:href="fmicb-08-01329-g006.tif"/>
</fig>
<p>The wild-type version of the BRE of the <italic>fla</italic> operon promoter, with its stretch of seven adenines, does not show strong sequence identity to what may be considered strong BRE sequences as reported for <italic>Mcc. jannaschii</italic>. On the other hand, it is apparent that the three adenine deletion version found in the &#x0394;<italic>earA-sp</italic> mutant much more closely aligns with BRE sequences found in strong tRNA gene promoters of <italic>Mcc. jannaschii</italic> (<bold>Figure <xref ref-type="fig" rid="F6">6A</xref></bold>). In addition, the mutated <italic>fla</italic> promoter in the &#x0394;<italic>earA-sp</italic> strain shares high sequence identity with two studied promoter sequences in <italic>Mc. maripaludis</italic>, namely the nitrogen-regulated <italic>glnA</italic> and <italic>nifH</italic> promoters (<bold>Figure <xref ref-type="fig" rid="F6">6A</xref></bold>) (<xref ref-type="bibr" rid="B8">Cohen-Kupiec et al., 1997</xref>, <xref ref-type="bibr" rid="B9">1999</xref>). Both <italic>glnA</italic> and <italic>nifH</italic> promoters are regulated via the repressor NrpR, which binds to the <italic>nif</italic> operators located downstream of the TATA boxes just after the TSS in the two promoters leading to repression of transcription under ammonia growth conditions (<xref ref-type="bibr" rid="B8">Cohen-Kupiec et al., 1997</xref>, <xref ref-type="bibr" rid="B9">1999</xref>; <xref ref-type="bibr" rid="B22">Lie et al., 2005</xref>). Both <italic>nifH</italic> and <italic>glnA</italic> expression is very low when cells are grown on ammonia and NrpR binds but high expression is observed under conditions of diazotrophic growth where NrpR does not bind or in a strain where <italic>nrpR</italic> has been deleted (<xref ref-type="bibr" rid="B8">Cohen-Kupiec et al., 1997</xref>, <xref ref-type="bibr" rid="B9">1999</xref>; <xref ref-type="bibr" rid="B21">Lie and Leigh, 2003</xref>; <xref ref-type="bibr" rid="B22">Lie et al., 2005</xref>). This indicated that the basal transcription level of the two promoters was strong, suggesting that TFB and TBP in <italic>Mc. maripaludis</italic> could recognize BRE and the TATA box of these two promoters and initiate transcription (<xref ref-type="bibr" rid="B8">Cohen-Kupiec et al., 1997</xref>, <xref ref-type="bibr" rid="B9">1999</xref>). The high sequence identity of the three adenine deletion BRE of the &#x0394;<italic>earA-sp</italic> strain with that of the <italic>glnA</italic> and <italic>nifH</italic> promoters, as well as the BRE of the highly expressed tRNA genes of <italic>Mcc. jannaschii</italic> likely explains why the pre-initiation complex could be formed with the mutated <italic>fla</italic> promoter without the aid of EarA. The qRT-PCR results (<bold>Figure <xref ref-type="fig" rid="F3">3B</xref></bold>) suggest that the wild-type <italic>fla</italic> operon promoter even with EarA is not as strong as the three adenine deletion version in the absence of EarA.</p>
<p>Studies in several archaea have indicated that promoters containing non-conserved BRE sequences can be weak or even inactive (<xref ref-type="bibr" rid="B32">Peng et al., 2009</xref>, <xref ref-type="bibr" rid="B31">2011</xref>; <xref ref-type="bibr" rid="B25">Marschaus and Pfeifer, 2012</xref>; <xref ref-type="bibr" rid="B27">Ochs et al., 2012</xref>). Replacement of the BRE of inducible promoters with a BRE from strong promoters, for example, can greatly increase the transcription from the resulting chimeric promoter. In <italic>Sulfolobus solfataricus,</italic> transcription from the arabinose promoter is induced in the presence of arabinose, via an unidentified factor that binds to a consensus ara-box sequence located immediately upstream of the BRE and TATA box (<xref ref-type="bibr" rid="B24">Lubelska et al., 2006</xref>; <xref ref-type="bibr" rid="B31">Peng et al., 2011</xref>). When the BRE from the arabinose promoter was replaced with the strong BRE from the <italic>Sulfolobus shibatae</italic> viral (SSV) T6 promoter (<xref ref-type="bibr" rid="B33">Qureshi and Jackson, 1998</xref>), the resulting chimeric promoter was now constitutive and not regulated by the ara-box element (<xref ref-type="bibr" rid="B32">Peng et al., 2009</xref>). The apparent mechanism of transcription activation of the ara-box binding factor is thought to be by recruitment of TFB to a weak BRE (<xref ref-type="bibr" rid="B32">Peng et al., 2009</xref>, <xref ref-type="bibr" rid="B31">2011</xref>). In <italic>Pyrococcus furiosus</italic>, transcription from the <italic>pf1089</italic> promoter is activated by PF1088 (Transcription factor B recruitment factor 1, TFB-RF1). This activation is dependent on the weak BRE of the <italic>pf1089</italic> promoter and is not observed if the <italic>pf1089</italic> promoter BRE is replaced with the BRE from the strong <italic>gdh</italic> promoter (<xref ref-type="bibr" rid="B36">Spitalny and Thomm, 2003</xref>; <xref ref-type="bibr" rid="B27">Ochs et al., 2012</xref>). Electrophoretic mobility shift assays further revealed that the transcription activation of the wild-type <italic>pf1089</italic> promoter was by the recruitment of TFB via TFB-RF1, thereby overcoming the weak BRE.</p>
<p>We have recently shown that EarA homologs are commonly found in the Euryarchaota and that EarA proteins from numerous methanogens can rescue the defects in archaellation in a <italic>Mc. maripaludis &#x0394;earA</italic> strain (<xref ref-type="bibr" rid="B10">Ding et al., 2017</xref>). As shown in <bold>Figure <xref ref-type="fig" rid="F6">6B</xref></bold>, examination of the <italic>fla</italic> promoter regions in selected archaellated Methanococcales containing an <italic>earA</italic> homolog revealed BRE sequences identical, or very similar, to that in <italic>Mc. maripaludis</italic>, i.e., with a string of seven adenines as in <italic>Methanococcus voltae</italic>, <italic>Methanococcus vannielii</italic>, and <italic>Methanothermococcus thermolithotrophicus</italic> or seven adenines in a stretch of eight nucleotides in the BRE of the <italic>fla</italic> promoter of <italic>Mcc. jannaschii</italic>. It would appear that in all these cases, the <italic>fla</italic> promoter requires the presence of EarA proteins to overcome weak BRE sequences, presumably to aid in the recruitment of TFB, as found for transcriptional activators TFB-RF1 and the ara-box binding factor.</p>
<p>The appearance of the &#x0394;<italic>earA-sp</italic> mutant was surprising to us. The isolation of the original &#x0394;<italic>earA</italic> mutant arose after it was discovered that, after repeated transfers in the lab, mutants carrying deletions of various <italic>fla</italic> or <italic>agl</italic> genes required for assembly of archaella stopped transcription of the <italic>fla</italic> operon and the <italic>fla</italic> operon reporter protein FlaB2 could not be detected in western blots (<xref ref-type="bibr" rid="B40">Vandyke et al., 2009</xref>; <xref ref-type="bibr" rid="B12">Ding et al., 2016b</xref>). It was determined that in at least some of these mutants, the reason for the cessation of <italic>fla</italic> operon transcription was a reading-frame shift mutation in <italic>earA</italic>. We reasoned that in these strains that carried mutations in <italic>fla</italic> or <italic>agl</italic> genes necessary for archaella assembly, it was an advantage to no longer synthesize several proteins, some of which, like archaellins, were required in large amounts when they could not be assembled in archaella. This led to a selective advantage for those cells that had stopped transcription of the <italic>fla</italic> operon, as in the <italic>earA</italic> mutants. Thus, it is not obvious to us why a mutation in the &#x0394;<italic>earA</italic> that would restore transcription of the <italic>fla</italic> operon would arise and outgrow the original &#x0394;<italic>earA</italic> mutant. The answer may lie in the presence of an additional mutation(s) in the &#x0394;<italic>earA-sp</italic> strain that could be revealed by comparison of the complete sequence of the &#x0394;<italic>earA</italic> and &#x0394;<italic>earA-sp</italic> strains.</p>
<p>In this study, a spontaneous mutant with restored FlaB2 expression was isolated from a &#x0394;<italic>earA</italic> mutant, indicating that in the spontaneous mutant the need for the transcriptional activator EarA for the transcription of the <italic>fla</italic> promoter was bypassed. Analysis of the DNA sequence in the <italic>fla</italic> promoter region from the spontaneous mutant revealed a three adenine deletion in the BRE region in the <italic>fla</italic> promoter. Sequence alignment showed that the mutated BRE in the <italic>fla</italic> promoter shares high similarity with BREs from strong promoters in methanogens, indicating that with this mutated BRE, the transcription initiation of the <italic>fla</italic> promoter could be conducted with components of the basal pre-initiation complex. We believe this is the first report of spontaneous mutation in the promoter region that overcomes the need for a transcriptional activator and it emphasizes the key role played by the BRE in promoter strength in Archaea.</p>
</sec>
<sec><title>Author Contributions</title>
<p>Conceived and designed experiments: YD, AB, CK, and KJ. Performed the experiments: YD, AB, CK, and KJ. Analyzed the data: YD, AB, CK, and KJ. Wrote the paper: YD, AB, CK, and KJ.</p>
</sec>
<sec><title>Conflict of Interest Statement</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
</body>
<back>
<fn-group>
<fn fn-type="financial-disclosure">
<p><bold>Funding.</bold> This research was funded by Discovery Grants from The Natural Sciences and Engineering Research Council of Canada (NSERC) to KJ and CK.</p>
</fn>
</fn-group>
<ref-list>
<title>References</title>
<ref id="B1"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Albers</surname> <given-names>S. V.</given-names></name> <name><surname>Jarrell</surname> <given-names>K. F.</given-names></name></person-group> (<year>2015</year>). <article-title>Archaellum moves Archaea with distinction.</article-title> <source><italic>Microbe</italic></source> <volume>10</volume> <fpage>283</fpage>&#x2013;<lpage>288</lpage>. <pub-id pub-id-type="doi">10.1128/microbe.10.283.1</pub-id></citation></ref>
<ref id="B2"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Balch</surname> <given-names>W. E.</given-names></name> <name><surname>Fox</surname> <given-names>G. E.</given-names></name> <name><surname>Magrum</surname> <given-names>L. J.</given-names></name> <name><surname>Woese</surname> <given-names>C. R.</given-names></name> <name><surname>Wolfe</surname> <given-names>R. S.</given-names></name></person-group> (<year>1979</year>). <article-title>Methanogens: reevaluation of a unique biological group.</article-title> <source><italic>Microbiol. Rev.</italic></source> <volume>43</volume> <fpage>260</fpage>&#x2013;<lpage>296</lpage>.</citation></ref>
<ref id="B3"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Bartlett</surname> <given-names>M. S.</given-names></name></person-group> (<year>2005</year>). <article-title>Determinants of transcription initiation by archaeal RNA polymerase.</article-title> <source><italic>Curr. Opin. Microbiol.</italic></source> <volume>8</volume> <fpage>677</fpage>&#x2013;<lpage>684</lpage>. <pub-id pub-id-type="doi">10.1016/j.mib.2005.10.016</pub-id></citation></ref>
<ref id="B4"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Bell</surname> <given-names>S. D.</given-names></name></person-group> (<year>2005</year>). <article-title>Archaeal transcriptional regulation&#x2013;variation on a bacterial theme?</article-title> <source><italic>Trends Microbiol.</italic></source> <volume>13</volume> <fpage>262</fpage>&#x2013;<lpage>265</lpage>.</citation></ref>
<ref id="B5"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Bell</surname> <given-names>S. D.</given-names></name> <name><surname>Jackson</surname> <given-names>S. P.</given-names></name></person-group> (<year>2001</year>). <article-title>Mechanism and regulation of transcription in archaea.</article-title> <source><italic>Curr. Opin. Microbiol.</italic></source> <volume>4</volume> <fpage>208</fpage>&#x2013;<lpage>213</lpage>. <pub-id pub-id-type="doi">10.1016/S1369-5274(00)00190-9</pub-id></citation></ref>
<ref id="B6"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Bell</surname> <given-names>S. D.</given-names></name> <name><surname>Kosa</surname> <given-names>P. L.</given-names></name> <name><surname>Sigler</surname> <given-names>P. B.</given-names></name> <name><surname>Jackson</surname> <given-names>S. P.</given-names></name></person-group> (<year>1999</year>). <article-title>Orientation of the transcription preinitiation complex in archaea.</article-title> <source><italic>Proc. Natl. Acad. Sci. U.S.A.</italic></source> <volume>96</volume> <fpage>13662</fpage>&#x2013;<lpage>13667</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.96.24.13662</pub-id></citation></ref>
<ref id="B7"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Chaban</surname> <given-names>B.</given-names></name> <name><surname>Ng</surname> <given-names>S. Y.</given-names></name> <name><surname>Kanbe</surname> <given-names>M.</given-names></name> <name><surname>Saltzman</surname> <given-names>I.</given-names></name> <name><surname>Nimmo</surname> <given-names>G.</given-names></name> <name><surname>Aizawa</surname> <given-names>S. I.</given-names></name><etal/></person-group> (<year>2007</year>). <article-title>Systematic deletion analyses of the <italic>fla</italic> genes in the flagella operon identify several genes essential for proper assembly and function of flagella in the archaeon, <italic>Methanococcus maripaludis</italic>.</article-title> <source><italic>Mol. Microbiol.</italic></source> <volume>66</volume> <fpage>596</fpage>&#x2013;<lpage>609</lpage>. <pub-id pub-id-type="doi">10.1111/j.1365-2958.2007.05913.x</pub-id></citation></ref>
<ref id="B8"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Cohen-Kupiec</surname> <given-names>R.</given-names></name> <name><surname>Blank</surname> <given-names>C.</given-names></name> <name><surname>Leigh</surname> <given-names>J. A.</given-names></name></person-group> (<year>1997</year>). <article-title>Transcriptional regulation in Archaea: in vivo demonstration of a repressor binding site in a methanogen.</article-title> <source><italic>Proc. Natl. Acad. Sci. U.S.A.</italic></source> <volume>94</volume> <fpage>1316</fpage>&#x2013;<lpage>1320</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.94.4.1316</pub-id></citation></ref>
<ref id="B9"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Cohen-Kupiec</surname> <given-names>R.</given-names></name> <name><surname>Marx</surname> <given-names>C. J.</given-names></name> <name><surname>Leigh</surname> <given-names>J. A.</given-names></name></person-group> (<year>1999</year>). <article-title>Function and regulation of <italic>glnA</italic> the methanogenic archaeon <italic>Methanococcus maripaludis</italic>.</article-title> <source><italic>J. Bacteriol.</italic></source> <volume>181</volume> <fpage>256</fpage>&#x2013;<lpage>261</lpage>.</citation></ref>
<ref id="B10"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ding</surname> <given-names>Y.</given-names></name> <name><surname>Berezuk</surname> <given-names>A.</given-names></name> <name><surname>Khursigara</surname> <given-names>C. M.</given-names></name> <name><surname>Jarrell</surname> <given-names>K. F.</given-names></name></person-group> (<year>2017</year>). <article-title>Phylogenetic distribution of the euryarchaeal archaellum regulator EarA and complementation of a <italic>Methanococcus maripaludis</italic> &#x0394;<italic>earA</italic> mutant with heterologous <italic>earA</italic> homologues.</article-title> <source><italic>Microbiology</italic></source> <pub-id pub-id-type="doi">10.1099/mic.0.000464</pub-id> <comment>[Epub ahead of print]</comment>.</citation></ref>
<ref id="B11"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ding</surname> <given-names>Y.</given-names></name> <name><surname>Lau</surname> <given-names>Z.</given-names></name> <name><surname>Logan</surname> <given-names>S. M.</given-names></name> <name><surname>Kelly</surname> <given-names>J. F.</given-names></name> <name><surname>Berezuk</surname> <given-names>A.</given-names></name> <name><surname>Khursigara</surname> <given-names>C. M.</given-names></name><etal/></person-group> (<year>2016a</year>). <article-title>Effects of growth conditions on archaellation and <italic>N</italic>-glycosylation in <italic>Methanococcus maripaludis</italic>.</article-title> <source><italic>Microbiology</italic></source> <volume>162</volume> <fpage>339</fpage>&#x2013;<lpage>350</lpage>. <pub-id pub-id-type="doi">10.1099/mic.0.000221</pub-id></citation></ref>
<ref id="B12"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ding</surname> <given-names>Y.</given-names></name> <name><surname>Nash</surname> <given-names>J.</given-names></name> <name><surname>Berezuk</surname> <given-names>A.</given-names></name> <name><surname>Khursigara</surname> <given-names>C. M.</given-names></name> <name><surname>Langelaan</surname> <given-names>D. N.</given-names></name> <name><surname>Smith</surname> <given-names>S. P.</given-names></name><etal/></person-group> (<year>2016b</year>). <article-title>Identification of the first transcriptional activator of an archaellum operon in a euryarchaeon.</article-title> <source><italic>Mol. Microbiol.</italic></source> <volume>102</volume> <fpage>54</fpage>&#x2013;<lpage>70</lpage>. <pub-id pub-id-type="doi">10.1111/mmi.13444</pub-id></citation></ref>
<ref id="B13"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ding</surname> <given-names>Y.</given-names></name> <name><surname>Uchida</surname> <given-names>K.</given-names></name> <name><surname>Aizawa</surname> <given-names>S. I.</given-names></name> <name><surname>Murphy</surname> <given-names>K.</given-names></name> <name><surname>Berezuk</surname> <given-names>A.</given-names></name> <name><surname>Khursigara</surname> <given-names>C. M.</given-names></name><etal/></person-group> (<year>2015</year>). <article-title>Effects of N-glycosylation site removal in archaellins on the assembly and function of archaella in <italic>Methanococcus maripaludis</italic>.</article-title> <source><italic>PLoS ONE</italic></source> <volume>10</volume>:<issue>e0116402</issue>. <pub-id pub-id-type="doi">10.1371/journal.pone.0116402</pub-id></citation></ref>
<ref id="B14"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Gehring</surname> <given-names>A. M.</given-names></name> <name><surname>Walker</surname> <given-names>J. E.</given-names></name> <name><surname>Santangelo</surname> <given-names>T. J.</given-names></name></person-group> (<year>2016</year>). <article-title>Transcription regulation in Archaea.</article-title> <source><italic>J. Bacteriol.</italic></source> <volume>198</volume> <fpage>1906</fpage>&#x2013;<lpage>1917</lpage>. <pub-id pub-id-type="doi">10.1128/JB.00255-16</pub-id></citation></ref>
<ref id="B15"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Goujon</surname> <given-names>M.</given-names></name> <name><surname>McWilliam</surname> <given-names>H.</given-names></name> <name><surname>Li</surname> <given-names>W.</given-names></name> <name><surname>Valentin</surname> <given-names>F.</given-names></name> <name><surname>Squizzato</surname> <given-names>S.</given-names></name> <name><surname>Paern</surname> <given-names>J.</given-names></name><etal/></person-group> (<year>2010</year>). <article-title>A new bioinformatics analysis tools framework at EMBL-EBI.</article-title> <source><italic>Nucleic Acids Res.</italic></source> <volume>38</volume> <fpage>W695</fpage>&#x2013;<lpage>W699</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gkq313</pub-id></citation></ref>
<ref id="B16"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Hendrickson</surname> <given-names>E. L.</given-names></name> <name><surname>Liu</surname> <given-names>Y.</given-names></name> <name><surname>Rosas-Sandoval</surname> <given-names>G.</given-names></name> <name><surname>Porat</surname> <given-names>I.</given-names></name> <name><surname>Soll</surname> <given-names>D.</given-names></name> <name><surname>Whitman</surname> <given-names>W. B.</given-names></name><etal/></person-group> (<year>2008</year>). <article-title>Global responses of <italic>Methanococcus maripaludis</italic> to specific nutrient limitations and growth rate.</article-title> <source><italic>J. Bacteriol.</italic></source> <volume>190</volume> <fpage>2198</fpage>&#x2013;<lpage>2205</lpage>. <pub-id pub-id-type="doi">10.1128/JB.01805-07</pub-id></citation></ref>
<ref id="B17"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Jarrell</surname> <given-names>K. F.</given-names></name> <name><surname>Albers</surname> <given-names>S. V.</given-names></name></person-group> (<year>2012</year>). <article-title>The archaellum: an old motility structure with a new name.</article-title> <source><italic>Trends Microbiol.</italic></source> <volume>20</volume> <fpage>307</fpage>&#x2013;<lpage>312</lpage>. <pub-id pub-id-type="doi">10.1016/j.tim.2012.04.007</pub-id></citation></ref>
<ref id="B18"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Jun</surname> <given-names>S. H.</given-names></name> <name><surname>Reichlen</surname> <given-names>M. J.</given-names></name> <name><surname>Tajiri</surname> <given-names>M.</given-names></name> <name><surname>Murakami</surname> <given-names>K. S.</given-names></name></person-group> (<year>2011</year>). <article-title>Archaeal RNA polymerase and transcription regulation.</article-title> <source><italic>Crit. Rev. Biochem. Mol. Biol.</italic></source> <volume>46</volume> <fpage>27</fpage>&#x2013;<lpage>40</lpage>. <pub-id pub-id-type="doi">10.3109/10409238.2010.538662</pub-id></citation></ref>
<ref id="B19"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Karr</surname> <given-names>E. A.</given-names></name></person-group> (<year>2014</year>). <article-title>Transcription regulation in the third domain.</article-title> <source><italic>Adv. Appl. Microbiol.</italic></source> <volume>89</volume> <fpage>101</fpage>&#x2013;<lpage>133</lpage>. <pub-id pub-id-type="doi">10.1016/B978-0-12-800259-9.00003-2</pub-id></citation></ref>
<ref id="B20"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Li</surname> <given-names>E.</given-names></name> <name><surname>Reich</surname> <given-names>C. I.</given-names></name> <name><surname>Olsen</surname> <given-names>G. J.</given-names></name></person-group> (<year>2008</year>). <article-title>A whole-genome approach to identifying protein binding sites: promoters in <italic>Methanocaldococcus</italic> <italic>(Methanococcus) jannaschii</italic>.</article-title> <source><italic>Nucleic Acids Res.</italic></source> <volume>36</volume> <fpage>6948</fpage>&#x2013;<lpage>6958</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gkm499</pub-id></citation></ref>
<ref id="B21"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Lie</surname> <given-names>T. J.</given-names></name> <name><surname>Leigh</surname> <given-names>J. A.</given-names></name></person-group> (<year>2003</year>). <article-title>A novel repressor of <italic>nif</italic> and <italic>glnA</italic> expression in the methanogenic archaeon <italic>Methanococcus maripaludis</italic>.</article-title> <source><italic>Mol. Microbiol.</italic></source> <volume>47</volume> <fpage>235</fpage>&#x2013;<lpage>246</lpage>. <pub-id pub-id-type="doi">10.1046/j.1365-2958.2003.03293.x</pub-id></citation></ref>
<ref id="B22"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Lie</surname> <given-names>T. J.</given-names></name> <name><surname>Wood</surname> <given-names>G. E.</given-names></name> <name><surname>Leigh</surname> <given-names>J. A.</given-names></name></person-group> (<year>2005</year>). <article-title>Regulation of nif expression in <italic>Methanococcus maripaludis</italic>: roles of the euryarchaeal repressor NrpR, 2-oxoglutarate, and two operators.</article-title> <source><italic>J. Biol. Chem.</italic></source> <volume>280</volume> <fpage>5236</fpage>&#x2013;<lpage>5241</lpage>. <pub-id pub-id-type="doi">10.1074/jbc.M411778200</pub-id></citation></ref>
<ref id="B23"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Littlefield</surname> <given-names>O.</given-names></name> <name><surname>Korkhin</surname> <given-names>Y.</given-names></name> <name><surname>Sigler</surname> <given-names>P. B.</given-names></name></person-group> (<year>1999</year>). <article-title>The structural basis for the oriented assembly of a TBP/TFB/promoter complex.</article-title> <source><italic>Proc. Natl. Acad. Sci. U.S.A.</italic></source> <volume>96</volume> <fpage>13668</fpage>&#x2013;<lpage>13673</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.96.24.13668</pub-id></citation></ref>
<ref id="B24"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Lubelska</surname> <given-names>J. M.</given-names></name> <name><surname>Jonuscheit</surname> <given-names>M.</given-names></name> <name><surname>Schleper</surname> <given-names>C.</given-names></name> <name><surname>Albers</surname> <given-names>S. V.</given-names></name> <name><surname>Driessen</surname> <given-names>A. J.</given-names></name></person-group> (<year>2006</year>). <article-title>Regulation of expression of the arabinose and glucose transporter genes in the thermophilic archaeon <italic>Sulfolobus solfataricus</italic>.</article-title> <source><italic>Extremophiles</italic></source> <volume>10</volume> <fpage>383</fpage>&#x2013;<lpage>391</lpage>. <pub-id pub-id-type="doi">10.1007/s00792-006-0510-7</pub-id></citation></ref>
<ref id="B25"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Marschaus</surname> <given-names>L.</given-names></name> <name><surname>Pfeifer</surname> <given-names>F.</given-names></name></person-group> (<year>2012</year>). <article-title>A dual promoter region with overlapping activator sequences drives the expression of gas vesicle protein genes in haloarchaea.</article-title> <source><italic>Microbiology</italic></source> <volume>158</volume> <fpage>2815</fpage>&#x2013;<lpage>2825</lpage>. <pub-id pub-id-type="doi">10.1099/mic.0.060178-0</pub-id></citation></ref>
<ref id="B26"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Moore</surname> <given-names>B. C.</given-names></name> <name><surname>Leigh</surname> <given-names>J. A.</given-names></name></person-group> (<year>2005</year>). <article-title>Markerless mutagenesis in <italic>Methanococcus maripaludis</italic> demonstrates roles for alanine dehydrogenase, alanine racemase, and alanine permease.</article-title> <source><italic>J. Bacteriol.</italic></source> <volume>187</volume> <fpage>972</fpage>&#x2013;<lpage>979</lpage>. <pub-id pub-id-type="doi">10.1128/JB.187.3.972-979.2005</pub-id></citation></ref>
<ref id="B27"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ochs</surname> <given-names>S. M.</given-names></name> <name><surname>Thumann</surname> <given-names>S.</given-names></name> <name><surname>Richau</surname> <given-names>R.</given-names></name> <name><surname>Weirauch</surname> <given-names>M. T.</given-names></name> <name><surname>Lowe</surname> <given-names>T. M.</given-names></name> <name><surname>Thomm</surname> <given-names>M.</given-names></name><etal/></person-group> (<year>2012</year>). <article-title>Activation of archaeal transcription mediated by recruitment of transcription factor B.</article-title> <source><italic>J. Biol. Chem.</italic></source> <volume>287</volume> <fpage>18863</fpage>&#x2013;<lpage>18871</lpage>. <pub-id pub-id-type="doi">10.1074/jbc.M112.365742</pub-id></citation></ref>
<ref id="B28"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ouhammouch</surname> <given-names>M.</given-names></name> <name><surname>Dewhurst</surname> <given-names>R. E.</given-names></name> <name><surname>Hausner</surname> <given-names>W.</given-names></name> <name><surname>Thomm</surname> <given-names>M.</given-names></name> <name><surname>Geiduschek</surname> <given-names>E. P.</given-names></name></person-group> (<year>2003</year>). <article-title>Activation of archaeal transcription by recruitment of the TATA-binding protein.</article-title> <source><italic>Proc. Natl. Acad. Sci. U.S.A.</italic></source> <volume>100</volume> <fpage>5097</fpage>&#x2013;<lpage>5102</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.0837150100</pub-id></citation></ref>
<ref id="B29"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ouhammouch</surname> <given-names>M.</given-names></name> <name><surname>Langham</surname> <given-names>G. E.</given-names></name> <name><surname>Hausner</surname> <given-names>W.</given-names></name> <name><surname>Simpson</surname> <given-names>A. J.</given-names></name> <name><surname>El-Sayed</surname> <given-names>N. M.</given-names></name> <name><surname>Geiduschek</surname> <given-names>E. P.</given-names></name></person-group> (<year>2005</year>). <article-title>Promoter architecture and response to a positive regulator of archaeal transcription.</article-title> <source><italic>Mol. Microbiol.</italic></source> <volume>56</volume> <fpage>625</fpage>&#x2013;<lpage>637</lpage>. <pub-id pub-id-type="doi">10.1111/j.1365-2958.2005.04563.x</pub-id></citation></ref>
<ref id="B30"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Peeters</surname> <given-names>E.</given-names></name> <name><surname>Peixeiro</surname> <given-names>N.</given-names></name> <name><surname>Sezonov</surname> <given-names>G.</given-names></name></person-group> (<year>2013</year>). <article-title>Cis-regulatory logic in archaeal transcription.</article-title> <source><italic>Biochem. Soc. Trans.</italic></source> <volume>41</volume> <fpage>326</fpage>&#x2013;<lpage>331</lpage>. <pub-id pub-id-type="doi">10.1042/BST20120312</pub-id></citation></ref>
<ref id="B31"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Peng</surname> <given-names>N.</given-names></name> <name><surname>Ao</surname> <given-names>X.</given-names></name> <name><surname>Liang</surname> <given-names>Y. X.</given-names></name> <name><surname>She</surname> <given-names>Q.</given-names></name></person-group> (<year>2011</year>). <article-title>Archaeal promoter architecture and mechanism of gene activation.</article-title> <source><italic>Biochem. Soc. Trans.</italic></source> <volume>39</volume> <fpage>99</fpage>&#x2013;<lpage>103</lpage>. <pub-id pub-id-type="doi">10.1042/BST0390099</pub-id></citation></ref>
<ref id="B32"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Peng</surname> <given-names>N.</given-names></name> <name><surname>Xia</surname> <given-names>Q.</given-names></name> <name><surname>Chen</surname> <given-names>Z.</given-names></name> <name><surname>Liang</surname> <given-names>Y. X.</given-names></name> <name><surname>She</surname> <given-names>Q.</given-names></name></person-group> (<year>2009</year>). <article-title>An upstream activation element exerting differential transcriptional activation on an archaeal promoter.</article-title> <source><italic>Mol. Microbiol.</italic></source> <volume>74</volume> <fpage>928</fpage>&#x2013;<lpage>939</lpage>. <pub-id pub-id-type="doi">10.1111/j.1365-2958.2009.06908.x</pub-id></citation></ref>
<ref id="B33"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Qureshi</surname> <given-names>S. A.</given-names></name> <name><surname>Jackson</surname> <given-names>S. P.</given-names></name></person-group> (<year>1998</year>). <article-title>Sequence-specific DNA binding by the <italic>S. shibatae</italic> TFIIB homolog, TFB, and its effect on promoter strength.</article-title> <source><italic>Mol. Cell</italic></source> <volume>1</volume> <fpage>389</fpage>&#x2013;<lpage>400</lpage>. <pub-id pub-id-type="doi">10.1016/S1097-2765(00)80039-8</pub-id></citation></ref>
<ref id="B34"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Sievers</surname> <given-names>F.</given-names></name> <name><surname>Wilm</surname> <given-names>A.</given-names></name> <name><surname>Dineen</surname> <given-names>D.</given-names></name> <name><surname>Gibson</surname> <given-names>T. J.</given-names></name> <name><surname>Karplus</surname> <given-names>K.</given-names></name> <name><surname>Li</surname> <given-names>W.</given-names></name><etal/></person-group> (<year>2011</year>). <article-title>Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega.</article-title> <source><italic>Mol. Syst. Biol.</italic></source> <volume>7</volume> <issue>539</issue>. <pub-id pub-id-type="doi">10.1038/msb.2011.75</pub-id></citation></ref>
<ref id="B35"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Soppa</surname> <given-names>J.</given-names></name></person-group> (<year>1999</year>). <article-title>Normalized nucleotide frequencies allow the definition of archaeal promoter elements for different archaeal groups and reveal base-specific TFB contacts upstream of the TATA box.</article-title> <source><italic>Mol. Microbiol.</italic></source> <volume>31</volume> <fpage>1589</fpage>&#x2013;<lpage>1592</lpage>. <pub-id pub-id-type="doi">10.1046/j.1365-2958.1999.01274.x</pub-id></citation></ref>
<ref id="B36"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Spitalny</surname> <given-names>P.</given-names></name> <name><surname>Thomm</surname> <given-names>M.</given-names></name></person-group> (<year>2003</year>). <article-title>Analysis of the open region and of DNA-protein contacts of archaeal RNA polymerase transcription complexes during transition from initiation to elongation.</article-title> <source><italic>J. Biol. Chem.</italic></source> <volume>278</volume> <fpage>30497</fpage>&#x2013;<lpage>30505</lpage>. <pub-id pub-id-type="doi">10.1074/jbc.M303633200</pub-id></citation></ref>
<ref id="B37"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Thomm</surname> <given-names>M.</given-names></name> <name><surname>Wich</surname> <given-names>G.</given-names></name></person-group> (<year>1988</year>). <article-title>An archaebacterial promoter element for stable RNA genes with homology to the TATA box of higher eukaryotes.</article-title> <source><italic>Nucleic Acids Res.</italic></source> <volume>16</volume> <fpage>151</fpage>&#x2013;<lpage>163</lpage>. <pub-id pub-id-type="doi">10.1093/nar/16.1.151</pub-id></citation></ref>
<ref id="B38"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Tumbula</surname> <given-names>D. L.</given-names></name> <name><surname>Makula</surname> <given-names>R. A.</given-names></name> <name><surname>Whitman</surname> <given-names>W. B.</given-names></name></person-group> (<year>1994</year>). <article-title>Transformation of <italic>Methanococcus maripaludis</italic> and identification of a <italic>Pst</italic>I-like restriction system.</article-title> <source><italic>FEMS Microbiol. Lett.</italic></source> <volume>121</volume> <fpage>309</fpage>&#x2013;<lpage>314</lpage>. <pub-id pub-id-type="doi">10.1111/j.1574-6968.1994.tb07118.x</pub-id></citation></ref>
<ref id="B39"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>van de Werken</surname> <given-names>H. J.</given-names></name> <name><surname>Verhees</surname> <given-names>C. H.</given-names></name> <name><surname>Akerboom</surname> <given-names>J.</given-names></name> <name><surname>de Vos</surname> <given-names>W. M.</given-names></name> <name><surname>van der Oost</surname> <given-names>J.</given-names></name></person-group> (<year>2006</year>). <article-title>Identification of a glycolytic regulon in the archaea <italic>Pyrococcus</italic> and <italic>Thermococcus</italic>.</article-title> <source><italic>FEMS Microbiol. Lett.</italic></source> <volume>260</volume> <fpage>69</fpage>&#x2013;<lpage>76</lpage>. <pub-id pub-id-type="doi">10.1111/j.1574-6968.2006.00292.x</pub-id></citation></ref>
<ref id="B40"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Vandyke</surname> <given-names>D. J.</given-names></name> <name><surname>Wu</surname> <given-names>J.</given-names></name> <name><surname>Logan</surname> <given-names>S. M.</given-names></name> <name><surname>Kelly</surname> <given-names>J. F.</given-names></name> <name><surname>Mizuno</surname> <given-names>S.</given-names></name> <name><surname>Aizawa</surname> <given-names>S. I.</given-names></name><etal/></person-group> (<year>2009</year>). <article-title>Identification of genes involved in the assembly and attachment of a novel flagellin N-linked tetrasaccharide important for motility in the archaeon <italic>Methanococcus maripaludis</italic>.</article-title> <source><italic>Mol. Microbiol.</italic></source> <volume>72</volume> <fpage>633</fpage>&#x2013;<lpage>644</lpage>. <pub-id pub-id-type="doi">10.1111/j.1365-2958.2009.06671.x</pub-id></citation></ref>
<ref id="B41"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>J.</given-names></name> <name><surname>Li</surname> <given-names>E.</given-names></name> <name><surname>Olsen</surname> <given-names>G. J.</given-names></name></person-group> (<year>2009</year>). <article-title>Protein-coding gene promoters in <italic>Methanocaldococcus (Methanococcus) jannaschii</italic>.</article-title> <source><italic>Nucleic Acids Res.</italic></source> <volume>37</volume> <fpage>3588</fpage>&#x2013;<lpage>3601</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gkp213</pub-id></citation></ref>
</ref-list>
</back>
</article>