Samples were collected from points indicated in Figure 1 in November 2013, January 2015 and August 2015 in 1 L autoclaved Nalgene bottles filled to the brim to exclude air and samples were shipped on ice. Shipping times for these three sets were 4, 3, and 4 days, respectively. The samples were stored in an anaerobic hood with 90% (v/v) N₂ and 10% CO₂ (N₂-CO₂) atmosphere upon arrival. Four types of samples were sent: source water (SW), injection water (IW), produced waters (PW) with emulsified oil, free-water knockout water (FW) and treatment water (TW). The aqueous layers of the PW samples were used for analyses and enrichments. Synthetic facility water, 300 mL per L of sample, was added to PW samples that had little water and were difficult to separate. Synthetic facility water contained per L: 146 g NaCl, 2.37 g KCl, 1.82 g MgCl₂, 6.48 g CaCl₂ and 0.34 g NaHCO₃.

Water chemistry analyses for field samples were carried out using 50 mL of sample for pH, salinity, sulfate and ammonium concentration measurements. Sulfate concentrations were also measured for enrichments, continuous cultures and bioreactors. Analyses of the concentrations of sulfide, nitrate or nitrite were for enrichments, continuous cultures and bioreactors only. The pH was measured using an Orion pH meter (Model 370). Salinity in molar equivalent (Meq) of NaCl was analyzed with an Orion conductivity cell (model 013005MD). The concentration of dissolved sulfide was measured using the diamine method (Trüper and Schlegel, 1964). Samples were diluted to 1 Meq of NaCl before analyzing sulfate, nitrate and nitrite with the Waters 600E high performance liquid chromatography (HPLC) instrument. Sulfate was measured using a conductivity detector (Waters 423) and IC-PAK anion column (4 × 150 mm, Waters) with acetonitrile, borate/gluconate buffer at a flow rate of 2 ml/min. Nitrate and nitrite were eluted from the same column with the same buffer that were measured with an UV detector (UV/VIS-2489, Waters) at 220 nm. Ammonium concentrations were measured using spectrophotometry with the indophenol method (Aminot et al., 1997).

Viable SRB and acid-producing bacteria (APB) in field samples were enumerated by a miniaturized three well MPN method, using 48 well (6 × 8) plates. For the MPN of SRB, 0.1 ml of sample was inoculated into 0.9 ml of Postgate B medium (at 0.01 M and 2 M NaCl, per L: 0.5 g KH₂PO₄, 1.0 g NH₄Cl, 1.3 g CaSO₄•2H₂O, 2.0 g MgSO₄•7H₂O, 4.0 g 60% sodium lactate, 1.0 g yeast extract, 0.1 g ascorbic acid, 0.1 g thioglycolate, 0.5 g FeSO₄•7H₂O, pH 7-7.5), containing lactate, sulfate and ferrous iron. These were then serially diluted 10-fold to 10⁻⁸ in the same medium in triplicate wells. The plate was immediately covered with a Titer-Tops membrane and incubated at 32°C inside the anaerobic hood. Wells were scored as positive when a black FeS precipitate was evident. For MPN of APB, the sample was serially diluted in Phenol Red Dextrose medium with 0.1 M or 2 M of NaCl (ZPRA-5, DALYNN Biologicals) using the same procedure as described for SRB. Growth of APB results in a decrease of pH detected as a change in color from orange to yellow. MPN values were calculated for triplicate dilution series by comparing the pattern of positive wells to a probability table for MPN tests (Shen and Voordouw, 2017).

Enrichments were grown in 120-mL serum bottles with 60 mL of anaerobic Coleville synthetic brine medium K (CSBK) containing the following in g/L: NaCl, 1.5, 29.2, 43.8, 58.4, 87.7, 116.9 or 146.1; KH₂PO₄, 0.05; NH₄Cl, 0.32; CaCl₂•2H₂O, 0.21; MgCl₂•2H₂O, 0.54; KCl, 0.1. After autoclaving 30 mL of 1 M NaHCO₃, 1 mL of vitamin solution and 1 mL of selenite-tungstate solution (Hubert et al., 2003) were added, 1 mM of Na₂S (as reductant) was also added and the pH was adjusted to 7.2 to 7.5 prior to dispensing medium into N₂-CO₂ flushed serum bottles. Autoclaved sulfate or nitrate (4 or 10 mM) was added as electron acceptors. Volatile fatty acids (VFA) (3 mM or 6 mM each of acetate, propionate, and butyrate) or lactate (20 mM) was added as the electron donors. Enrichments were incubated at 30°C in the dark shaking at 100 rpm. Enrichments were also used to inoculate continuous cultures (chemostats).

Aliquots (10% v/v) of 2013 and 2015 shale oil field samples were inoculated into 120 mL serum bottles containing 60 mL of reduced CSBK medium with different salinities (0.01, 0.5, 0.75, 1.0, 1.5, 2.0, or 2.5 M NaCl). Incubations received either lactate (20 mM) or VFA (3 or 6 mM) as electron donors and sulfate (10 mM) or nitrate (10 or 20 mM) as electron acceptors. All enrichments were done in duplicate and incubated at 30°C. Successful enrichments were transferred into medium with the same substrates.

Chemostats were inoculated using secondary enrichments of August 2015 field samples (08/15). High salinity (2.5 M NaCl) chemostats contained lactate and sulfate (LS_2.5), lactate and nitrate (LN_2.5), VFA and sulfate (VS_2.5) or VFA and nitrate (VN_2.5). These were inoculated with high salinity enrichments of TW_08/15. Low salinity (0.5 M NaCl) chemostats contained lactate and sulfate (LS_0.5) or lactate and nitrate (LN_0.5). Chemostats contained 100 mL of culture stirring at 400 rpm and were incubated at 37°C. The medium flow rate was generally 42 mL/day, corresponding to a dilution rate of 0.42 day⁻¹.

Bioreactors were set up to determine the effect of nitrate on sulfide production under flow conditions at high salt concentration using methods as described previously (Xue and Voordouw, 2015) (Figure 2) with plastic syringes (30 mL) without pistons as bioreactor columns. Glass wool and polymeric mesh were placed at the bottom of the bioreactors. The bioreactors were then tightly packed with sand (Sigma-Aldrich, 50–70 mesh particle size). The pore volume (PV) of the columns was calculated using the weight difference between medium-flooded columns and dry columns (PV = 12.47 ± 0.53 mL). The medium used was CSBK with 0.5 or 2.5 M NaCl and 10 mM sulfate, 10 mM nitrate, 20 mM lactate or 6 mM VFA, as indicated. After media flooding, the bioreactors were inoculated with 0.5 PV of an enrichment or a chemostat culture. Bioreactors were then incubated without flow for 2 weeks. Post incubation, medium with 4 mM sulfate and/or 4 mM nitrate was injected into the bioreactors at flow rates of 0.1 to 0.6 PV/day as indicated. Periodic measurements of anions and sulfide were taken for samples collected from the effluent port of the bioreactors (Figure 2). At the end of the experiment the microbial community compositions were analyzed by Illumina Miseq sequencing. Bioreactors were run at room temperature (22°C).

DNA was extracted from field samples and for samples from incubations or bioreactors. For field samples, 250 mL of the aqueous phase of each sample was centrifuged at 14,000x g for 20 min at 4°C to pellet the cells. For incubations, 5 mL of sample was centrifuged at 14,000x g for 10 min at 4°C. For the bioreactors, 5 mL of the effluent was collected on ice then centrifuged at 14,000x g for 10 min at 4°C. Following completion of the experiment, the bioreactors were dismantled and 5 mL of sterile water was added to 5 g of inlet sand fraction and shaken vigorously. The supernatant was then removed and centrifuged at 14,000x g for 10 min at 4°C to pellet cells. DNA was extracted from the cell pellets using the FastDNA extraction kit for soil (MP Biomedicals). DNA was quantified with a Qubit fluorimeter (Invitrogen) using the Quant-iT double-stranded DNA (dsDNA) HS assay kit (Invitrogen).

For the 2013 field samples 16S rRNA genes were amplified using a two step-PCR procedure. The first PCR (25 cycles) was done using non-barcoded universal 16S primers (926F: AAACTYAAAKGAATTGRCGG and 1392R: ACGGGCGGTGTGTRC) with conditions as described elsewhere (Park et al., 2011). PCR products were checked with gel electrophoresis and purified with a QIAquick PCR Purification Kit (Qiagen). The second PCR (10 cycles) was done using barcoded FLX titanium amplicon primers 454T_RA_X and 454T_FwB, which have the 16S primers (926F and 1392) as their 3'-ends (Park et al., 2011). The resulting PCR products were purified and quantified prior to pyrosequencing at the McGill University Genome Quebec Innovation Centre, Montreal, using a Genome Sequencer FLX instrument and a GS FLX titanium series XLR70 kit (Roche Diagnostic Corporation).

For 2015 field samples, incubation and bioreactor DNAs were amplified using the same two-step PCR process but with Illumina Miseq non-barcoded primers (926Fi5 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAACTYAAAKGAATWGRCGG and 1392RiF GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACGGGCGGTGWGTRC) for the first PCR (25 cycles). For the 2nd PCR (10 cycles), forward primer (P5-S50X-OHAF) with a 29-nt 5' Illumina sequencing adaptor (P5, AATGATACGGCGACCACCGAGATCTACAC), an 8-nt identifying index S50X and a 14-nt forward overhang adaptor (OHAF, TCGTCGGCAGCGTC), and reverse primer (P7-N7XX-OHAF) with a 24-nt 3' Illumina sequencing adaptor (P7, CAAGCAGAAGACGGCATACGAGAT), an 8-nt identifying index N7XX and a 14-nt reverse overhang adaptor (OHAF, GTCTCGTGGGCTCGG), were used. The final PCR product was purified and quantified using the same procedures as above and sent for Illumina Miseq sequencing at the University of Calgary.

Analyses of pyrosequencing and Illumina Miseq sequences were done with the MetaAmp software, (http://ebg.ucalgary.ca/metaamp/; developed by the University of Calgary Energy Bioengineering Group) and sequences were subjected to stringent quality control (QC). Merged reads using PEAR 0.9.8 were uploaded to MetaAmp, which used a cutoff quality score for each sequence of 50 and a minimum length of each sequence of 420 base pairs. The QC sequences were clustered into operational taxonomic units (OTUs) using average neighbor clustering at a distance of 3%. Each remaining OTU was assigned to a taxon by comparing with the latest version of the non-redundant 16S rRNA small subunit SILVA database. Samples were clustered into a dendrogram using the unweighted pair group method algorithm (UPGMA) and the distance between communities was calculated using the Bray-Curtis coefficient in the Mothur software. The dendrogram was visualized using the MEGA5.2.2. Program (Tamura et al., 2011). The entire sets of raw reads have been submitted to the NCBI Sequence Read Archive (SRA) under Bioproject accession number PRJNA181037, with Biosample numbers SAMN06624370 and SAMN06624665.

The water chemistry of the source water (SW), injection water (IW), produced water (PW), free water knockout water (FW) and treater water (TW) samples is summarized in Table 1. Samples that were mostly oil and required synthetic facility water for obtaining an aqueous extract are not included. SW and IW samples (SW-IWs) had an average salinity of 0.7 ± 0.1 Meq of NaCl, a high sulfate concentration of 29.9 ± 2.6 mM and a low ammonium concentration of 2.0 ± 0.9 mM. These values were similar for all samples reflecting those of the Mannville SW of which the water chemistry was apparently constant with time. In contrast the PWs had salinities ranging from 0.6 to 3.7 Meq of NaCl (average 1.6 ± 1.0 Meq of NaCl), sulfate concentrations from 5.1 to 34.8 mM (average 23.6 ± 10.1 mM) and ammonium concentrations from 2.4 to 33.2 mM (average 17.3 ± 11.0 mM). Three PWs had similar salinity and sulfate concentration as for the SW-IWs. However, only one of these (12PW_08/15) also had a low ammonium concentration of 2.4 mM (Table 1). The bivariate fit analysis of ammonium concentrations and salinity (JMP®, Version 13.1. SAS Institute Inc., Cary, NC, 1989–2007), with the exception of sample 11PW_08/15, showed a linear relationship (Figure S1: r² = 0.90), indicating that the increased salinity and ammonium concentration of the PWs were likely contributed by the shale oil formation. However, salinity and sulfate concentration were not linearly correlated, indicating that the shale formation can either decrease or maintain the sulfate concentration of produced waters from the value of 30 mM (540 ppm) of the SW-IWs (Table 1). The ammonium concentration in flowback waters from shale gas fields was shown to correlate linearly with the chloride concentration in each geological formation with maximum values of 432 ppm (24 mM) of ammonium and 160,000 ppm (4.5 M) of chloride (Harkness et al., 2015). Produced waters from all producing wells are co-mingled in the FW and TW processing facilities. The PWs that were sampled were only a small subset of these. The average salinity of FW and TW (FW-TW) samples was 2.4 ± 0.3 Meq of NaCl. The average ammonium and sulfate concentrations were 22.5 ± 3.5 and 17.2 ± 1.6 mM, respectively. These averages were similar but not identical to those for the PWs, because the selected set of PWs may not represent the average.

MPNs for APB and SRB were determined both at 0.01 M and 2 M NaCl (Table S1). The MPNs were higher at higher salinity for APB in 6 of 7 and for SRB in 4 of 7 PW samples, indicating the presence of a halophilic microbial community.

DNAs were isolated, subjected to PCR and either pyrosequencing (2013 samples) or Illumina sequencing (2015 samples). dendrogram for microbial community compositions of the 2015 samples (Figure 3) indicated five distinct clades (Figure 3A; I-V). Communities in FW-TW samples (clades I and II) were distinct from those in most produced water samples (clade V). Microbial community compositions for 4PW and 13IW were in clades III and IV, respectively.

Microorganisms can be described as being halophilic (requiring high salt for growth) or halotolerant (tolerating high salt, but growing better at low salt) (Oren, 2008). Because this property cannot be derived from most genus names, we will use the term halophilic/halotolerant to describe identified taxa. The microbial communities in clade I (FW-TW 08/15) were dominated by the halophilic/halotolerant genera Halanaerobium, Modicisalibacter, Methanohalophilus, and Chromohalobacter. Microbial communities from clade II (FW-TW 01/15), were dominated by Halanaerobium, Desulfovermiculus, Methanohalophilus, Rhodococcus, Ralstonia, Marinobacterium, and Dethiosulfatibacter (Table 2). The community compositions of PW samples in clade V had high fractions (45-95%) of Marinobacter with smaller fractions of Halomonas, Thiomicrospira, Methanothermococcus, and Desulfotignum (Table 2). The single IW sample in clade IV had a community dominated by Thiomicrospira, unidentified Gammaproteobacteria and Desulfocella (Figure 3A, Table 2), whereas the single PW sample in clade III had high fractions of Halanaerobium (36%) and Desulfovermiculus (41%) and smaller fractions of Methanohalophilus, Chromohalobacter, Marinobacterium, and Sphingobacteriales. Overall these results indicated dominance of halophilic/halotolerant taxa in the microbial communities of all samples, except 13IW.

The microbial communities in 2013 samples were also dominated by halophilic/halotolerant taxa. High fractions of Methanohalophilus, Halanaerobium, and Desulfovermiculus, as well as of Flexistipes, Halomonas, and Desulfohalobium were found (Table S2).

Media with 2.5 M NaCl, containing lactate and sulfate (LS_2.5), VFA and sulfate (VS_2.5) or VFA and nitrate (VN_2.5) were inoculated with 9 field samples collected in 2013. Incubations in LS_2.5 medium showed SRB activity for 5 of these with reduction of 9.5±0.03 mM sulfate to 5.2 ± 0.7 mM of aqueous sulfide in 20 to 60 days (Figures 4A,B), whereas incubations in VS_2.5 medium showed activity for 3 samples with reduction of 9.6 ± 0.2 mM sulfate to 3.8 ± 0.6 mM sulfide (Figures 4C,D). Five samples showed nitrate reduction (Figure 4E). Of these 4 accumulated up to 9.2 ± 0.6 mM nitrite (Figure 4C), whereas nitrite was transiently formed in 10TW_11/13 (Figure 4F).

The enrichments in VS_2.5 medium were used to inoculate fresh cultures at 1.0 M or 2.5 M NaCl with or without 10 mM nitrate. With 4PW_11/13 enrichment sulfide was produced at 1.0 or 2.5 M NaCl, irrespective of the presence of nitrate (Figure S2B). Nitrate reduction was not observed (Figures S2C,D). Similar results were observed for 9FW_11/13 enrichment (Figure S3). In incubations with 10TW_11/13 enrichment at 2.5 M NaCl sulfate was reduced to sulfide in the absence, but not in the presence of nitrate (Figures S4A,B). At 1 M NaCl nitrate was reduced first with little remaining at 15 days and little nitrite being formed (Figures S4C,D). Following the reduction of nitrate, sulfate was reduced with formation of 6.6 ± 0.01 mM sulfide (Figures S4A,B). These results suggest accumulation of nitrite at high salinity (2.5 M NaCl), which inhibits sulfate reduction. At low salinity no nitrite accumulated and no inhibition of sulfate reduction was observed. The results with enrichments of 4PW_11/13 (Figure S2) and 9FW_11/13 (Figure S3) indicated that NRB were absent. These were also absent from the primary enrichment of 9FW_11/13 in VN_2.5 medium (not shown). The primary enrichment of 4PW_11/13 did have NRB activity (Figure 4F).

Only 3 out of 6 samples collected in January 2015 showed SRB activity in LS_2.5 medium with 10.0 ± 0.2 mM sulfide being produced within 60 days (Figure S5). Both LS_0.75 and LS_2.5 were inoculated with 9 field samples collected in August 2015. SRB activity was observed in 6 of 9 samples with production of up to 9.3 and 10.7 mM sulfide at 0.75 and 2.5 M NaCl, respectively (Figures S6A,B). To test the effect of salinity on NRB activity, samples 2PW_08/15, 10TW_08/15, 13W_08/15, and 15PW_08/15 were inoculated into media with VFA and nitrate with 0, 0.5, 1.5 or 2.5 M NaCl (Figure S7). Nitrate reduction was slowest at 2.5 M NaCl with nitrite accumulating in incubations with 2PW_08/15, 10TW_08/15, and 15PW_08/15 (Figures S7A,B,D). Little nitrate reduction and no nitrite accumulation were observed at 2.5 M NaCl in the incubation of 13IW_08/15 (Figure S7C), indicating this sample to have few halophilic NRB. Nitrate reduction was faster at 1.5 M NaCl; nitrite accumulated only in the incubation with 10TW_08/15. Nitrate reduction was fastest at 0.5 and 0 M NaCl, with no nitrite accumulation in any of the incubations (Figure S7).

Thus, the results showed that samples from Bakken shale oil fields harbored halophilic SRB and NRB, capable of growth at 2.5 M NaCl. Halophilic NRB reduced nitrate mostly to nitrite under these conditions. At lower salinities nitrite accumulation was not observed, indicating reduction of nitrate to N₂. Production of N₂O was tested by headspace gas analyses, but was not found (results not shown).

Chemostats at salinities of 0.5 and 2.5 M NaCl were established using secondary enrichments of 13IW_08/15 and 10TW_08/15, respectively. Steady state SRB activity was established within 2 days in LS_0.5-fed, within 50 days in LS_2.5-fed and within 60 days in VS_2.5-fed chemostats (Figures S8A–C). Likewise, steady state NRB activity was established more rapidly at low salinity in LN_0.5 medium (Figure S8F) than at high salinity in LN_2.5 and VN_2.5 media (Figures S8D,E). The average nitrite concentrations in these chemostats were 0.3±0.6, 2.0 ± 2.4 and 1.4 ± 1.5 mM, respectively. Although nitrate concentrations fluctuated significantly they were on average higher at high than at low salinity (Figures S8D–F).

The microbial community compositions in these six chemostats were very different (Table 3). Under sulfate-reducing conditions SRB of the genus Desulfovibrio dominated in LS_0.5, whereas Halanaerobium and the SRB Desulfovermiculus were most prominent at high salinity in LS_2.5 and VS_2.5 (Table 3). Under nitrate-reducing conditions Geoalkalibacter, Mollicutes and Dethiosulfatibacter dominated in LN_0.5, whereas Halomonas, Marinobacter and Halanaerobium dominated in LN_2.5 and VN_2.5 (Table 3).

SRB enrichments of 4PW_11/13, which had been transferred three times, were used to inoculate two bioreactors. These were then continuously injected with either VSN_2.5 or VS_2.5, as indicated (Figure S9). Injection of VS_2.5, containing 6 mM VFA, 4 mM sulfate and 2.5 M NaCl gave production of 2 mM sulfide after 120 days (Figure S9B), indicating the potential of souring at high salinity. The bioreactor injected with VSN_2.5, containing 6 mM VFA, 4 mM sulfate, 4 mM nitrate and 2.5 M NaCl gave reduction of 2 mM sulfate at day 75. Nitrate reduction did not start until day 110. No nitrate was observed in the bioreactor effluent from day 150 onwards. However, this did contain 2 mM nitrite. As a result sulfate reduction was no longer observed (Figure S9A). The slow start of nitrate reduction indicated that the halophilic SRB enrichment contained few residual NRB at the beginning of the experiment.

Reduction of nitrate and sulfate in bioreactors inoculated with the chemostat cultures of Figure S8 is shown in Figure 5. The duplicated bioreactors (I and II) were continuously injected with LS_0.5, LS_2.5, LSN_0.5, or LSN_2.5, containing 20 mM lactate and 4 mM sulfate without or with 4 mM nitrate. In the absence of nitrate after 30 days, steady concentrations of 3.2 ± 0.4 and 3.2 ± 0.2 mM sulfide were formed at 0.5 and 2.5 M NaCl, respectively (Figure 5A). In the presence of 4 mM sulfate and 4 mM nitrate at low salinity no nitrate or nitrite were detected in the effluent, and steady formation of 3.3 ± 0.2 mM sulfide was observed after 30 days. These results indicated sequential reduction of nitrate and sulfate, as observed elsewhere (Callbeck et al., 2011; Chen et al., 2017). In the presence of 4 mM sulfate and 4 mM nitrate at high salinity no reduction of sulfate to sulfide was detected, whereas all nitrate was reduced. On average 2.4 ± 1.0 mM nitrite persisted in the effluent of LSN_2.5 (Figure 5B). Thus, as in experiments with batch cultures and continuous cultures, nitrite also accumulated in bioreactors at high salinity preventing reduction of sulfate to sulfide (Figure 5A).

The microbial community in influent sand of the LS_2.5 bioreactors had high fractions of Halanaerobium and Desulfovermiculus (Table 4), while that of LSN_2.5 bioreactors had high fractions of Halomonas and Halanaerobium, but mostly lacked the halophilic SRB Desulfovermiculus (Table 4). At 0.5 M NaCl, with and without nitrate the dominant taxa were Halanaerobium, Halomonas, and Desulfovibrio (Table 4). A high fraction of Pseudomonas was also detected in influent sand of the LSN_0.5 bioreactors, but not in that of LS_0.5 bioreactors (Table 4). Overall, the results from these bioreactors suggest that an accumulation of nitrite at high salinity inhibited growth of the SRB Desulfovermiculus. At 0.5 M NaCl Desulfovibrio was found as a major community component both in the absence and presence of nitrate. In the presence of nitrate this taxon likely grew in a zone, which was already depleted of nitrate, allowing sulfate reduction.

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.