An inducible vector was designed using the following elements: the AlcR gene and AlcA promoter from Aspergillus nidulans, the replication protein “Rep,” and the origin of replication “Ori” from the geminivirus Ageratum enation virus. The elements of the viral vector were placed in the following order: Cauliflower mosaic virus 35S promoter, AlcR gene, nopaline synthase terminator (nos), Ori, AlcA promoter, Sma I, BamHI, and Pst I restriction sites, 35S terminator, Ori (repeated), AlcA promoter, and Rep protein ORF. A DNA fragment containing this array was synthetized by GenScript Inc. (New Jersey, USA) and sub-cloned in the binary vector pBI121 at the XbaI-Sac I sites through standard digestion-ligation procedures. A positive clone identified by restriction profile was used to perform sequencing and confirm sequence integrity; the construct was subsequently transferred into Agrobacterium tumefaciens (GV3101 strain) by electroporation (Cangelosi et al., 1991). A clone carrying the expression vector was confirmed by PCR and subsequently cultivated overnight in Luria Bertani broth at 25°C and 200 rpm to perform expression experiments.

The Schizochytrium sp. strain 20888 was obtained from ATCC (USA), it was cultured at 25°C in modified seawater medium (5 g/L peptone, 1 g/L yeast extract, 0.2 g/L FeSO₄, 15 g/L agar, and 35 g/L NaCl). For liquid cultures, the 679BY medium was used (1 g/L yeast extract, 1 g/L peptone, 5 g/L dextrose, and 35 g/L NaCl). Cultures were incubated at 150 rpm. Transformation was carried out by inoculating Schizochytrium sp. cultures (100 mL, OD_650nm = 0.7) with 1 mL of A. tumefaciens culture (OD_650nm = 1.0). The medium was supplemented with 100 μM acetosyringone. 16 h post-inoculation cefotaxime was added at a final concentration of 250 mg/L. The expression of the gene of interest in the transiently transformed microalgae was induced 20 h post-inoculation by the addition of 1 mL of absolute ethanol (1% of final concentration). Culture samples were collected before induction and 12, 24, and 48 h post-induction. Samples were stored at −80°C until further use.

Circular DNA replicons were detected by inverse PCR using the following primer sets: for GP1, forward 5′CATCACCAAGATACCGGAGAAG and reverse 5′TTTAGTTTCCCAGAAGGCCC3′; for LTB, forward 5′CATTTCCCTCTTTCCAGCCAand reverse 5′TTATGGAGAAACTCGAGCTTGT 3′. Total DNA was isolated from Schizochytrium sp. cultures according to Dellaporta et al. (1983). PCR reaction mixtures (25 μL) contained 1 × PCR buffer, 100 ng DNA, 1.5 mM magnesium chloride, 2.5 U Taq DNA polymerase, 1 mM dNTPs, and 1 μM of the corresponding primer set. Cycling conditions were: 94°C for 5 min (initial denaturation); 35 cycles at 94°C for 30 s, 55°C for 30 s, 72°C for 120 s, and a final extension at 72°C for 10 min. PCR products were detected by electrophoresis in 1% agarose gels. The negative control consisted of 100 ng of DNA from WT Schizochytrium sp. culture.

The integrity of the Schizochytrium-made recombinant proteins was assessed by Western blot analysis. Culture samples were collected at different post-induction times (0, 12, 24, and 48 h) and protein extracts were obtained as follows: 20 mg of fresh biomass were resuspended in 200 μL of extraction buffer (750 mM Tris-HCl, pH 8, 15% sucrose, 100 mM β-mercaptoethanol, and 1 mM PMSF) and sonicated (4 pulses of 4 s with a 4 s delay in between) using an ultrasonic processor equipment at 24% amplitude (model GEX130PB). Samples were subsequently centrifuged at 8,000 rpm for 15 min and the supernatants were transferred to new microtubes. Total soluble protein concentration was determined in the extracts by the Lowry method and a volume corresponding to 80 μg of TSP (approximately 100 μL) was mixed with the same volume of 2 × reducing loading buffer, denatured by boiling for 5 min at 95°C, and subsequently subjected to SDS-PAGE analysis. Gels were blotted onto 0.45 μm Bio-Rad nitrocellulose membranes (http://www.bio-rad.com). Protein transfer was performed using a TV100-EBK Electroblotter (AlphaMetrix Biotech, GER) for 1 h at 150 V in a methanol-based transfer buffer. After blocking with 5% fat-free milk (Carnation, Nestle) dissolved in PBS-0.1% Tween, the blots were incubated with mouse anti-sera (1:200 dilution) against either LTB or GP1; which were produced in mice as previously described (Orellana-Escobedo et al., 2015). The blots were washed and incubated with a goat horseradish peroxidase-conjugated secondary anti-IgG mouse antibody (1:2,000 dilution, Sigma) for 2 h at room temperature. Antigen detection was revealed by incubating blots with the SuperSignal West Dura solution following the instructions from the manufacturer (Thermo Scientific, http://www.thermoscientific.com) and exposing the film to standard procedures. LTB and GP1 proteins (250 ng) purified from recombinant E. coli were used as positive controls.

For quantitative ELISA, a protocol described elsewhere was applied (Ríos-Huerta et al., 2017). Briefly, protein extracts were obtained as described above and diluted with 0.2 M carbonate buffer (pH = 9.6). The diluted sample was added to an ELISA plate for protein adsorption at 4°C. After blocking with 5% fat-free dry milk solution for 2 h at room temperature, the plates were incubated with either anti-LTB (1:500 dilution) or anti-GP1 mouse serum (1:1,000 dilution) overnight at 4°C. The plates were subsequently incubated with a rabbit horseradish peroxidase-conjugated anti-mouse IgG (1:2,000 dilution) for 2 h at 25°C. A colorimetric reaction was induced by addition of the ABTS substrate solution (0.6 mM 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid), 0.1 M citric acid, pH = 4.35, and 1 mM H₂O₂), after 30 min of incubation at 25°C OD values were measured at 405 nm. Standard curves were constructed using pure LTB or GP1 to estimate expression levels.

Gene synthesis and molecular cloning techniques allowed the construction of the pAlgevir vector; whose physical map is shown in Figure 1 while the restriction profile and sequence are shown in Figures S1, S2, respectively. The AlcR gene from A. nidulans is under the control of the Cauliflower mosaic virus 35S promoter and the nos terminator, whereas the Rep protein is under the control of the AlcA inducible promoter from A. nidulans and the nos terminator. The gene of interest, which is inserted into the SmaI at the 5′ end and either BamHI or PstI sites at the 3′ end, is under the control of the inducible AlcA promoter and the 35S terminator. Upon ethanol induction, the transcription factor AlcR is activated leading to the expression of the gene of interest and the Rep protein. The latter acts on the Ori elements and mediates the generation and replication of circular DNA molecules carrying the expression cassette for the biopharmaceutical. The obtained restriction profile for the pAlgevir vector is shown in Figure S1.

Expression studies were conducted to evaluate the efficiency of the Algevir system. Schizochytrium sp. cultures were inoculated with recombinant agrobacteria and induced with ethanol 20 h post-inoculation, with the subsequent analysis to determine vector replication and recombinant protein yields at different post-induction times. We first investigated the presence of DNA replicons through inverse PCR analysis to prove the expression of functional Rep leading to replication of the expression cassette. In this approach PCR primers landing in the expression cassette flanks but at a divergent position allow the amplification of circular molecules only, which are generated by rolling circle replication; whereas lineal forms of the expression cassette are not amplified. Transformed and induced Schizochytrium sp. cultures showed a positive result at any studied time point, indicating that the Algevir plasmid mediates the generation of replicons by rolling circle replication (Figure 2). The amplification was also detected at the pre-induction phase, which suggested a basal transcription of the Rep protein before ethanol induction. In terms of recombinant protein production, Schizochytrium sp. showed a minimum level of recombinant protein at the pre-induction phase. The recombinant protein levels dramatically increased upon induction, reaching the highest levels 48 h post-induction (Figure 3). According to an ELISA, the recombinant protein yields 48 h post-induction reached values up to 1.25 mg/g fresh weight (FW) for GP1 (6 mg/L of culture) and 0.12 mg/g FW (0.6 mg/L of culture) for LTB (Figure 4). Quantitative ELISA analysis confirmed that 48 h post-induction was the time point with maximum yields whereas shorter or extended post-induction times showed significantly lower protein yields (data not shown).

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The work presented in this report is the subject of a pending patent.