<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Microbiol.</journal-id>
<journal-title>Frontiers in Microbiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Microbiol.</abbrev-journal-title>
<issn pub-type="epub">1664-302X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fmicb.2017.00819</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Microbiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>A Novel ESAT-6 Secretion System-Secreted Protein EsxX of Community-Associated <italic>Staphylococcus aureus</italic> Lineage ST398 Contributes to Immune Evasion and Virulence</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name><surname>Dai</surname> <given-names>Yingxin</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="author-notes" rid="fn002"><sup>&#x2020;</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/406319/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Wang</surname> <given-names>Yanan</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="author-notes" rid="fn002"><sup>&#x2020;</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/434697/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Liu</surname> <given-names>Qian</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="author-notes" rid="fn002"><sup>&#x2020;</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/410429/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Gao</surname> <given-names>Qianqian</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/428850/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Lu</surname> <given-names>Huiying</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/429408/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Meng</surname> <given-names>Hongwei</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/413393/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Qin</surname> <given-names>Juanxiu</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/434727/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Hu</surname> <given-names>Mo</given-names></name>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Li</surname> <given-names>Min</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="author-notes" rid="fn001"><sup>&#x002A;</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/364515/overview"/>
</contrib>
</contrib-group>
<aff id="aff1"><sup>1</sup><institution>Department of Laboratory Medicine, Renji Hospital, School of Medicine, Shanghai Jiao Tong University</institution> <country>Shanghai, China</country></aff>
<aff id="aff2"><sup>2</sup><institution>Institute of Analytical Chemistry and Synthetic and Functional Biomolecules Center, College of Chemistry and Molecular Engineering, Peking University</institution> <country>Beijing, China</country></aff>
<author-notes>
<fn fn-type="edited-by"><p>Edited by: <italic>James P. O&#x2019;Gara, NUI Galway, Ireland</italic></p></fn>
<fn fn-type="edited-by"><p>Reviewed by: <italic>Guoqing Xia, University of Manchester, UK; Brian Patrick Conlon, University of North Carolina at Chapel Hill, USA; Michael Olson, Southern Illinois University School of Medicine, USA</italic></p></fn>
<fn fn-type="corresp" id="fn001"><p>&#x002A;Correspondence: <italic>Min Li, <email>ruth_limin@126.com</email></italic></p></fn>
<fn fn-type="other" id="fn002"><p><sup>&#x2020;</sup><italic>These authors have contributed equally to this work.</italic></p></fn>
<fn fn-type="other" id="fn003"><p>This article was submitted to Infectious Diseases, a section of the journal Frontiers in Microbiology</p></fn>
</author-notes>
<pub-date pub-type="epub">
<day>05</day>
<month>05</month>
<year>2017</year>
</pub-date>
<pub-date pub-type="collection">
<year>2017</year>
</pub-date>
<volume>8</volume>
<elocation-id>819</elocation-id>
<history>
<date date-type="received">
<day>23</day>
<month>02</month>
<year>2017</year>
</date>
<date date-type="accepted">
<day>21</day>
<month>04</month>
<year>2017</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#x00A9; 2017 Dai, Wang, Liu, Gao, Lu, Meng, Qin, Hu and Li.</copyright-statement>
<copyright-year>2017</copyright-year>
<copyright-holder>Dai, Wang, Liu, Gao, Lu, Meng, Qin, Hu and Li</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/"><p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p></license>
</permissions>
<abstract>
<p>The ESAT-6 secretion system (ESS) has been reported to contribute to the virulence and pathogenicity of several <italic>Staphylococcus aureus</italic> strains such as USA300 and Newman. However, the role of the ESS in community-associated <italic>S. aureus</italic> (CA-SA) lineage ST398 in China is not well understood. By comparing the <italic>ess</italic> locus of ST398 with the published <italic>S. aureus</italic> sequence in the NCBI database, we found one gene in the <italic>ess</italic> locus encoding a novel WXG superfamily protein that is highly conserved only in ST398. LC-MS/MS and Western blot analysis revealed that this protein is a novel secreted protein controlled by the ST398 ESS, and we named the protein EsxX. Although EsxX was not under the control of the accessory gene regulator like many other virulence factors and had no influence on several phenotypes of ST398, such as growth, hemolysis, and biofilm formation, it showed important impacts on immune evasion and virulence in ST398. An <italic>esxX</italic> deletion mutant led to significantly reduced resistance to neutrophil killing and decreased virulence in murine skin and blood infection models, indicating its essential contribution to the evasion of innate host defense and virulence to support the pathogenesis of ST398 infections. The function of this novel secreted protein EsxX might help us better understand the role of the ESS in the virulence and epidemic success of the CA-SA lineage ST398.</p>
</abstract>
<kwd-group>
<kwd>community-associated <italic>Staphylococcus aureus</italic></kwd>
<kwd>ESAT-6 secretion system</kwd>
<kwd>secreted protein</kwd>
<kwd>EsxX</kwd>
<kwd>immune evasion</kwd>
<kwd>virulence</kwd>
</kwd-group>
<counts>
<fig-count count="6"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="45"/>
<page-count count="13"/>
<word-count count="0"/>
</counts>
</article-meta>
</front>
<body>
<sec><title>Introduction</title>
<p><italic>Staphylococcus aureus</italic> is an important pathogen that causes a broad range of infections, including the majority of skin and soft tissue infections (SSTIs) and some life-threatening infections such as necrotizing pneumonia and fatal endocarditis (<xref ref-type="bibr" rid="B24">Lowy, 1998</xref>; <xref ref-type="bibr" rid="B30">Schijffelen et al., 2010</xref>). During infection, <italic>S. aureus</italic> expresses a wide array of secreted virulence factors to invade hosts and evade immune responses (<xref ref-type="bibr" rid="B16">Foster, 2009</xref>; <xref ref-type="bibr" rid="B14">Edwards and Massey, 2011</xref>; <xref ref-type="bibr" rid="B34">Spaan et al., 2013</xref>). Those virulence factors require secretion systems to translocate across the membrane.</p>
<p>A specialized ESAT-6 secretion system (ESS), similar to the type VII secretion system (T7SS) described in <italic>Mycobacterium tuberculosis</italic>, has been discovered in <italic>S. aureus</italic> (<xref ref-type="bibr" rid="B8">Burts et al., 2005</xref>). There are two homologous secretion factors of the <italic>M. tuberculosis</italic> T7SS effectors ESAT-6 and CFP-10, in the ESS of <italic>S. aureus</italic>, named EsxA and EsxB. It is reported that <italic>esxA</italic> and <italic>esxB</italic> deletion mutants resulted in decreased murine abscess formation by <italic>S. aureus</italic> (<xref ref-type="bibr" rid="B8">Burts et al., 2005</xref>). Other ESS substrates were reported subsequently, such as the proteins EsxC and EsxD. EsxC was shown to contribute to persistent infections (<xref ref-type="bibr" rid="B7">Burts et al., 2008</xref>), and EsxD was involved in the secretion of substrates (<xref ref-type="bibr" rid="B1">Anderson et al., 2013</xref>). A study indicated that EsxA and EsxB are involved in the modulation of apoptosis and release of ingested <italic>S. aureus</italic> from epithelial cells (<xref ref-type="bibr" rid="B19">Korea et al., 2014</xref>), focusing on the mechanistic function of secreted ESS substrates in pathogenesis. In addition, recent studies have revealed three new ESS components, EssD, EssE, and EssI, which contribute to the host immune response during infections (<xref ref-type="bibr" rid="B3">Anderson et al., 2017</xref>; <xref ref-type="bibr" rid="B26">Ohr et al., 2017</xref>). The majority of studies regarding ESS function were performed in USA300 and Newman (<xref ref-type="bibr" rid="B8">Burts et al., 2005</xref>, <xref ref-type="bibr" rid="B7">2008</xref>; <xref ref-type="bibr" rid="B2">Anderson et al., 2011</xref>, <xref ref-type="bibr" rid="B1">2013</xref>; <xref ref-type="bibr" rid="B18">Kneuper et al., 2014</xref>), two epidemic strains of community-associated <italic>S. aureus</italic> (CA-SA) in America. A few other strains were described, including RN6390, COL, SA113 (<xref ref-type="bibr" rid="B18">Kneuper et al., 2014</xref>), which belong to the same multi-locus sequence type (MLST) clonal complex (CC) as USA300 and Newman (CC8). However, there are strain-dependent differences in the <italic>ess</italic> locus among a broad range of <italic>S. aureus</italic> strains of different CC or sequence types, showing unexpected genetic diversity, which indicates that there might be strain-specific substrates and functions (<xref ref-type="bibr" rid="B39">Warne et al., 2016</xref>).</p>
<p><italic>Staphylococcus aureus</italic> lineage ST398 was previously considered to be livestock-associated (LA) and has been reported in European countries and North America (<xref ref-type="bibr" rid="B35">Voss et al., 2005</xref>; <xref ref-type="bibr" rid="B41">Witte et al., 2007</xref>; <xref ref-type="bibr" rid="B32">Smith et al., 2009</xref>; <xref ref-type="bibr" rid="B33">Smith and Pearson, 2011</xref>; <xref ref-type="bibr" rid="B40">Wassenberg et al., 2011</xref>). However, the emergence of ST398 methicillin-sensitive <italic>S. aureus</italic> (MSSA) in community households in northern Manhattan has been observed (<xref ref-type="bibr" rid="B5">Bhat et al., 2009</xref>), independent of animal contact. Additionally, there has been a fatal infection caused by ST398 reported in Japan, and the isolate is not likely to be associated with livestock (<xref ref-type="bibr" rid="B20">Koyama et al., 2015</xref>). Additionally, an epidemiological study in China indicates that lineage ST398 could be CA-SA rather than LA-SA (<xref ref-type="bibr" rid="B9">Chao et al., 2014</xref>). The extraordinary virulence of CA-SA allows these strains to infect healthy individuals and spread easily from person to person. Therefore, the emerging CA-SA lineage ST398 requires more consideration. However, the molecular underpinnings of the virulence characteristics and epidemiological success of this CA-SA lineage remain poorly understood.</p>
<p>Recently, one of our studies showed that the prevalence of the CA-SA ST398 is increasing in China, and we have reported the contribution of the ESS to the virulence of the emerging CA-SA lineage for the first time (<xref ref-type="bibr" rid="B38">Wang et al., 2016</xref>). Compared with USA300 and Newman, our knowledge regarding the structure and function of the ESS of ST398 is still limited. The role of the ESS in ST398 needs further investigation, which would help us better understand the virulence and epidemiological success of this CA-SA lineage.</p>
<p>In the present study, we compared the <italic>ess</italic> locus between ST398 with the published <italic>S. aureus</italic> sequence in the NCBI database and found one gene that is highly conserved in <italic>S. aureus</italic> lineage ST398. This gene is located downstream of <italic>esxB</italic>, and its encoded protein has a unique LXG domain belonging to the WXG superfamily. We determined that the secretion of this protein is controlled by ESS, identified its subcellular localization, and named the protein EsxX. The role of EsxX has been studied by comparing ST398 wild type and an isogenic deletion mutant using <italic>in vitro</italic> and <italic>in vivo</italic> experiments. According to our results, this novel secreted protein EsxX did not impact the secretion of EsxA or EsxB. It was not under the control of accessory gene regulator (<italic>agr</italic>) and did not influence the growth, hemolysis, or biofilm formation of ST398. However, we demonstrated that EsxX promoted neutrophil lysis and contributed to the evasion of elimination by human neutrophils, indicating that the protein has the potential to interfere with innate defense. Furthermore, in experimental skin and blood infections, EsxX showed a significant contribution to the virulence and pathogenicity of ST398.</p>
</sec>
<sec id="s1" sec-type="materials|methods">
<title>Materials and Methods</title>
<sec><title>Ethics Statement</title>
<p>All animal experiments were carried out in accordance with the Guide for the Care and Use of Laboratory Animals of the Chinese Association for Laboratory Animal Sciences (CALAS) and the protocol was approved by the ethics committee of Renji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai, China. Human heparinized venous blood was obtained from healthy individuals in accordance with a protocol approved by the ethics committee of Renji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai, China. All individuals gave written informed consent in accordance with the Declaration of Helsinki prior to donating blood.</p>
</sec>
<sec><title>Bacterial Strains, Plasmids, Oligonucleotides, and Growth Conditions</title>
<p>Clinical <italic>S. aureus</italic> isolates were obtained from a comprehensive teaching hospital in Shanghai, China (Renji Hospital, School of Medicine, Shanghai Jiao Tong University). Bacteria were identified as staphylococci by classic microbiological methods, including Gram staining, catalase and coagulase activity on rabbit plasma. <italic>S. aureus</italic> strains were further categorized by VITEK2 automated systems (BioM&#x00E9;rieux, France). CA-SA was defined as previously described (<xref ref-type="bibr" rid="B22">Li et al., 2016</xref>). Isolates were obtained either from an outpatient or from an inpatient &#x003C;24 h after hospital admission and lacked the following risk factors: contact with the hospital environment in the preceding 6 months, residence in a long-term care facility in the preceding 12 months, <italic>S. aureus</italic> infection in the preceding 12 months, and presence of a central vascular catheter at the time of infection. All bacterial strains and plasmids used in this study are listed in <bold>Table <xref ref-type="table" rid="T1">1</xref></bold>. <italic>S. aureus</italic> was grown in tryptic soy broth (TSB; Oxoid) with 0.25% glucose or on agar plates at 37&#x00B0;C, and <italic>Escherichia coli</italic> was routinely grown in Luria-Bertani medium (LB; Oxoid). When necessary, antibiotics were used at the following concentrations: ampicillin, 100 &#x03BC;g/ml; chloramphenicol, 10 &#x03BC;g/ml. All oligonucleotides used in this study are listed in <bold>Table <xref ref-type="table" rid="T2">2</xref></bold>.</p>
<table-wrap position="float" id="T1">
<label>Table 1</label>
<caption><p>Bacterial strains and plasmids used in this study.</p></caption>
<table cellspacing="5" cellpadding="5" frame="hsides" rules="groups">
<thead>
<tr>
<th valign="top" align="left">Strains/plasmids</th>
<th valign="top" align="left">Relevant genotype and property</th>
<th valign="top" align="left">Source</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left" colspan="3"><bold><italic>S. aureus</italic></bold></td>
</tr>
<tr>
<td valign="top" align="left">RN4220</td>
<td valign="top" align="left">derived from NCTC8325-4;r-m+</td>
<td valign="top" align="left"><xref ref-type="bibr" rid="B11">de Azavedo et al., 1985</xref></td>
</tr>
<tr>
<td valign="top" align="left">RJ-ST398</td>
<td valign="top" align="left">CA-SA clinical isolate</td>
<td valign="top" align="left"><xref ref-type="bibr" rid="B38">Wang et al., 2016</xref></td>
</tr>
<tr>
<td valign="top" align="left">RJ-ST398&#x0394; <italic>essB</italic></td>
<td valign="top" align="left">RJ-ST398 <italic>essB</italic> mutant</td>
<td valign="top" align="left"><xref ref-type="bibr" rid="B38">Wang et al., 2016</xref></td>
</tr>
<tr>
<td valign="top" align="left">RJ-ST398&#x0394;<italic>esxX</italic></td>
<td valign="top" align="left">RJ-ST398 <italic>esxX</italic> mutant</td>
<td valign="top" align="left">This study</td>
</tr>
<tr>
<td valign="top" align="left">RJ-ST398&#x0394;<italic>esxX</italic>(pOS1<italic>esxX</italic>)</td>
<td valign="top" align="left">RJ-ST398 <italic>esxX</italic> mutant with pOS1- <italic>esxX</italic></td>
<td valign="top" align="left">This study</td>
</tr>
<tr>
<td valign="top" align="left">RJ-ST398&#x0394;<italic>esxX</italic>(pOS1)</td>
<td valign="top" align="left">RJ-ST398 <italic>esxX</italic> mutant with pOS1</td>
<td valign="top" align="left">This study</td>
</tr>
<tr>
<td valign="top" align="left">RJ-ST398&#x0394; <italic>agr</italic></td>
<td valign="top" align="left">RJ-ST398 <italic>agr</italic> mutant</td>
<td valign="top" align="left"><xref ref-type="bibr" rid="B38">Wang et al., 2016</xref></td>
</tr>
<tr>
<td valign="top" align="left" colspan="3"><bold><italic>E. coli</italic></bold></td>
</tr>
<tr>
<td valign="top" align="left">DH5&#x03B1;</td>
<td valign="top" align="left"><italic>endA</italic>1 <italic>recA</italic>1 <italic>gyrA</italic>96 <italic>thi-1 hsdR</italic>17(rK-mK+) <italic>relA</italic>1 <italic>supE</italic>44 (<italic>lacZYA-argF</italic>)U169 F-80d<italic>lac</italic>ZM15 <italic>deoR phoA</italic></td>
<td valign="top" align="left">Invitrogen</td>
</tr>
<tr>
<td valign="top" align="left">BL21</td>
<td valign="top" align="left"><italic>E. coli B F- dcm ompT hsdS</italic>(rB- mB-) gal For recombinant protein production</td>
<td valign="top" align="left">Amersham Biosciences</td>
</tr>
<tr>
<td valign="top" align="left" colspan="3"><bold><italic>Plasmids</italic></bold></td>
</tr>
<tr>
<td valign="top" align="left">pKOR1</td>
<td valign="top" align="left">cmR and ampR, temperature-sensitive vector for allelic replacement via lambda recombination and <italic>ccdB</italic> selection</td>
<td valign="top" align="left"><xref ref-type="bibr" rid="B4">Bae and Schneewind, 2006</xref></td>
</tr>
<tr>
<td valign="top" align="left">pKOR1&#x0394;<italic>esxX</italic></td>
<td valign="top" align="left">Vector for allelic replacement of <italic>esxX</italic> in <italic>S. aureus</italic></td>
<td valign="top" align="left">This study</td>
</tr>
<tr>
<td valign="top" align="left">pOS1</td>
<td valign="top" align="left"><italic>E. coli/Staphylococcus</italic> shuttle cloning plasmid, cmR, ampR</td>
<td valign="top" align="left"><xref ref-type="bibr" rid="B6">Bubeck Wardenburg et al., 2006</xref></td>
</tr>
<tr>
<td valign="top" align="left">pOS1<italic>esxX</italic></td>
<td valign="top" align="left">pOS1 with insertion of <italic>esxX</italic> gene</td>
<td valign="top" align="left">This study</td>
</tr>
<tr>
<td valign="top" align="left"></td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap position="float" id="T2">
<label>Table 2</label>
<caption><p>Oligonucleotides used in this study.</p></caption>
<table cellspacing="5" cellpadding="5" frame="hsides" rules="groups">
<thead>
<tr>
<th valign="top" align="left">Oligonucleotide</th>
<th valign="top" align="left">Sequence</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left"><bold><italic>Oligonucleotides for isogenic deletion mutants</italic></bold></td>
<td valign="top" align="left"></td>
</tr>
<tr>
<td valign="top" align="left">esxX-att1</td>
<td valign="top" align="left">ggggacaagtttgtacaaaaaagcaggctgatggtatgagtaaacttaagga</td>
</tr>
<tr>
<td valign="top" align="left">esxX-rev1</td>
<td valign="top" align="left">tttatactcctttactcttttat</td>
</tr>
<tr>
<td valign="top" align="left">esxX-rev2</td>
<td valign="top" align="left">aagagtaaaggagtataaaaaggagatttaaaatgaataat</td>
</tr>
<tr>
<td valign="top" align="left">esxX-att2</td>
<td valign="top" align="left">gggg accactttgtacaagaaagctgggtggtaaaagggcaattgaagg</td>
</tr>
<tr>
<td valign="top" align="left"><bold><italic>Oligonucleotides for genetic complementation</italic></bold></td>
<td valign="top" align="left"></td>
</tr>
<tr>
<td valign="top" align="left">EsxX- Sma1-F</td>
<td valign="top" align="left">gagcccgggatggggaataaaataaaaatgtcag</td>
</tr>
<tr>
<td valign="top" align="left">EsxX-BamH1-flag-R</td>
<td valign="top" align="left">gagggatccttacttatcgtcgtcatccttgtaatcaaatacattgcttaacgtttt</td>
</tr>
<tr>
<td valign="top" align="left"><bold><italic>Oligonucleotides for qRT- PCR</italic></bold></td>
<td valign="top" align="left"></td>
</tr>
<tr>
<td valign="top" align="left">gyrB-F</td>
<td valign="top" align="left">caaatgatcacagcatttggtacag</td>
</tr>
<tr>
<td valign="top" align="left">gyrB-R</td>
<td valign="top" align="left">cggcatcagtcataatgacgat</td>
</tr>
<tr>
<td valign="top" align="left">esxX-F</td>
<td valign="top" align="left">caactggtacggcaatcggt</td>
</tr>
<tr>
<td valign="top" align="left">esxX-R</td>
<td valign="top" align="left">tgacttgccaccaacaatctt</td>
</tr>
<tr>
<td valign="top" align="left"><bold><italic>Oligonucleotides for construction and purification of His-tagged fusion protein</italic></bold></td>
<td valign="top" align="left"></td>
</tr>
<tr>
<td valign="top" align="left">EsxX-EcoR1-F</td>
<td valign="top" align="left">gaggaattcatggggaataaaataaaaatgtcag</td>
</tr>
<tr>
<td valign="top" align="left">EsxX-BamH1-R</td>
<td valign="top" align="left">Gagggatccttaaaatacattgcttaacgtttt</td>
</tr>
<tr>
<td valign="top" align="left"></td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec><title>Molecular Typing</title>
<p>Multi-locus sequence typing (MLST) was performed as previously described (<xref ref-type="bibr" rid="B15">Enright et al., 2000</xref>). PCR amplicons of seven <italic>S. aureus</italic> housekeeping genes (<italic>arcC</italic>, <italic>aroE</italic>, <italic>glpF</italic>, <italic>gmk</italic>, <italic>pta</italic>, <italic>tpi</italic>, <italic>and yqiL</italic>) were obtained from chromosomal DNA. The sequences of the PCR products were compared with the existing sequences available at the MLST website<sup><xref ref-type="fn" rid="fn01">1</xref></sup>.</p>
</sec>
<sec><title>Sequence Alignment and Conservation Analysis</title>
<p>Sequence alignment of <italic>esxX</italic> gene among clinical <italic>S. aureus</italic> ST398 isolates was performed using MEGA software. The <italic>esxX</italic> gene sequence was used for BLAST in the NCBI database. The amino acid sequence alignment of EsxX both from clinical isolates and the NCBI database were analyzed by GENEDOC software.</p>
</sec>
<sec><title>Mass Spectrometric Analysis</title>
<p>Bacteria were grown to an OD<sub>600</sub> of 5.0, and filtrates of the cultures were precipitated with 10% trichloroacetic acid (TCA and washed 3 times with ice-cold acetone. The samples were then resuspended in sample buffer (50 mM Tris-HCl pH 8.0, 4% SDS) and then mixed with protein loading buffer and boiled for 10 min. A 12% SDS-PAGE was used to pre-fractionate the secreted proteins and then the protein samples were subjected to in-gel digestion. Finally, the extracted peptides were vacuum-dried prior to LC-MS/MS analysis on a nanoflow liquid chromatography instrument (EASY-nLC 1000, Thermo Scientific) coupled to an ion trap mass spectrometer (LTQ Velos Pro, Thermo Scientific) in the data-dependent mode. The detailed LC-MS/MS settings for this procedure have been described previously (<xref ref-type="bibr" rid="B17">Hu et al., 2014</xref>).</p>
</sec>
<sec><title>Allelic Gene Replacement by Homologous Recombination and Genetic Complementation</title>
<p>For gene deletion in CA-SA ST398, a representative clinical isolate (RJ-ST398) was chosen; this isolate was recovered from an abscess of a patient with a skin infection (<xref ref-type="bibr" rid="B38">Wang et al., 2016</xref>). The homologous recombination procedure using the plasmid pKOR1 was performed as described (<xref ref-type="bibr" rid="B4">Bae and Schneewind, 2006</xref>). DNA fragments for the upstream and downstream sequences of <italic>esxX</italic> were PCR amplified from the chromosomal DNA of RJ-ST398, and overlap PCR was used to obtain a fused PCR product. This product was cloned into pKOR1 using a Clonase reaction and <italic>attB</italic> sites, yielding the plasmid pKOR1&#x0394;<italic>esxX</italic>. The plasmid pKOR1&#x0394;<italic>esxX</italic> was transferred via electroporation into <italic>S. aureus</italic> RN4220 and then into RJ-ST398. The allelic replacement procedure was performed as described by others (<xref ref-type="bibr" rid="B36">Vuong et al., 2003</xref>). Proper integration was verified by PCR amplification from genomic DNA using <italic>esxX</italic>-att1 and <italic>esxX</italic>-att2 primers and sequencing of the PCR product. For genetic complementation, the <italic>esxX</italic> gene was amplified by PCR with the primers <italic>esxX</italic>-SmaI-F and <italic>esxX</italic>-BamHI-flag-R. The <italic>esxX</italic> complementation plasmid was generated by cloning the <italic>esxX</italic> gene into vector pOS1 and was then transferred into RJ-ST398. The plasmid control strain was obtained by transferring the pOS1 plasmid into RJ-ST398.</p>
</sec>
<sec><title>Staphylococcal Fractionation</title>
<p>Overnight cultures were diluted 1:100 into 10 ml of TSB and incubated at 37&#x00B0;C with shaking at 200 rpm until they had grown to an OD<sub>600</sub> of 2.0 (mid-exponential growth phase), and 1.5 ml of culture was centrifuged at 10,000 &#x00D7; <italic>g</italic> for 4 min to separate the cells from the supernatant. Proteins in 1 ml of supernatant were precipitated with 10% TCA using 3 ice-cold acetone washes and then resuspended in sample buffer (50 mM Tris-HCl pH 8.0, 4% SDS). The cells were resuspended in 80 &#x03BC;l of TE buffer (10 mM Tris-HCl, 1mM EDTA, pH 8.0). Lysostaphin (100 &#x03BC;g/ml) was added for a 10 &#x03BC;g/ml final concentration, and the samples were incubated for 30 min at 37&#x00B0;C. Supernatant (S) and cell lysate (CL) samples were both mixed with protein loading buffer and boiled for 10 min. For subcellular localization, 2 ml cultures were centrifuged as described above, and the supernatants were precipitated with TCA. The cell pellet of a 2 ml culture were was with TSM buffer, and then suspended in 500 &#x03BC;l of TSM buffer containing 10 &#x03BC;l of lysostaphin (2 mg/ml stock) and incubated at 37&#x00B0;C for 30 min. The protoplasts were collected by centrifugation at 10,000 &#x00D7; <italic>g</italic> for 10 min, and the cell wall fraction (W) was precipitated with TCA. Protoplasts were suspended in 5ml of membrane buffer (0.1 M Tris-HCl, 0.1 M NaCl, pH 7.5, 0.01 M MgCl<sub>2</sub>) and sonicated on ice at full power for 10 s. Soluble proteins (C, cytoplasmic fraction) were separated from insoluble materials and membranes (M, membrane fraction) by ultracentrifugation at 45k rpm for 30 min, at 4&#x00B0;C. All samples were precipitated with TCA before Western blotting.</p>
</sec>
<sec><title>Western Blot Analysis</title>
<p>Equal volumes (10 &#x03BC;l) of all proteins of interest were separated by SDS-PAGE and transferred onto nitrocellulose membranes (Invitrogen). After blocking, the membranes were incubated with specific antiserum at 4&#x00B0;C overnight and then incubated with a horseradish peroxidase-conjugated secondary antibody at room temperature for 1 h. Images of Western blots were acquired using a Tanon-5200 system. In total, eight specific antibodies were used for Western blot analysis in this study, including &#x03B1;-EsxX, &#x03B1;-EsxA, &#x03B1;-EsxB (generated by GLBiochem, China); &#x03B1;-SrtA, &#x03B1;-SeaS, and &#x03B1;-SeaR (kindly provided by Taeok Bae, Indiana University School of Medicine-Northwest, Gary, Indiana); &#x03B1;-Hla (Abcam) and &#x03B1;-Spa (Sigma-Aldrich).</p>
</sec>
<sec><title>Quantitative Reverse-Transcription (RT) PCR</title>
<p>Complementary DNA (cDNA) was synthesized from total RNA using the QuantiTect RT system (Qiagen) according to the manufacturer&#x2019;s instructions. Oligonucleotide primers were designed using Primer Express (<bold>Table <xref ref-type="table" rid="T2">2</xref></bold>). The resulting complementary DNA and negative control samples were amplified using the QuantiTect SYBR green PCR kit (Qiagen). Reactions were performed in a MicroAmp Optical 96-well reaction plate using a 7500 Sequence Detector (Applied Biosystems). Standard curves were determined for each gene using purified chromosomal DNA at concentrations of 0.005&#x2013;50 ng/ml. All quantitative reverse-transcription polymerase chain reaction (qRT-PCR) experiments were performed in duplicate with <italic>gyrB</italic> as an internal control.</p>
</sec>
<sec><title>Analysis of Hemolytic Capacity</title>
<p>Strains were grown to the mid-exponential growth phase (4 h), and equal amounts (2 &#x03BC;l) of cells were spotted on sheep blood agar plates. After incubation at 37&#x00B0;C for 24 h, the zones of hemolysis (diameter) were measured.</p>
</sec>
<sec><title>Semiquantitative Biofilm Assay</title>
<p>Semiquantitative biofilm assays were performed as described previously (<xref ref-type="bibr" rid="B36">Vuong et al., 2003</xref>). Cells were fixed by Bouin&#x2019;s fixative. The fixative was removed after 1 h incubation, and wells were washed with phosphate-buffered saline (PBS). Organisms in the wells were then stained with crystal violet, and the floating stain was washed off with slow-running water. After drying, the stained biofilm was scanned with a Micro ELISA autoreader (BioRad) at 570 nm.</p>
</sec>
<sec><title>Neutrophil Lysis and Bacterial Survival Assays</title>
<p>Human neutrophils were isolated from heparinized venous blood of healthy individuals with a standard method. Bacteria were grown to the mid-exponential growth phase and incubated with neutrophils at a 10:1 ratio (MOI 10) at 37&#x00B0;C for 3h. PBS with 0.1% Triton-X100 (100 &#x03BC;l) was used to determine 100% lysis. Lysis was measured using a lactate dehydrogenase (LDH) cytotoxicity detection kit (Roche) according to the manufacturer&#x2019;s protocol as described elsewhere (<xref ref-type="bibr" rid="B21">Li et al., 2012</xref>). To determine bacteria survival rates, 100 &#x03BC;l of the culture above was serially diluted and plated on TSA containing 5% sheep blood for <italic>S. aureus</italic> colony forming units (CFU) counting.</p>
<p>For microscopic evaluation of neutrophil killing after phagocytosis and intracellular <italic>S. aureus</italic> counting, overnight cultures were diluted 1:100 into 10 ml of TSB and incubated at 37&#x00B0;C with shaking at 200 rpm to the mid-logarithmic growth phase (4 h). The cells were washed and resuspended in sterile PBS at a concentration of 1 &#x00D7; 10<sup>10</sup> CFU/ml. <italic>S. aureus</italic> cells were mixed with heparinized venous blood at a ratio of blood/bacterial solution of 10:1 (v/v) and incubated at 37&#x00B0;C. After the indicated times of incubation, blood smears were prepared and cells were stained with a modified Wright-Giemsa stain. The number of neutrophils lysed by <italic>S. aureus</italic> among the total number of neutrophils that had ingested <italic>S. aureus</italic> (<italic>n</italic> = 100 analyzed) was calculated by microscopic examination at 30 min after incubation. The number of intracellular <italic>S. aureus</italic> after 30 min of infection was counted using 20 neutrophils per group.</p>
</sec>
<sec><title>Mouse Skin Abscess and Bacteremia Models</title>
<p>The skin abscess model was performed as described elsewhere (<xref ref-type="bibr" rid="B37">Wang et al., 2007</xref>). Outbred, immunocompetent hairless female mice between 4 and 6 weeks of age were used for the experiments. Anesthetized mice were inoculated subcutaneously on the back with 100 &#x03BC;l of PBS containing 10<sup>7</sup> CFU of live <italic>S. aureus</italic> or an equal volume of PBS alone. The next day, abscess length (L) and width (W) values were measured to calculate the area of abscesses with the formula area (A) = &#x03C0; (L &#x00D7; W)/2. The abscess skin tissue was excised, washed with saline, and fixed in 4% formalin (Sigma-Aldrich). Paraffin embedding and hematoxylin and eosin (H&#x0026;E) staining were performed.</p>
<p>For the bacteremia model, BALB/c female mice between 4 and 6 weeks of age were used. <italic>S. aureus</italic> strains were grown to mid-logarithmic phase, washed once with sterile PBS and then suspended in PBS. Each mouse of one group was injected with 100 &#x03BC;l of PBS containing 10<sup>8</sup> CFU of live <italic>S. aureus</italic> into the retro-orbital vein, and another group was injected with 100 &#x03BC;l of PBS containing 10<sup>9</sup> CFU of each for survival analysis. Control animals received sterile PBS only. After inoculation, the health of the mice and the advancement of their disease state were monitored every day. The mice were euthanized immediately if they showed signs of respiratory distress, mobility loss or inability to eat and drink. The surviving mice injected with 10<sup>8</sup> CFU were euthanized 4 days after injection. Kidneys were excised, washed with saline, and one kidney was fixed in 4% formalin (Sigma-Aldrich). Paraffin embedding and hematoxylin and eosin (H&#x0026;E) staining were performed. The other kidney was homogenized in 0.5 ml of PBS, and the homogenized kidney tissue was diluted and plated on TSB agar for the determination of CFU numbers. All surviving mice injected with 10<sup>9</sup> CFU were euthanized at 5 days.</p>
</sec>
<sec><title>Statistics</title>
<p>Statistical analysis was performed using Graph Pad Prism, version 6.01. The data were analyzed using unpaired <italic>t</italic>-tests to compare two different conditions. All error bars show the standard error of the mean (SEM).</p>
</sec>
</sec>
<sec><title>Results</title>
<sec><title>A Novel Protein EsxX with Secretion Potential Is Highly Conserved in ST398</title>
<p>The <italic>ess</italic> locus of USA300 or Newman has been well characterized. There are six core genes from <italic>esxA</italic> to <italic>essC</italic> and several other genes of the system (<bold>Figure <xref ref-type="fig" rid="F1">1A</xref></bold>), in which the EsaA, EssA, EssB, and EssC proteins are membrane-located components of the secretion machinery, EsaB is a regulator, and EsxA, EsxB, EsxC, and EsxD are exported effector proteins (<xref ref-type="bibr" rid="B8">Burts et al., 2005</xref>, <xref ref-type="bibr" rid="B7">2008</xref>; <xref ref-type="bibr" rid="B2">Anderson et al., 2011</xref>; <xref ref-type="bibr" rid="B18">Kneuper et al., 2014</xref>); three additional components of the ESS pathway, EssE, EssD, and EssI, were recently identified (<xref ref-type="bibr" rid="B3">Anderson et al., 2017</xref>; <xref ref-type="bibr" rid="B26">Ohr et al., 2017</xref>). Compared with USA300 or Newman, the <italic>ess</italic> locus of ST398 contains the same six core genes from <italic>esxA</italic> to <italic>essC</italic>, as well as another exported effector encoded gene <italic>esxB</italic>, but the <italic>esxC</italic>, <italic>esxD</italic>, <italic>essE</italic>, <italic>essD</italic>, and <italic>essI</italic> genes are all absent; instead, there are other genes of unknown function (<bold>Figure <xref ref-type="fig" rid="F1">1A</xref></bold>). We found one gene located downstream of the <italic>esxB</italic> gene (<bold>Figure <xref ref-type="fig" rid="F1">1A</xref></bold>) that encodes a 517 amino acid protein we named EsxX. The ESS has two identified secreted virulence factors, EsxA and EsxB, both of which are members of the WXG100 superfamily. The WXG motif of EsxA and EsxB is referred to as a signature sequence of ESAT-6-like proteins that can be secreted by ESS (<xref ref-type="bibr" rid="B29">Pallen, 2002</xref>). EsxX, which also belongs to the WXG superfamily, has a unique LXG domain at the N-terminal (<bold>Figure <xref ref-type="fig" rid="F1">1B</xref></bold>; <xref ref-type="bibr" rid="B31">Schneewind and Missiakas, 2012</xref>), indicating that the protein might have secretion potential. This is consistent with a study proposing that EsxX might be secreted by the ESS (<xref ref-type="bibr" rid="B39">Warne et al., 2016</xref>). Furthermore, we performed sequence alignment of <italic>esxX</italic> among clinical <italic>S. aureus</italic> isolates and strains in the NCBI database and found that it is highly conserved in <italic>S. aureus</italic> lineage ST398. 61 isolates of <italic>S. aureus</italic> ST398 derived from infected patients and 15 isolates derived from cattle suffering from mastitis were collected in this study. Whole genome sequencing of the 76 isolates was performed, and the present study used the sequence of the <italic>esxX</italic> gene of the 76 clinical isolates for sequence alignment. According to the alignment results, 86.8% of isolates (66/76) showed 100% sequence identity, and the other 13.2% of isolates showed 99% identity, differing only by one point mutation (Supplementary Table <xref ref-type="supplementary-material" rid="SM1">1</xref>). In the NCBI BLAST database, there is no homologous protein of EsxX in USA300 or other <italic>S. aureus</italic> strains. Only one ST582 and four ST15 strains were discovered to have 96% sequence identity and they had lower scores and more gaps than the other strains belonging to ST398 which showed 100 or 99% sequence identity of <italic>esxX</italic> (Supplementary Table <xref ref-type="supplementary-material" rid="SM2">2</xref>). These findings suggest that EsxX is a clone-specific protein of ST398 that might have special functions.</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption><p><bold>Location of <italic>esxX</italic> in the CA-SA ST398 <italic>ess</italic> locus and its domain organization.</bold> <bold>(A)</bold> <italic>ess</italic> locus of USA300 and ST398. Gene and protein colors indicate FtsK-SpoIIIE domain-ATPases (yellow); secreted protein (red); transmembrane protein (green); cytoplasmic protein (white); hypothetical protein (slash pattern); protein of unknown function (gray); EssE (pink); EssI (EssD inhibitor, blue). <bold>(B)</bold> EsxA and EsxB, both members of the WXG100 superfamily. EsxX, a 517 aa protein, has an LXG domain at the N-terminal and belongs to the WXG superfamily.</p></caption>
<graphic xlink:href="fmicb-08-00819-g001.tif"/>
</fig>
</sec>
<sec><title>Secretion of EsxX Is Controlled by the ESS of ST398 and it Has No Effect on the Secretion of Other ESS-Secreted Factors</title>
<p>Our previous study confirmed that ST398 ESS is responsible for the secretion of EsxA and EsxB via LC-MS/MS analysis of ST398 wild type versus <italic>essB</italic> deletion mutant culture filtrates (<xref ref-type="bibr" rid="B38">Wang et al., 2016</xref>). It is worth mentioning that in the same LC-MS/MS analysis, EsxX was not detectable in the <italic>essB</italic> deletion mutant culture filtrate (<bold>Figure <xref ref-type="fig" rid="F2">2A</xref></bold>), indicating that its secretion is controlled by the ESS of ST398. To verify the secretion property of EsxX, we constructed an isogenic gene deletion mutant of <italic>esxX</italic> by a representative ST398 isolate selected previously (<xref ref-type="bibr" rid="B38">Wang et al., 2016</xref>). We performed a Western blot to determine whether EsxX was secreted. EsxX was detected both in the CL and the supernatant of ST398 using specific rabbit antisera (<bold>Figure <xref ref-type="fig" rid="F2">2B</xref></bold>). Sortase-A and Hla were used as controls for proteins in the CL and the supernatant, respectively. Furthermore, to examine the subcellular localization of EsxX, cultures of ST398 were separated into cytoplasmic (C), membrane (M), cell wall (W), and supernatant (S) fractions (<bold>Figure <xref ref-type="fig" rid="F2">2C</xref></bold>). Proteins in all fractions were examined by Western blotting with specific antibodies. EsxX was found predominantly in the supernatant and partially in the cytoplasm. As a control, Hla was detected in the supernatant, whereas Spa resided in both the cell wall and supernatant fraction, SaeS in the membrane, and SaeR in the cytoplasm (<bold>Figure <xref ref-type="fig" rid="F2">2C</xref></bold>). Together, these results demonstrate that EsxX is a novel secreted protein controlled by ST398 ESS. Because EsxA and EsxB are two ESS effectors that play important roles in the function of ESS, we then used Western blotting to analyze whether EsxX impacts their secretion. EsxA and EsxB were detected in the supernatant fraction of both ST398 wild type and <italic>esxX</italic> mutant bacteria at the same level (<bold>Figure <xref ref-type="fig" rid="F2">2D</xref></bold>), which suggested that the ESS was still completely functional when the <italic>esxX</italic> gene was knockout.</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption><p><bold>EsxX is a secreted protein of the ESS of ST398 and it has no effect on the secretion of other ESS-secreted factors.</bold> <bold>(A)</bold> Detection of secreted proteins from ST398 wild type and <italic>essB</italic> deletion strains by mass spectroscopy. Peaks of peptides derived from EsxX are present in wild type samples but absent in samples from the <italic>essB</italic> deletion mutant. <bold>(B)</bold> <italic>S. aureus</italic> ST398 cultures were separated into cell lysate (CL) and supernatant (S) fractions. Proteins were detected by Western blotting with specific antibodies (&#x03B1;-EsxX, &#x03B1;-SrtA, &#x03B1;-Hla). <bold>(C)</bold> <italic>S. aureus</italic> ST398 cultures were fractionated into the cytoplasmic (C), membrane (M), cell wall (CW), and supernatant (S) compartments. Proteins were detected by Western blotting with specific antibodies (&#x03B1;- EsxX, &#x03B1;-Hla, &#x03B1;-Spa, &#x03B1;-SeaS, &#x03B1;-SeaR). <bold>(D)</bold> Supernatant (S) fractions of ST398 wild type and <italic>agr</italic> mutant cultures were obtained. Proteins were detected by Western blotting with specific antibodies (&#x03B1;-EsxA, &#x03B1;-EsxB, &#x03B1;-Hla).</p></caption>
<graphic xlink:href="fmicb-08-00819-g002.tif"/>
</fig>
</sec>
<sec><title>EsxX Is Not under the Control of <italic>agr</italic> and Does Not Affect the Growth, Hemolysis or Biofilm Formation of ST398</title>
<p>EsxA and EsxB, two canonical secreted proteins of ESS, have been described as secreted virulence factors in other <italic>S. aureus</italic> strains (<xref ref-type="bibr" rid="B8">Burts et al., 2005</xref>; <xref ref-type="bibr" rid="B45">Zhou et al., 2013</xref>). Previous work had shown that the <italic>esxA</italic> and <italic>esxB</italic> genes were under <italic>agr</italic> control at a transcriptional level (<xref ref-type="bibr" rid="B38">Wang et al., 2016</xref>). Because EsxX is a novel secreted protein of ST398 ESS, we questioned whether it had similar functions to the two Esx proteins. Quantitative RT-PCR and Western blotting were used to investigate EsxA, EsxB, and EsxX expression in ST398 wild type versus <italic>agr</italic> deletion mutant (<bold>Figure <xref ref-type="fig" rid="F3">3A</xref></bold>). We found that EsxA and EsxB were <italic>agr</italic>-regulated, while EsxX was not (<bold>Figure <xref ref-type="fig" rid="F3">3B</xref></bold>). We also found that there is no difference in growth between ST398 wild type and an <italic>esxX</italic> mutant (<bold>Figure <xref ref-type="fig" rid="F3">3C</xref></bold>). To study the role of EsxX in ST398, we examined the capacity of the bacteria to induce hemolysis, one of the most important virulence phenotypes of <italic>S. aureus</italic>, but found no difference between the wild type and the <italic>esxX</italic> mutant strain (<bold>Figure <xref ref-type="fig" rid="F3">3D</xref></bold>). <italic>S. aureus</italic> has been reported to form biofilms during infection, which promotes persistence and contributes to its successful colonization, making it difficult to eliminate the infection (<xref ref-type="bibr" rid="B27">Otto, 2008</xref>). However, the EsxX had no impact on biofilm formation (<bold>Figure <xref ref-type="fig" rid="F3">3E</xref></bold>).</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption><p><bold>EsxX is not under the control of <italic>agr</italic> and the role of EsxX in <italic>S. aureus</italic> ST398 phenotypes.</bold> <bold>(A)</bold> Gene transcription of <italic>esxA</italic>, <italic>esxB</italic>, and <italic>esxX</italic> and <bold>(B)</bold> protein expression of EsxA, EsxB, and EsxX in ST398 wild type versus an <italic>agr</italic> deletion mutant as determined by qRT-PCR and Western blotting. <sup>&#x2217;&#x2217;</sup><italic>p</italic> &#x003C; 0.01; <sup>&#x2217;&#x2217;&#x2217;</sup><italic>p</italic> &#x003C; 0.001 (unpaired <italic>t</italic>-tests). <bold>(C)</bold> Growth of ST398 wild type versus the <italic>esxX</italic> mutant. <bold>(D)</bold> Zones of hemolysis (diameter) due to the wild type strain versus the <italic>esxX</italic> deletion mutant, the complemented mutant and the deletion mutant harboring a control plasmid. <bold>(E)</bold> Detection of biofilm formation in wild type strain versus the <italic>esxX</italic> deletion mutant, the complemented mutant and the deletion mutant harboring a control plasmid.</p></caption>
<graphic xlink:href="fmicb-08-00819-g003.tif"/>
</fig>
</sec>
<sec><title>EsxX Promotes Neutrophil Lysis and Contributes to Evasion of Innate Host Defense in ST398 Infections</title>
<p>Recently, EsxA was reported to play a role in the immune response to invasive <italic>S. aureus</italic> disease (<xref ref-type="bibr" rid="B42">Zhang et al., 2015</xref>) and to delay apoptosis and contribute to the release of <italic>S. aureus</italic> from epithelial cells, together with EsxB (<xref ref-type="bibr" rid="B19">Korea et al., 2014</xref>). These reports inspired us to investigate whether the novel secreted protein EsxX impacts the interaction between <italic>S. aureus</italic> and host cells. We selected neutrophils because neutrophils represent the first line of defense against a <italic>S. aureus</italic> infection. We analyzed the lysis of neutrophils and the degree of bacterial survival by incubating wild type and <italic>esxX</italic> mutant bacteria with human neutrophils. Compared with the wild type strain, the <italic>esxX</italic> mutant showed significantly decreased neutrophil lysis (<bold>Figure <xref ref-type="fig" rid="F4">4A</xref></bold>). The low bacterial survival of the <italic>esxX</italic> mutant (<bold>Figure <xref ref-type="fig" rid="F4">4B</xref></bold>) showed that the mutant was more likely to be eliminated than the wild type. Further, a microscopic analysis was performed. We examined the numbers of intracellular <italic>S. aureus</italic> after 30 min of infection, and the data showed no impact of EsxX on uptake by neutrophils (<bold>Figure <xref ref-type="fig" rid="F4">4C</xref></bold>), while the count of lysed neutrophils after ingestion (<bold>Figure <xref ref-type="fig" rid="F4">4D</xref></bold>) suggested that EsxX contributed to neutrophil lysis after phagocytosis. These results indicated that EsxX impacts the capacity of ST398 to interact with human neutrophils and thus plays an important role in the evasion of innate host defenses.</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption><p><bold>EsxX promotes neutrophil lysis and contributes to evasion of elimination by human neutrophils.</bold> <bold>(A)</bold> Neutrophil lysis. Human neutrophils were isolated from heparinized venous blood of healthy individuals. Bacteria were grown to the mid-logarithmic phase and incubated with neutrophils at a 10:1 ratio. Neutrophil lysis was determined by measuring the release of LDH. <bold>(B)</bold> Bacterial survival. Bacterial survival was measured by incubating a mixture of bacteria and neutrophils and plating for CFUs. <sup>&#x2217;&#x2217;</sup><italic>p</italic> &#x003C; 0.01; <sup>&#x2217;&#x2217;&#x2217;</sup><italic>p</italic> &#x003C; 0.001 (unpaired <italic>t</italic>-tests of the deletion mutant versus wild type strain and the complemented mutant versus the deletion mutant harboring a control plasmid). <bold>(C,D)</bold> Microscopic evaluation of neutrophil phagocytosis. Blood smears were obtained at different time points in the incubation of bacteria with neutrophils. Ingestion of bacteria and neutrophil lysis were analyzed by light microscopy using a modified Wright-Giemsa stain. <bold>(C)</bold> The numbers of intracellular <italic>S. aureus</italic>. Twenty neutrophils per group were used to examine the number of intracellular <italic>S. aureus</italic> after 30 min of infection. (<italic>P</italic> > 0.05; <bold>D)</bold> Neutrophil lysis after phagocytosis. The number of lysed neutrophils among 100 neutrophils that had ingested bacteria is shown on the right for two different donors. <sup>&#x2217;&#x2217;</sup><italic>p</italic> &#x003C; 0.01 (unpaired <italic>t</italic>-tests).</p></caption>
<graphic xlink:href="fmicb-08-00819-g004.tif"/>
</fig>
</sec>
<sec><title>EsxX Makes a Significant Contribution to Virulence of ST398 in Skin and Blood Infection</title>
<p><italic>Staphylococcus aureus</italic> causes a variety of infections, including superficial skin and soft tissues infections (SSTIs) and severe invasion infections such as bacteremia. After evaluating the impact of EsxX on the capacity of neutrophil lysis <italic>in vitro</italic>, we then explored its virulence potential <italic>in vivo</italic> using mouse skin abscess and bacteremia models. In the skin abscess model, the ST398 caused a significantly larger abscess area than the <italic>esxX</italic> mutant (<bold>Figures <xref ref-type="fig" rid="F5">5A,B</xref></bold>), and histological examinations showed greater infiltration of inflammatory cells and skin tissue destruction in the mice infected with the wild type than those infected with the <italic>esxX</italic> mutant strain (<bold>Figure <xref ref-type="fig" rid="F5">5C</xref></bold>). In a low-dose (10<sup>8</sup> CFU) bacteremia model, the kidneys of mice infected with the ST398 wild type showed increased abscess formation (<bold>Figure <xref ref-type="fig" rid="F6">6A</xref></bold>). Histological examination showed increased infiltration of inflammatory cells and tissue structure destruction in the kidneys of ST398 wild type-strain-infected mice compared with those <italic>esxX</italic> mutant-strain-infected mice (<bold>Figure <xref ref-type="fig" rid="F6">6B</xref></bold>). Furthermore, the mice infected with the wild type strain showed notably higher CFU counts in the kidneys 4 days after infection than the mice infected with the <italic>esxX</italic> mutant strain (<bold>Figure <xref ref-type="fig" rid="F6">6C</xref></bold>). In a high-dose (10<sup>9</sup> CFU) bacteremia model, the mice infected with ST398 wild type all died within 96 h, while the mice infected with the <italic>esxX</italic> mutant survived for a longer time (<bold>Figure <xref ref-type="fig" rid="F6">6D</xref></bold>); however, there was no statistical significance (<italic>P</italic> = 0.0993). The results of skin and blood infections together suggested that EsxX makes a significant contribution to the virulence of ST398.</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption><p><bold>Role of EsxX in CA-SA ST398 skin infection.</bold> Mouse abscess model comparing the ST398 wild type isolate with an isogenic <italic>esxX</italic> deletion mutant. Control animals received only sterile PBS. <bold>(A)</bold> Abscess areas on day 2 after infection. <sup>&#x2217;&#x2217;&#x2217;</sup><italic>p</italic> &#x003C; 0.001 (unpaired <italic>t</italic>-test). <bold>(B)</bold> Representative abscesses on day 2 after infection. <bold>(C)</bold> H&#x0026;E staining of abscess skin tissue harvested on day 4. Note the considerable infiltration of inflammatory cells and damage of the subcutaneous structure in the wild type and <italic>esxX</italic> mutant samples; this infiltration is noticeably stronger in the wild type sample (arrows).</p></caption>
<graphic xlink:href="fmicb-08-00819-g005.tif"/>
</fig>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption><p><bold>Role of EsxX in CA-SA ST398 bacteremia.</bold> Mouse bacteremia model comparing the ST398 wild type isolate with an isogenic <italic>esxX</italic> deletion mutant. Control animals received only sterile PBS. <bold>(A&#x2013;C)</bold> Mice (<italic>n</italic> = 8 per group) were infected with 10<sup>8</sup> CFU of <italic>S. aureus</italic> and euthanized 4 days after injection. <bold>(A)</bold> Representative macroscopic abscess formation in kidneys of mice infected with ST398 wild type and the <italic>esxX</italic> mutant strain (arrows). <bold>(B)</bold> Histological results of representative kidneys. Note pronounced infiltration of inflammatory cells and structural destruction in the wild type sample, while significantly less infiltration and damage was evident in the <italic>esxX</italic> mutant sample (arrows). <bold>(C)</bold> The number of CFUs in the kidneys was determined by plating samples on TSB agar. <sup>&#x2217;&#x2217;</sup><italic>p</italic> &#x003C; 0.01 (unpaired <italic>t</italic>-tests). <bold>(D)</bold> Survival analysis of mice (<italic>n</italic> = 8 per group) injected with 10<sup>9</sup> CFU of S. aureus or PBS. Survival curves were compared using a log-rank (Mantel-Cox) test, <italic>P</italic> = 0.0993.</p></caption>
<graphic xlink:href="fmicb-08-00819-g006.tif"/>
</fig>
</sec>
</sec>
<sec><title>Discussion</title>
<p>In recent years, an ongoing surge of CA-SA infections have gained increasing world-wide consideration (<xref ref-type="bibr" rid="B13">DeLeo et al., 2010</xref>; <xref ref-type="bibr" rid="B10">Dantes et al., 2013</xref>). Compared with traditional HA-SA, CA-SA infects otherwise healthy individuals with no predisposing risk factors or conditions, indicating that CA-SA strains have enhanced virulence. USA300, the epidemic clone of CA-MRSA in the United States, has received much attention, but data regarding CA-SA in China is limited. The CA-SA lineage ST398, not related to contact with livestock, has grown to be a considerable problem in China, as described in our earlier work. Unlike USA300, whose epidemiological success has been linked to the acquisition of factors encoded on mobile genetic elements, such as the Panton-Valentine leukocidin (PVL), the arginine catabolic mobile element (ACME), and a comparatively small methicillin resistance element, SCCmec IV (or V) (<xref ref-type="bibr" rid="B28">Otto, 2010</xref>), CA-SA ST398 is showing increased expression of genome-encoded toxins such as PSMs and &#x03B1;-toxin and increased expression of the <italic>agr</italic> global virulence regulator. In addition to these common virulence factors, studies have revealed the important role of the ESAT-6 like secretion system (ESS) in USA300 (<xref ref-type="bibr" rid="B8">Burts et al., 2005</xref>; <xref ref-type="bibr" rid="B19">Korea et al., 2014</xref>). Recently, we have also described a previously unrecognized role of the ESS in the virulence of the CA-SA ST398 (<xref ref-type="bibr" rid="B38">Wang et al., 2016</xref>). In the present study, we compared the <italic>ess</italic> locus of ST398 with the published <italic>S. aureus</italic> sequence in the NCBI database and identified a novel protein, designated EsxX. We revealed this protein as a secreted factor and investigated its important role in the innate host defense and virulence of <italic>S. aureus</italic> ST398.</p>
<p>Initially, we found <italic>esxX</italic> located downstream of <italic>esxB</italic> in the <italic>ess</italic> locus of ST398, which is different from any other genes identified at similar locations of USA300. It is highly conserved in ST398, and there are no homologous proteins in other <italic>S. aureus</italic> strains. This finding might explain why there is no previous research about the function of EsxX, because the virulent CA-SA lineage ST398 was discovered only within the last few years. EsxA and EsxB, the two most studied ESS substrates, are both members of the WXG100 protein superfamily, which features a conserved &#x201C;Trp-Xaa-Gly (WXG)&#x201D; motif (<xref ref-type="bibr" rid="B29">Pallen, 2002</xref>). EsxX, which also belongs to the WXG protein family, has a unique LXG domain at the N-terminal. It is reported that the LXG domain is comparable to the WXG/ESAT-6 domains (<xref ref-type="bibr" rid="B44">Zhang et al., 2011</xref>), and they are both classified as signature N-terminal or pre-toxin-domains of the T7SS/ESS (<xref ref-type="bibr" rid="B43">Zhang et al., 2012</xref>), indicating that EsxX might be a substrate of ESS, similar to EsxA and EsxB. Furthermore, our data from the LC-MS/MS analysis and Western blots demonstrated that the secretion of EsxX is controlled by the ESS of ST398, and its subcellular localization also supported our hypothesis. In addition, EsxX has no effect on the secretion of EsxA and EsxB, suggesting that it might play a role independently. There are many secreted virulence factors that are <italic>agr</italic>-regulated, including EsxA and EsxB. Although EsxX could contribute to virulence, it is not under <italic>agr</italic> control, and this feature may be due to its strain specificity. Unlike EsxA and EsxB, which play roles in many <italic>S. aureus</italic> strains, EsxX is conserved in ST398, meaning that its role could be clone-dependent and does not require the engagement of the <italic>agr</italic> global virulence regulator.</p>
<p>Community-associated <italic>S. aureus</italic> ST398 showed enhanced virulence that promoted pathogenicity, and it was able to spread easily because of its poor biofilm formation. Although EsxX did not influence the growth, hemolysis, or biofilm formation of ST398, the observation of neutrophil killing and bacterial survival revealed that EsxX promoted neutrophil destruction and contributed to evasion of elimination by neutrophils. The microscopic analysis also showed the impact of EsxX on neutrophil lysis after phagocytosis. These findings suggested that EsxX plays an important role in resisting human innate defenses. Moreover, experimental murine skin and blood infection models showed EsxX to be a substantial contributor to both SSTIs and invasion infections. The significant influence of EsxX on virulence indicated that EsxX might have the potential to be a new virulence factor of ST398.</p>
<p>Our study demonstrated that EsxX is a novel secreted protein of ST398 ESS. EsxX is highly conserved and plays an important role in innate host defense and virulence in this epidemic CA-SA clone. However, the secretion mechanism of EsxX and how it interacts with host cells remain unclear. Pore-forming toxins contribute to bacterial pathogenicity by forming pores and/or disrupting host cell membranes (<xref ref-type="bibr" rid="B23">Los et al., 2013</xref>). Studies have shown that the ESAT-6 of <italic>M. tuberculosis</italic> has membrane-lytic and pore-forming activity (<xref ref-type="bibr" rid="B12">De Leon et al., 2012</xref>; <xref ref-type="bibr" rid="B25">Ma et al., 2015</xref>). However, no similar evidence regarding EsxA or EsxB in <italic>S. aureus</italic> has been reported thus far. It appears that the C-terminal domain (334&#x2013;481) of EsxX shares structural homology with <italic>E. coli</italic> Colicin IA (PDB 1cii_A). Might it have pore-forming potential? Does the C-terminal domain of EsxX play a role in neutrophil lysis? Much work remains. Further investigation of this novel secreted protein might help us better understand the role of the ESS in ST398 and its contribution to the evolution of this virulent CA-SA lineage.</p>
</sec>
<sec><title>Author Contributions</title>
<p>YD, YW, QL, QG, HL, HM, JQ, and MH conducted experiments. ML planned, supervised experiments, YD and ML wrote the paper.</p>
</sec>
<sec><title>Conflict of Interest Statement</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
</body>
<back>
<ack>
<p>This study was supported by the National Natural Science Foundation of China (grants 81671975 and 81371875), the Shanghai Committee of Science and Technology, China (grant 15411960500), and the Foundation for Innovative Research Groups of the National Natural Science Foundation of China (grant 81421001).</p>
</ack>
<sec sec-type="supplementary material">
<title>Supplementary Material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="http://journal.frontiersin.org/article/10.3389/fmicb.2017.00819/full#supplementary-material">http://journal.frontiersin.org/article/10.3389/fmicb.2017.00819/full#supplementary-material</ext-link></p>
<supplementary-material xlink:href="Table_1.DOCX" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document" xmlns:xlink="http://www.w3.org/1999/xlink">
</supplementary-material>
<supplementary-material xlink:href="Table_2.DOCX" id="SM2" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document" xmlns:xlink="http://www.w3.org/1999/xlink">
</supplementary-material>
</sec>
<ref-list>
<title>References</title>
<ref id="B1"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Anderson</surname> <given-names>M.</given-names></name> <name><surname>Aly</surname> <given-names>K. A.</given-names></name> <name><surname>Chen</surname> <given-names>Y. H.</given-names></name> <name><surname>Missiakas</surname> <given-names>D.</given-names></name></person-group> (<year>2013</year>). <article-title>Secretion of atypical protein substrates by the ESAT-6 secretion system of <italic>Staphylococcus aureus</italic>.</article-title> <source><italic>Mol. Microbiol.</italic></source> <volume>90</volume> <fpage>734</fpage>&#x2013;<lpage>743</lpage>. <pub-id pub-id-type="doi">10.1111/mmi.12395</pub-id></citation></ref>
<ref id="B2"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Anderson</surname> <given-names>M.</given-names></name> <name><surname>Chen</surname> <given-names>Y. H.</given-names></name> <name><surname>Butler</surname> <given-names>E. K.</given-names></name> <name><surname>Missiakas</surname> <given-names>D. M.</given-names></name></person-group> (<year>2011</year>). <article-title>EsaD, a secretion factor for the Ess pathway in <italic>Staphylococcus aureus</italic>.</article-title> <source><italic>J. Bacteriol.</italic></source> <volume>193</volume> <fpage>1583</fpage>&#x2013;<lpage>1589</lpage>. <pub-id pub-id-type="doi">10.1128/JB.01096-10</pub-id></citation></ref>
<ref id="B3"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Anderson</surname> <given-names>M.</given-names></name> <name><surname>Ohr</surname> <given-names>R. J.</given-names></name> <name><surname>Aly</surname> <given-names>K. A.</given-names></name> <name><surname>Nocadello</surname> <given-names>S.</given-names></name> <name><surname>Kim</surname> <given-names>H. K.</given-names></name> <name><surname>Schneewind</surname> <given-names>C. E.</given-names></name><etal/></person-group> (<year>2017</year>). <article-title>EssE promotes <italic>Staphylococcus aureus</italic> ESS-dependent protein secretion to modify host immune responses during infection.</article-title> <source><italic>J. Bacteriol.</italic></source> <volume>199</volume> <fpage>e00527</fpage>&#x2013;<lpage>16</lpage>. <pub-id pub-id-type="doi">10.1128/JB.00527-16</pub-id></citation></ref>
<ref id="B4"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Bae</surname> <given-names>T.</given-names></name> <name><surname>Schneewind</surname> <given-names>O.</given-names></name></person-group> (<year>2006</year>). <article-title>Allelic replacement in <italic>Staphylococcus aureus</italic> with inducible counter-selection.</article-title> <source><italic>Plasmid</italic></source> <volume>55</volume> <fpage>58</fpage>&#x2013;<lpage>63</lpage>. <pub-id pub-id-type="doi">10.1016/j.plasmid.2005.05.005</pub-id></citation></ref>
<ref id="B5"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Bhat</surname> <given-names>M.</given-names></name> <name><surname>Dumortier</surname> <given-names>C.</given-names></name> <name><surname>Taylor</surname> <given-names>B. S.</given-names></name> <name><surname>Miller</surname> <given-names>M.</given-names></name> <name><surname>Vasquez</surname> <given-names>G.</given-names></name> <name><surname>Yunen</surname> <given-names>J.</given-names></name><etal/></person-group> (<year>2009</year>). <article-title><italic>Staphylococcus aureus</italic> ST398, New York City and Dominican Republic.</article-title> <source><italic>Emerg. Infect. Dis.</italic></source> <volume>15</volume> <fpage>285</fpage>&#x2013;<lpage>287</lpage>.</citation></ref>
<ref id="B6"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Bubeck Wardenburg</surname> <given-names>J.</given-names></name> <name><surname>Williams</surname> <given-names>W. A.</given-names></name> <name><surname>Missiakas</surname> <given-names>D.</given-names></name></person-group> (<year>2006</year>). <article-title>Host defenses against <italic>Staphylococcus aureus</italic> infection require recognition of bacterial lipoproteins.</article-title> <source><italic>Proc. Natl. Acad. Sci. U.S.A.</italic></source> <volume>103</volume> <fpage>13831</fpage>&#x2013;<lpage>13836</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.0603072103</pub-id></citation></ref>
<ref id="B7"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Burts</surname> <given-names>M. L.</given-names></name> <name><surname>Dedent</surname> <given-names>A. C.</given-names></name> <name><surname>Missiakas</surname> <given-names>D. M.</given-names></name></person-group> (<year>2008</year>). <article-title>EsaC substrate for the ESAT-6 secretion pathway and its role in persistent infections of <italic>Staphylococcus aureus</italic>.</article-title> <source><italic>Mol. Microbiol.</italic></source> <volume>69</volume> <fpage>736</fpage>&#x2013;<lpage>746</lpage>. <pub-id pub-id-type="doi">10.1111/j.1365-2958.2008.06324.x</pub-id></citation></ref>
<ref id="B8"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Burts</surname> <given-names>M. L.</given-names></name> <name><surname>Williams</surname> <given-names>W. A.</given-names></name> <name><surname>Debord</surname> <given-names>K.</given-names></name> <name><surname>Missiakas</surname> <given-names>D. M.</given-names></name></person-group> (<year>2005</year>). <article-title>EsxA and EsxB are secreted by an ESAT-6-like system that is required for the pathogenesis of <italic>Staphylococcus aureus</italic> infections.</article-title> <source><italic>Proc. Natl. Acad. Sci. U.S.A.</italic></source> <volume>102</volume> <fpage>1169</fpage>&#x2013;<lpage>1174</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.0405620102</pub-id></citation></ref>
<ref id="B9"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Chao</surname> <given-names>G.</given-names></name> <name><surname>Bao</surname> <given-names>G.</given-names></name> <name><surname>Jiao</surname> <given-names>X.</given-names></name></person-group> (<year>2014</year>). <article-title>Molecular epidemiological characteristics and clonal genetic diversity of <italic>Staphylococcus aureus</italic> with different origins in China.</article-title> <source><italic>Foodborne Pathog. Dis.</italic></source> <volume>11</volume> <fpage>503</fpage>&#x2013;<lpage>510</lpage>. <pub-id pub-id-type="doi">10.1089/fpd.2013.1717</pub-id></citation></ref>
<ref id="B10"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Dantes</surname> <given-names>R.</given-names></name> <name><surname>Mu</surname> <given-names>Y.</given-names></name> <name><surname>Belflower</surname> <given-names>R.</given-names></name> <name><surname>Aragon</surname> <given-names>D.</given-names></name> <name><surname>Dumyati</surname> <given-names>G.</given-names></name> <name><surname>Harrison</surname> <given-names>L. H.</given-names></name><etal/></person-group> (<year>2013</year>). <article-title>National burden of invasive methicillin-resistant <italic>Staphylococcus aureus</italic> infections, United States, 2011.</article-title> <source><italic>JAMA Intern. Med.</italic></source> <volume>173</volume> <fpage>1970</fpage>&#x2013;<lpage>1978</lpage>. <pub-id pub-id-type="doi">10.1001/jamainternmed.2013.10423</pub-id></citation></ref>
<ref id="B11"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>de Azavedo</surname> <given-names>J. C.</given-names></name> <name><surname>Foster</surname> <given-names>T. J.</given-names></name> <name><surname>Hartigan</surname> <given-names>P. J.</given-names></name> <name><surname>Arbuthnott</surname> <given-names>J. P.</given-names></name> <name><surname>O&#x2019;reilly</surname> <given-names>M.</given-names></name> <name><surname>Kreiswirth</surname> <given-names>B. N.</given-names></name><etal/></person-group> (<year>1985</year>). <article-title>Expression of the cloned toxic shock syndrome toxin 1 gene (tst) in vivo with a rabbit uterine model.</article-title> <source><italic>Infect. Immun.</italic></source> <volume>50</volume> <fpage>304</fpage>&#x2013;<lpage>309</lpage>.</citation></ref>
<ref id="B12"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>De Leon</surname> <given-names>J.</given-names></name> <name><surname>Jiang</surname> <given-names>G.</given-names></name> <name><surname>Ma</surname> <given-names>Y.</given-names></name> <name><surname>Rubin</surname> <given-names>E.</given-names></name> <name><surname>Fortune</surname> <given-names>S.</given-names></name> <name><surname>Sun</surname> <given-names>J.</given-names></name></person-group> (<year>2012</year>). <article-title><italic>Mycobacterium tuberculosis</italic> ESAT-6 exhibits a unique membrane-interacting activity that is not found in its ortholog from non-pathogenic <italic>Mycobacterium smegmatis</italic>.</article-title> <source><italic>J. Biol. Chem.</italic></source> <volume>287</volume> <fpage>44184</fpage>&#x2013;<lpage>44191</lpage>. <pub-id pub-id-type="doi">10.1074/jbc.M112.420869</pub-id></citation></ref>
<ref id="B13"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>DeLeo</surname> <given-names>F. R.</given-names></name> <name><surname>Otto</surname> <given-names>M.</given-names></name> <name><surname>Kreiswirth</surname> <given-names>B. N.</given-names></name> <name><surname>Chambers</surname> <given-names>H. F.</given-names></name></person-group> (<year>2010</year>). <article-title>Community-associated meticillin-resistant <italic>Staphylococcus aureus</italic>.</article-title> <source><italic>Lancet</italic></source> <volume>375</volume> <fpage>1557</fpage>&#x2013;<lpage>1568</lpage>. <pub-id pub-id-type="doi">10.1016/S0140-6736(09)61999-1</pub-id></citation></ref>
<ref id="B14"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Edwards</surname> <given-names>A. M.</given-names></name> <name><surname>Massey</surname> <given-names>R. C.</given-names></name></person-group> (<year>2011</year>). <article-title>How does <italic>Staphylococcus aureus</italic> escape the bloodstream?</article-title> <source><italic>Trends Microbiol.</italic></source> <volume>19</volume> <fpage>184</fpage>&#x2013;<lpage>190</lpage>. <pub-id pub-id-type="doi">10.1016/j.tim.2010.12.005</pub-id></citation></ref>
<ref id="B15"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Enright</surname> <given-names>M. C.</given-names></name> <name><surname>Day</surname> <given-names>N. P.</given-names></name> <name><surname>Davies</surname> <given-names>C. E.</given-names></name> <name><surname>Peacock</surname> <given-names>S. J.</given-names></name> <name><surname>Spratt</surname> <given-names>B. G.</given-names></name></person-group> (<year>2000</year>). <article-title>Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of <italic>Staphylococcus aureus</italic>.</article-title> <source><italic>J. Clin. Microbiol.</italic></source> <volume>38</volume> <fpage>1008</fpage>&#x2013;<lpage>1015</lpage>.</citation></ref>
<ref id="B16"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Foster</surname> <given-names>T. J.</given-names></name></person-group> (<year>2009</year>). <article-title>Colonization and infection of the human host by staphylococci: adhesion, survival and immune evasion.</article-title> <source><italic>Vet. Dermatol.</italic></source> <volume>20</volume> <fpage>456</fpage>&#x2013;<lpage>470</lpage>. <pub-id pub-id-type="doi">10.1111/j.1365-3164.2009.00825.x</pub-id></citation></ref>
<ref id="B17"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Hu</surname> <given-names>M.</given-names></name> <name><surname>Liu</surname> <given-names>Y.</given-names></name> <name><surname>Yu</surname> <given-names>K.</given-names></name> <name><surname>Liu</surname> <given-names>X.</given-names></name></person-group> (<year>2014</year>). <article-title>Decreasing the amount of trypsin in in-gel digestion leads to diminished chemical noise and improved protein identifications.</article-title> <source><italic>J Proteomics</italic></source> <volume>109</volume> <fpage>16</fpage>&#x2013;<lpage>25</lpage>. <pub-id pub-id-type="doi">10.1016/j.jprot.2014.06.017</pub-id></citation></ref>
<ref id="B18"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Kneuper</surname> <given-names>H.</given-names></name> <name><surname>Cao</surname> <given-names>Z. P.</given-names></name> <name><surname>Twomey</surname> <given-names>K. B.</given-names></name> <name><surname>Zoltner</surname> <given-names>M.</given-names></name> <name><surname>Jager</surname> <given-names>F.</given-names></name> <name><surname>Cargill</surname> <given-names>J. S.</given-names></name><etal/></person-group> (<year>2014</year>). <article-title>Heterogeneity in ess transcriptional organization and variable contribution of the Ess/Type VII protein secretion system to virulence across closely related <italic>Staphyloccus aureus</italic> strains.</article-title> <source><italic>Mol. Microbiol.</italic></source> <volume>93</volume> <fpage>928</fpage>&#x2013;<lpage>943</lpage>. <pub-id pub-id-type="doi">10.1111/mmi.12707</pub-id></citation></ref>
<ref id="B19"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Korea</surname> <given-names>C. G.</given-names></name> <name><surname>Balsamo</surname> <given-names>G.</given-names></name> <name><surname>Pezzicoli</surname> <given-names>A.</given-names></name> <name><surname>Merakou</surname> <given-names>C.</given-names></name> <name><surname>Tavarini</surname> <given-names>S.</given-names></name> <name><surname>Bagnoli</surname> <given-names>F.</given-names></name><etal/></person-group> (<year>2014</year>). <article-title>Staphylococcal Esx proteins modulate apoptosis and release of intracellular <italic>Staphylococcus aureus</italic> during infection in epithelial cells.</article-title> <source><italic>Infect. Immun.</italic></source> <volume>82</volume> <fpage>4144</fpage>&#x2013;<lpage>4153</lpage>. <pub-id pub-id-type="doi">10.1128/IAI.01576-14</pub-id></citation></ref>
<ref id="B20"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Koyama</surname> <given-names>H.</given-names></name> <name><surname>Sanui</surname> <given-names>M.</given-names></name> <name><surname>Saga</surname> <given-names>T.</given-names></name> <name><surname>Harada</surname> <given-names>S.</given-names></name> <name><surname>Ishii</surname> <given-names>Y.</given-names></name> <name><surname>Tateda</surname> <given-names>K.</given-names></name><etal/></person-group> (<year>2015</year>). <article-title>A fatal infection caused by sequence type 398 methicillin-resistant <italic>Staphylococcus aureus</italic> carrying the Panton-Valentine leukocidin gene: a case report in Japan.</article-title> <source><italic>J. Infect. Chemother.</italic></source> <volume>21</volume> <fpage>541</fpage>&#x2013;<lpage>543</lpage>. <pub-id pub-id-type="doi">10.1016/j.jiac.2015.03.013</pub-id></citation></ref>
<ref id="B21"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Li</surname> <given-names>M.</given-names></name> <name><surname>Du</surname> <given-names>X.</given-names></name> <name><surname>Villaruz</surname> <given-names>A. E.</given-names></name> <name><surname>Diep</surname> <given-names>B. A.</given-names></name> <name><surname>Wang</surname> <given-names>D.</given-names></name> <name><surname>Song</surname> <given-names>Y.</given-names></name><etal/></person-group> (<year>2012</year>). <article-title>MRSA epidemic linked to a quickly spreading colonization and virulence determinant.</article-title> <source><italic>Nat Med.</italic></source> <volume>18</volume> <fpage>816</fpage>&#x2013;<lpage>819</lpage>. <pub-id pub-id-type="doi">10.1038/nm.2692</pub-id></citation></ref>
<ref id="B22"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Li</surname> <given-names>M.</given-names></name> <name><surname>Wang</surname> <given-names>Y.</given-names></name> <name><surname>Zhu</surname> <given-names>Y.</given-names></name> <name><surname>Dai</surname> <given-names>Y.</given-names></name> <name><surname>Hong</surname> <given-names>X.</given-names></name> <name><surname>Liu</surname> <given-names>Q.</given-names></name><etal/></person-group> (<year>2016</year>). <article-title>Increased community-associated infections caused by panton-valentine leukocidin-negative MRSA, Shanghai, 2005-2014.</article-title> <source><italic>Emerg. Infect. Dis.</italic></source> <volume>22</volume> <fpage>1988</fpage>&#x2013;<lpage>1991</lpage>. <pub-id pub-id-type="doi">10.3201/eid2211.160587</pub-id></citation></ref>
<ref id="B23"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Los</surname> <given-names>F. C.</given-names></name> <name><surname>Randis</surname> <given-names>T. M.</given-names></name> <name><surname>Aroian</surname> <given-names>R. V.</given-names></name> <name><surname>Ratner</surname> <given-names>A. J.</given-names></name></person-group> (<year>2013</year>). <article-title>Role of pore-forming toxins in bacterial infectious diseases.</article-title> <source><italic>Microbiol. Mol. Biol. Rev.</italic></source> <volume>77</volume> <fpage>173</fpage>&#x2013;<lpage>207</lpage>. <pub-id pub-id-type="doi">10.1128/MMBR.00052-12</pub-id></citation></ref>
<ref id="B24"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Lowy</surname> <given-names>F. D.</given-names></name></person-group> (<year>1998</year>). <article-title><italic>Staphylococcus aureus</italic> infections.</article-title> <source><italic>N Engl J Med.</italic></source> <volume>339</volume> <fpage>520</fpage>&#x2013;<lpage>532</lpage>. <pub-id pub-id-type="doi">10.1056/NEJM199808203390806</pub-id></citation></ref>
<ref id="B25"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ma</surname> <given-names>Y.</given-names></name> <name><surname>Keil</surname> <given-names>V.</given-names></name> <name><surname>Sun</surname> <given-names>J.</given-names></name></person-group> (<year>2015</year>). <article-title>Characterization of <italic>Mycobacterium tuberculosis</italic> EsxA membrane insertion: roles of N- and C-terminal flexible arms and central helix-turn-helix motif.</article-title> <source><italic>J. Biol. Chem.</italic></source> <volume>290</volume> <fpage>7314</fpage>&#x2013;<lpage>7322</lpage>. <pub-id pub-id-type="doi">10.1074/jbc.M114.622076</pub-id></citation></ref>
<ref id="B26"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ohr</surname> <given-names>R. J.</given-names></name> <name><surname>Anderson</surname> <given-names>M.</given-names></name> <name><surname>Shi</surname> <given-names>M.</given-names></name> <name><surname>Schneewind</surname> <given-names>O.</given-names></name> <name><surname>Missiakas</surname> <given-names>D.</given-names></name></person-group> (<year>2017</year>). <article-title>EssD, a nuclease effector of the <italic>Staphylococcus aureus</italic> ESS pathway.</article-title> <source><italic>J. Bacteriol.</italic></source> <volume>199</volume> <fpage>e00528</fpage>&#x2013;<lpage>16</lpage>. <pub-id pub-id-type="doi">10.1128/JB.00528-16</pub-id></citation></ref>
<ref id="B27"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Otto</surname> <given-names>M.</given-names></name></person-group> (<year>2008</year>). <article-title>Staphylococcal biofilms.</article-title> <source><italic>Curr. Top. Microbiol. Immunol.</italic></source> <volume>322</volume> <fpage>207</fpage>&#x2013;<lpage>228</lpage>.</citation></ref>
<ref id="B28"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Otto</surname> <given-names>M.</given-names></name></person-group> (<year>2010</year>). <article-title>Basis of virulence in community-associated methicillin-resistant <italic>Staphylococcus aureus</italic>.</article-title> <source><italic>Annu. Rev. Microbiol.</italic></source> <volume>64</volume> <fpage>143</fpage>&#x2013;<lpage>162</lpage>. <pub-id pub-id-type="doi">10.1146/annurev.micro.112408.134309</pub-id></citation></ref>
<ref id="B29"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Pallen</surname> <given-names>M. J.</given-names></name></person-group> (<year>2002</year>). <article-title>The ESAT-6/WXG100 superfamily&#x2013;and a new Gram-positive secretion system?</article-title> <source><italic>Trends Microbiol.</italic></source> <volume>10</volume> <fpage>209</fpage>&#x2013;<lpage>212</lpage>.</citation></ref>
<ref id="B30"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Schijffelen</surname> <given-names>M. J.</given-names></name> <name><surname>Boel</surname> <given-names>C. H.</given-names></name> <name><surname>Van Strijp</surname> <given-names>J. A.</given-names></name> <name><surname>Fluit</surname> <given-names>A. C.</given-names></name></person-group> (<year>2010</year>). <article-title>Whole genome analysis of a livestock-associated methicillin-resistant <italic>Staphylococcus aureus</italic> ST398 isolate from a case of human endocarditis.</article-title> <source><italic>BMC Genomics</italic></source> <volume>11</volume>:<issue>376</issue>. <pub-id pub-id-type="doi">10.1186/1471-2164-11-376</pub-id></citation></ref>
<ref id="B31"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Schneewind</surname> <given-names>O.</given-names></name> <name><surname>Missiakas</surname> <given-names>D. M.</given-names></name></person-group> (<year>2012</year>). <article-title>Protein secretion and surface display in Gram-positive bacteria.</article-title> <source><italic>Philos. Trans. R. Soc. Lond. B Biol. Sci.</italic></source> <volume>367</volume> <fpage>1123</fpage>&#x2013;<lpage>1139</lpage>. <pub-id pub-id-type="doi">10.1098/rstb.2011.0210</pub-id></citation></ref>
<ref id="B32"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Smith</surname> <given-names>T. C.</given-names></name> <name><surname>Male</surname> <given-names>M. J.</given-names></name> <name><surname>Harper</surname> <given-names>A. L.</given-names></name> <name><surname>Kroeger</surname> <given-names>J. S.</given-names></name> <name><surname>Tinkler</surname> <given-names>G. P.</given-names></name> <name><surname>Moritz</surname> <given-names>E. D.</given-names></name><etal/></person-group> (<year>2009</year>). <article-title>Methicillin-resistant <italic>Staphylococcus aureus</italic> (MRSA) strain ST398 is present in midwestern U.S. swine and swine workers.</article-title> <source><italic>PLoS ONE</italic></source> <volume>4</volume>:<issue>e4258</issue>. <pub-id pub-id-type="doi">10.1371/journal.pone.0004258</pub-id></citation></ref>
<ref id="B33"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Smith</surname> <given-names>T. C.</given-names></name> <name><surname>Pearson</surname> <given-names>N.</given-names></name></person-group> (<year>2011</year>). <article-title>The emergence of <italic>Staphylococcus aureus</italic> ST398.</article-title> <source><italic>Vector Borne Zoonotic Dis.</italic></source> <volume>11</volume> <fpage>327</fpage>&#x2013;<lpage>339</lpage>. <pub-id pub-id-type="doi">10.1089/vbz.2010.0072</pub-id></citation></ref>
<ref id="B34"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Spaan</surname> <given-names>A. N.</given-names></name> <name><surname>Surewaard</surname> <given-names>B. G.</given-names></name> <name><surname>Nijland</surname> <given-names>R.</given-names></name> <name><surname>Van Strijp</surname> <given-names>J. A.</given-names></name></person-group> (<year>2013</year>). <article-title>Neutrophils versus <italic>Staphylococcus aureus</italic>: a biological tug of war.</article-title> <source><italic>Annu. Rev. Microbiol.</italic></source> <volume>67</volume> <fpage>629</fpage>&#x2013;<lpage>650</lpage>. <pub-id pub-id-type="doi">10.1146/annurev-micro-092412-155746</pub-id></citation></ref>
<ref id="B35"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Voss</surname> <given-names>A.</given-names></name> <name><surname>Loeffen</surname> <given-names>F.</given-names></name> <name><surname>Bakker</surname> <given-names>J.</given-names></name> <name><surname>Klaassen</surname> <given-names>C.</given-names></name> <name><surname>Wulf</surname> <given-names>M.</given-names></name></person-group> (<year>2005</year>). <article-title>Methicillin-resistant <italic>Staphylococcus aureus</italic> in pig farming.</article-title> <source><italic>Emerg. Infect. Dis.</italic></source> <volume>11</volume> <fpage>1965</fpage>&#x2013;<lpage>1966</lpage>. <pub-id pub-id-type="doi">10.3201/eid1112.050428</pub-id></citation></ref>
<ref id="B36"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Vuong</surname> <given-names>C.</given-names></name> <name><surname>Gerke</surname> <given-names>C.</given-names></name> <name><surname>Somerville</surname> <given-names>G. A.</given-names></name> <name><surname>Fischer</surname> <given-names>E. R.</given-names></name> <name><surname>Otto</surname> <given-names>M.</given-names></name></person-group> (<year>2003</year>). <article-title>Quorum-sensing control of biofilm factors in <italic>Staphylococcus epidermidis</italic>.</article-title> <source><italic>J. Infect. Dis.</italic></source> <volume>188</volume> <fpage>706</fpage>&#x2013;<lpage>718</lpage>. <pub-id pub-id-type="doi">10.1086/377239</pub-id></citation></ref>
<ref id="B37"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname> <given-names>R.</given-names></name> <name><surname>Braughton</surname> <given-names>K. R.</given-names></name> <name><surname>Kretschmer</surname> <given-names>D.</given-names></name> <name><surname>Bach</surname> <given-names>T. H.</given-names></name> <name><surname>Queck</surname> <given-names>S. Y.</given-names></name> <name><surname>Li</surname> <given-names>M.</given-names></name><etal/></person-group> (<year>2007</year>). <article-title>Identification of novel cytolytic peptides as key virulence determinants for community-associated MRSA.</article-title> <source><italic>Nat Med.</italic></source> <volume>13</volume> <fpage>1510</fpage>&#x2013;<lpage>1514</lpage>. <pub-id pub-id-type="doi">10.1038/nm1656</pub-id></citation></ref>
<ref id="B38"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname> <given-names>Y.</given-names></name> <name><surname>Hu</surname> <given-names>M.</given-names></name> <name><surname>Liu</surname> <given-names>Q.</given-names></name> <name><surname>Qin</surname> <given-names>J.</given-names></name> <name><surname>Dai</surname> <given-names>Y.</given-names></name> <name><surname>He</surname> <given-names>L.</given-names></name><etal/></person-group> (<year>2016</year>). <article-title>Role of the ESAT-6 secretion system in virulence of the emerging community-associated <italic>Staphylococcus aureus</italic> lineage ST398.</article-title> <source><italic>Sci Rep.</italic></source> <volume>6</volume>:<issue>25163</issue>. <pub-id pub-id-type="doi">10.1038/srep25163</pub-id></citation></ref>
<ref id="B39"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Warne</surname> <given-names>B.</given-names></name> <name><surname>Harkins</surname> <given-names>C. P.</given-names></name> <name><surname>Harris</surname> <given-names>S. R.</given-names></name> <name><surname>Vatsiou</surname> <given-names>A.</given-names></name> <name><surname>Stanley-Wall</surname> <given-names>N.</given-names></name> <name><surname>Parkhill</surname> <given-names>J.</given-names></name><etal/></person-group> (<year>2016</year>). <article-title>The Ess/Type VII secretion system of <italic>Staphylococcus aureus</italic> shows unexpected genetic diversity.</article-title> <source><italic>BMC Genomics</italic></source> <volume>17</volume>:<issue>222</issue>. <pub-id pub-id-type="doi">10.1186/s12864-016-2426-7</pub-id></citation></ref>
<ref id="B40"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Wassenberg</surname> <given-names>M. W.</given-names></name> <name><surname>Bootsma</surname> <given-names>M. C.</given-names></name> <name><surname>Troelstra</surname> <given-names>A.</given-names></name> <name><surname>Kluytmans</surname> <given-names>J. A.</given-names></name> <name><surname>Bonten</surname> <given-names>M. J.</given-names></name></person-group> (<year>2011</year>). <article-title>Transmissibility of livestock-associated methicillin-resistant <italic>Staphylococcus aureus</italic> (ST398) in Dutch hospitals.</article-title> <source><italic>Clin. Microbiol. Infect.</italic></source> <volume>17</volume> <fpage>316</fpage>&#x2013;<lpage>319</lpage>. <pub-id pub-id-type="doi">10.1111/j.1469-0691.2010.03260.x</pub-id></citation></ref>
<ref id="B41"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Witte</surname> <given-names>W.</given-names></name> <name><surname>Strommenger</surname> <given-names>B.</given-names></name> <name><surname>Stanek</surname> <given-names>C.</given-names></name> <name><surname>Cuny</surname> <given-names>C.</given-names></name></person-group> (<year>2007</year>). <article-title>Methicillin-resistant <italic>Staphylococcus aureus</italic> ST398 in humans and animals, Central Europe.</article-title> <source><italic>Emerg. Infect. Dis.</italic></source> <volume>13</volume> <fpage>255</fpage>&#x2013;<lpage>258</lpage>. <pub-id pub-id-type="doi">10.3201/eid1302.060924</pub-id></citation></ref>
<ref id="B42"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>B. Z.</given-names></name> <name><surname>Hua</surname> <given-names>Y. H.</given-names></name> <name><surname>Yu</surname> <given-names>B.</given-names></name> <name><surname>Lau</surname> <given-names>C. C.</given-names></name> <name><surname>Cai</surname> <given-names>J. P.</given-names></name> <name><surname>Zheng</surname> <given-names>S. Y.</given-names></name><etal/></person-group> (<year>2015</year>). <article-title>Recombinant ESAT-6-like proteins provoke protective immune responses against invasive <italic>Staphylococcus aureus</italic> disease in a murine model.</article-title> <source><italic>Infect. Immun.</italic></source> <volume>83</volume> <fpage>339</fpage>&#x2013;<lpage>345</lpage>. <pub-id pub-id-type="doi">10.1128/IAI.02498-14</pub-id></citation></ref>
<ref id="B43"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>D.</given-names></name> <name><surname>De Souza</surname> <given-names>R. F.</given-names></name> <name><surname>Anantharaman</surname> <given-names>V.</given-names></name> <name><surname>Iyer</surname> <given-names>L. M.</given-names></name> <name><surname>Aravind</surname> <given-names>L.</given-names></name></person-group> (<year>2012</year>). <article-title>Polymorphic toxin systems: comprehensive characterization of trafficking modes, processing, mechanisms of action, immunity and ecology using comparative genomics.</article-title> <source><italic>Biol. Direct.</italic></source> <volume>7</volume>:<issue>18</issue>. <pub-id pub-id-type="doi">10.1186/1745-6150-7-18</pub-id></citation></ref>
<ref id="B44"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>D.</given-names></name> <name><surname>Iyer</surname> <given-names>L. M.</given-names></name> <name><surname>Aravind</surname> <given-names>L.</given-names></name></person-group> (<year>2011</year>). <article-title>A novel immunity system for bacterial nucleic acid degrading toxins and its recruitment in various eukaryotic and DNA viral systems.</article-title> <source><italic>Nucleic Acids Res.</italic></source> <volume>39</volume> <fpage>4532</fpage>&#x2013;<lpage>4552</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gkr036</pub-id></citation></ref>
<ref id="B45"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zhou</surname> <given-names>H.</given-names></name> <name><surname>Du</surname> <given-names>H.</given-names></name> <name><surname>Zhang</surname> <given-names>H.</given-names></name> <name><surname>Shen</surname> <given-names>H.</given-names></name> <name><surname>Yan</surname> <given-names>R.</given-names></name> <name><surname>He</surname> <given-names>Y.</given-names></name><etal/></person-group> (<year>2013</year>). <article-title>EsxA might as a virulence factor induce antibodies in patients with <italic>Staphylococcus aureus</italic> infection.</article-title> <source><italic>Braz. J. Microbiol.</italic></source> <volume>44</volume> <fpage>267</fpage>&#x2013;<lpage>271</lpage>. <pub-id pub-id-type="doi">10.1590/S1517-83822013005000019</pub-id></citation></ref>
</ref-list>
<fn-group>
<fn id="fn01"><label>1</label><p><ext-link ext-link-type="uri" xlink:href="http://www.mlst.net">http://www.mlst.net</ext-link></p></fn>
</fn-group>
</back>
</article>