Between April, 2013 and February, 2015, a total of 468 clinical non-duplicate Proteae isolates (P. mirabilis, n = 459; P. vulgaris, n = 1; P. penneri, n = 1; Morganella morganii, n = 2; Providencia rettgeri, n = 4; P. stuartii, n = 1) were collected from various animal hosts corresponding to distinct and epidemiological unrelated individuals (dogs, n = 411; cats, n = 25; horses, n = 13; bovine, n = 7; rabbit, n = 3; ovine, n = 3; ferret, n = 2; snake, n = 2; chicken; n = 1; bird, n = 1) and originating from distant geographical areas throughout France. These isolates were collected through the Resapath, the French antimicrobial resistance surveillance network in animal pathogens¹. Identification was performed by peripheral veterinary laboratories and then confirmed at the Anses laboratory in Lyon, France, using Api20E strips (bioMérieux, Marcy l’Etoile, France). Isolates were screened for antibiotic resistance by the disk diffusion method according to the guidelines of the CA-SFM with 30 antibiotics of veterinary or human interest².

Salmonella genomic island 1 detection was performed by PCR amplification with degenerated primers designed in order to amplify all known SGI1 and PGI1 integrase genes (FwintSGI1HR, 5′ATGTTGCGTCAGGCYGAGGC; RvintSGI1HR, 5′GAGTGYCCAAGAAGSCGAGAG). The chromosomal location was confirmed by PCR amplification of the left and right junctions in the chromosome, as previously described (Schultz et al., 2015). The genetic diversity of SGI1 was assessed by PCR mapping covering the entire island using primers previously described (Siebor and Neuwirth, 2011, 2013). PGI1 detection, chromosomal location, backbone mapping and resistance gene detection were performed by PCR, as previously described (Figure 1) (Siebor and Neuwirth, 2014).

β-lactamase genes detection was performed by PCR, as previously described (Dallenne et al., 2010). For the CTX-M-1 group, an additional PCR was performed using external primers (ISEcp1L1, 5′ CAGCTTTTATGACTCG; P2D, 5′ CAGCGCTTTTGCCGTCTAAG) and the amplicons were sequenced.

The chromosomal location of these genes was assessed with the I-CeuI (New England Biolabs, Hertfordshire, UK) technique (Liu et al., 1993). After digestion of the complete DNA, DNA fragments were separated by Pulsed-Field Gel Electrophoresis (PFGE) in TBE 0.5 X at 14°C using a CHEF Mapper (Bio-Rad Laboratories, Richmond, CA, USA). Running conditions were 6 V/cm with a switch time of 5.3–49.9 s for 19.7 h. Southern blots were performed by transferring the DNA on a Hybond-N⁺ membrane and hybridizing the membrane with DIG-labeled probes specific for the 23S rDNA, the ESBL (bla_VEB-6, bla_CTX-M-1, or bla_CTX-M-15) and AmpC (bla_{CMY -2} or bla_DHA-16) genes of interest (see detailed primers in Supplementary Table S1). Probes were prepared by PCR using labeled DIG-dUTP (PCR DIG probe synthesis kit; Roche Diagnostics, Indianapolis, IN, USA). Detection was performed using the DIG DNA Labeling and Detection Kit (Roche Diagnostics) according to the manufacturer’s instructions.

The plasmidic location of these genes was assessed by Southern blots on S1-PFGE gels (New England Biolabs, Hertfordshire, UK). Running conditions were 6 V/cm with a switch time of 1–30 s for 20 h. Hybridization was performed as described above for Southern blots on I-CeuI gels, using the same ESBL/AmpC probes and the DIG DNA Labeling and Detection Kit.

Finally, all SGI1/PGI1-positive, ESBL and AmpC strains were analyzed by PCR-based replicon typing (PBRT kit; Diatheva, Fano, Italy) in order to type the plasmids carrying the ESBL/AmpC genes.

The genetic diversity was investigated by PFGE. DNA plugs were digested with SmaI (Promega, Madison, WI, USA) and genomic DNA was separated by CHEF Mapper gel electrophoresis in TBE 0.5 X at 14°C. The running conditions were 6 V/cm with a switch time of 5–20 s for 22 h. XbaI-digested S. enterica serovar Braenderup strain H9812 was used as size ladder. The DNA patterns were analyzed using BioNumerics software version 4.5 (Applied Maths, Sint-Martens-Latem, Belgium) to construct a phylogenetic tree. Analysis was performed using the Dice coefficient with optimization set at 0.5% and tolerance at 1%.

Salmonella genomic island 1/Proteus genomic island 1-carrying P. mirabilis are emerging pathogens in humans and animals. In a recent study, SGI1/PGI1-carrying P. mirabilis were reported in animals in France but no large-scale non-biased data on their prevalence were available (Schultz et al., 2015). Here, we investigated a large collection of 468 Proteae isolates of animal origin in France to estimate the prevalence of the SGI1/PGI1 elements. We also assessed the prevalence of resistance to broad-spectrum cephalosporins in those Proteae isolates considering that the bla_VEB-6 gene was recurrently reported on the SGI1-V variant in P. mirabilis (Siebor and Neuwirth, 2011; Schultz et al., 2015). Among the 468 isolates studied, 17 P. mirabilis (17/468, 3.6%) were positive for SGI1 (11 isolates) or PGI1 (6 isolates) by PCR (Figure 2 and Table 1). They were mostly recovered from dogs (n = 13; 13/411, 3.2%), but also from cats (n = 2; 2/25, 8%), and horses (n = 2; 2/13, 15.4%). While Proteae are more frequently isolated from dogs, SGI1/PGI1 elements were more prevalent in cats and horses. This would deserve confirmation due to the low number of isolates collected from these two animal categories.

Among the 11 SGI1-positive P. mirabilis, six showed an ESBL phenotype using the double disk synergy test by antibiogram. PCR mapping of the SGI1 resistance gene cluster and backbone revealed that all six ESBL-positive isolates harbored the SGI1-V variant carrying the bla_VEB-6 gene (Figure 1). In the five other SGI1-positive P. mirabilis isolates, PCR mapping of the antimicrobial resistance gene cluster gave positive results for different complex class 1 integrons, i.e., InSGI1-H, InPmABB and InPmMAT (Figures 1, 2 and Table 1). PCR mapping of the SGI1 backbone confirmed that SGI1 elements with InSGI1-H, InPmABB, and InPmMAT harbored the same 2789 bp deletion at position 5340-8120 (GenBank accession number AF261825) in the region spanning from ORF S005 to ORF S009, as previously described. Except for SGI1-InPmMAT, this deletion was replaced by the insertion of ISVch4 (also called IS1359) (Figure 1). Interestingly, this region contains two ORFs S007 and S006 coding for homologs of the master activator AcaDC of IncA/C conjugative plasmids and named SgaDC (SGI1 activator, subunits D and C; Poulin-Laprade et al., 2015; Muranyi et al., 2016). The SgaDC activator (also named FlhDC_SGI1) was shown to be active on the same AcaDC-dependent promoter regions, i.e., P_xis, and thus should be also implicated in transfer and/or maintenance of SGI1 (Muranyi et al., 2016). The absence of flhDC_SGI1 in these variants and the partial deletion of ORF S005 (traN) may have implications in their spread that needs to be further studied. In addition to the classical penta-resistance of SGI1 to amoxicillin, chloramphenicol, streptomycin and sulphonamides, other SGI1/PGI1-conferred resistances were amikacin, apramycin, gentamicin, tobramycin, netilmicin, kanamycin, nalidixic acid, trimethoprim, and enrofloxacin.

The six PGI1-positive P. mirabilis isolates were characterized by PCR mapping of the whole backbone. PCR products of the expected sizes were obtained for the complete mapping indicating a conserved PGI1 genetic structure in these isolates (Figure 1). All six isolates showed similar antibiotic resistance profiles as the ones previously described (Siebor and Neuwirth, 2014; Schultz et al., 2015). Interestingly PGI1, which was only recently reported in P. mirabilis, was represented in more than one-third of the genomic islands characterized here, thus confirming the proportion observed in a recent study on a much smaller number of isolates (Schultz et al., 2015). This may suggest either a previously undetected situation in the Proteae population or a recent and rapid spread of PGI1 elements, which were first described in 2014 (Siebor and Neuwirth, 2014). Our data also indicate that the dissemination of SGI1/PGI1 in multidrug-resistant P. mirabilis in animals is not a sporadic phenomenon and should be considered with great attention.

Eighteen strains (18/468, 3.8%) harbored an ESBL profile (n = 9), an AmpC profile (n = 8), or a combination of both (n = 1) after antibiotic susceptibility analysis. Only one AmpC-producing strain did not present any additional resistance (Table 1). Otherwise, proportions of strains resistant to non-β-lactam antibiotics were particularly high for chloramphenicol (14/18, 77.8%), streptomycin (10/18, 55.6%), trimethoprim/sulphonamides (13/18, 72.2%), nalidixic acid (13/18, 72.2%), and enrofloxacin (10/18, 55.6%). Of note, none of the strains were resistant to carbapenems.

In addition to the six SGI1-V positive P. mirabilis described above, the ESBL phenotype was detected in four other strains. Two P. mirabilis isolates (38327 and 39081) harbored the bla_VEB-6 gene independently of the SGI1 element (Figure 2), whereas the two last ESBL-producing isolates harbored the bla_CTX-M-15 gene (P. mirabilis 34146) and the bla_CTX-M-1 gene (P. rettgeri 39465). The prevalence of ESBL producers was lower than the one recently reported in France. However, the previous sampling was based on isolates conserved by the veterinary laboratories and a bias toward non-susceptible isolates cannot be excluded (Schultz et al., 2015). On the contrary, no ESBL-producing isolate was detected in Japan (Harada et al., 2014). In any case, Proteae from animal origin present much less ESC-resistant isolates than those from human origin, since the nowadays ESBL rate in animals is very close to the French situation in human medicine in the late 1990s (Chanal et al., 2000).

Concerning AmpC resistance phenotypes, the bla_{CMY -2} gene was detected alone in 7 P. mirabilis isolates whereas another P. mirabilis isolate (38375) presented a bla_DHA-16 gene (Figure 2). Finally, one P. mirabilis isolate (39214) possessed both bla_{CMY -2} and bla_DHA-16 genes (Figure 2). The presence of multiple ESC-resistance genes in two strains (bla_VEB-6/bla_{CMY -2} in 38327 and bla_{CMY -2}/bla_DHA-16 in 39214) shows the capacity of P. mirabilis to accumulate redundant resistance genes and thus acting as a potential reservoir.

The chromosomal location of genes was assessed by Southern-blots on I-CeuI-PFGE using the probes corresponding to the ESBL/AmpC genes carried by the studied isolates, as well as probes specific for the 23S rDNA. This method revealed that all bla_{CMY -2} (Figure 3) and bla_DHA-16 genes (Supplementary Figure S1) were located on the bacterial chromosome. All bla_VEB-6 genes carried by the SGI1-V variant as well as the bla_VEB-6 gene identified in isolate 39081 were also proved to be encoded by the chromosome (Supplementary Figure S2). On the contrary, the plasmidic localization of genes was proved by Southern-blots on S1-nuclease-PFGE using adequate probes. The last non-chromosomal bla_VEB-6 (38327; Supplementary Figure S3) and bla_CTX-M-1 (P. rettgeri 39465; Figure 4) genes were thus shown to be carried on plasmids, which were considered as non-typable because of the total absence of amplification using the PBRT kit. Finally, the P. mirabilis isolate 34146 carried two copies of the ESBL gene bla_CTX-M-15, one located on the chromosome and the other on a non-typable plasmid (Figure 4). Whereas ESBL genes were mostly reported on plasmids in Enterobacteriaceae, it is noteworthy to observe that it is seemingly not the case in Proteae. These data strongly suggest that Proteae may be more prone than other Enterobacteriaceae to integrate resistance determinants into the chromosome, mostly on SGI1/PGI1 or other genomic islands.

SmaI PFGE revealed that all SGI1/PGI1-positive isolates were genetically unrelated as were the ESBL/AmpC producing isolates (Figure 2), except the six SGI1-V positive isolates that belonged to the same cluster but interestingly differed from the ones previously reported (Schultz et al., 2015). This clustering suggests the spread of a clonal population among different and unrelated individuals. Such a dominance of a clonal population of SGI1-V/bla_VEB-6 P. mirabilis strains in humans and companion animals may result from close contacts between these two populations, as also demonstrated for the transfer of other multidrug resistant bacteria or plasmids, such as those carrying ESBL genes. Indeed, the transmission of bacterial clones from animals to humans (or vice-versa) through physical contacts or contact with contaminated saliva or feces has been described (Espinosa-Gongora et al., 2015; Ljungquist et al., 2016).