C. glabrata parental strain KUE100 (Ueno et al., 2007) and derived single deletion mutants KUE100_Δcgflr1 or KUE100_Δcgflr2, constructed in this study, as well as the C. glabrata strains 66032u and 66032u_Δcgpdr1 (Vermitsky and Edlind, 2004), provided by Thomas Edlind, from Drexel University, College of Medicine, Philadelphia, PA, were batch-cultured at 30°C, with orbital agitation (250 rpm) in basal medium (BM), with the following composition (per liter): 1.7 g yeast nitrogen base without amino acids or NH4⁺ (Difco), 20 g glucose (Merck) and 2.65 g (NH4)₂SO4 (Merck). C. glabrata strains L5U1 (cgura3Δ0, cgleu2Δ0), 84u (cgura3Δ0), and 84u_Δcgyap1, kindly provided by John Bennett, (Chen et al., 2007) from the National Institute of Allergy and Infectious Diseases, NIH, Bethesda, USA, were grown in BM medium supplemented with 20 mg/L uracil and 60mg/L leucine. S. cerevisiae parental strain BY4741 (MATa, ura3Δ0, leu2Δ0, his3Δ1, met15Δ0) and the derived single deletion mutant BY4741_Δflr1 were obtained from Euroscarf (http://web.uni-frankfurt.de/fb15/mikro/euroscarf/). Cells were batch-cultured at 30°C, with orbital agitation (250 rpm) in supplemented with 20 mg/L methionine, 20 mg/L histidine, 60 mg/L leucine, 20 mg/L uracil (all from Sigma). Solid media contained, besides the above-indicated ingredients, 20 g/L agar (Iberagar). The plasmid pGREG576 was obtained from the Drag&Drop collection (Jansen et al., 2005).

Exponentially growing wild-type 66032 C. glabrata strain and the derived 66032_Δcgpdr1 deletion mutant were transferred to fresh BM medium in the absence of stress (control conditions) or in the presence of 4 μg/mL 5-flucytosine (Sigma). Upon 1 h of cultivation, cells were harvested by centrifugation and the membrane protein fraction was obtained as described before (Pais et al., 2016). Expression proteomics analysis of the obtained membrane-enriched fraction was carried out using an iTRAQ-MS procedure, carried out as a paid service at the Keck Foundation Biotechnology Resource Laboratory, Yale University, USA (http://medicine.yale.edu/keck/proteomics/index.aspx), using the method followed in Pais et al. (2016). Briefly, samples were sonicated and proteins reduced by adding 50 mM TCEP (tris(2-carboxyethyl)phosphine), followed by 200 mM MMTS (methyl methane thiosulfonate). Protein digestion was achieved by adding 10 μL of a solution of 1 mg/mL Lys-C, followed by incubation at 37°C for 3 h, and 10 μL of 1 mg/mL trypsin, followed by overnight incubation at 37°C. Macro-spin desalt of the digests with C18 spin columns for cleanup and quantitation was carried out, followed by dissolution in 65 μL of 500 mM TEAB. iTRAQ labeling was carried out based on the AAA quant protocol. iTRAQ experiments were carried out through the SCX cartridge and experiments run on 5600.

The search parameters and acceptance criteria used were the following: Peaklist generating software: ProteinPilot 4.5 and Mascot; Search engine: Paragon Search Engine (ProteinPilot 4.2); Sequence Database/spectral library: C. glabrata [5478] from SwissProt (May 2013); The database used was downloaded from UniProt, with a total of 5197 protein entries. Mass spectrometric analysis is done on an AB SCIEX TripleTOF® 5600 mass spectrometer with AB SCIEX ProteinPilot™ software used for protein identification and quantitation. ProteinPilot utilizes a Paragon™ algorithm with hybrid sequence tag and feature probability database searches. Hence, specific details such as mass tolerances, specific modifications etc., are not utilized. All iTRAQ results are uploaded into the Yale Protein Expression database (YPED) for investigator viewing. Protein identification was considered reliable for a Protein Score >2, corresponding to a confidence level of 99%. A reserve decoy database search, followed by filtering of all peptides above 1% False Discovery Rate was carried out before protein grouping.

Proteomics data analysis started from 3 iTRAQ sets. The samples present in each of the sets were randomized to prevent bias, and in different sets distinct labels were used to tag the samples, ensuring that protein identification in the MS step is not biased by the tags. For each sample in a given set, protein quantification was only considered for p < 0.05. Protein expression changes above 1.5-fold or below 0.66-fold were considered relevant. Protein classification into functional groups was achieved based on their predicted function, according to the Candida Genome Database (www.candidagenome.org), or based on the function of their closest S. cerevisiae homolog, according to the Saccharomyces Genome Database (www.yeastgenome.org).

The deletion of the C. glabrata FLR1 and FLR2 genes (ORFs CAGL0H06017g and CAGL0H06039g, respectively) was carried out in the parental strain KUE100, using the method described by Ueno et al. (2011). The target genes CgFLR1 and CgFLR2 were replaced by a DNA cassette including the CgHIS3 gene, through homologous recombination. The replacement cassette was prepared by PCR using the primers 5′ AGAGAAAAATAAAACCAATTCTAAAACCAAATCCATATTACAACCCAATTGCAAAGGGCCGCTGATCACG-3′ and 5′-AATGTTAGTGTGAACTTGAATGTTAGATTTTCACGTGAATGAGAACTGAGAAATCACATCGTGAGGCTGG-3′, for the CgFLR1 gene, and the primers 5′-AGAATCATATTCATAAAGGTAACAAAACTACACAACAAATTATTAACTATTTTACAGGCCGCTGATCACG-3′ and 5′-AAATAATTTGTTCGGGGTAAGCACAATTGGAGGCTCTATCTTTTTTCTCTTCTTCACATCGTGAGGCTGG-3′, for the CgFLR2 gene. The pHIS906 plasmid including CgHIS3 was used as a template and transformation was performed as described previously (Ueno et al., 2007). Recombination locus and gene deletion were verified by PCR using the following pairs of primers: 5′-GAGGTGCTTAATATCGTCAC -3′ and 5′-CAACAACGTGTCCTACATG-3′; and 5′-GTGCATTTCAGGACACACT-3′ and 5′-GTATTTGTTCTTGTCCTGGTGTG -3′, respectively.

The pGREG576 plasmid from the Drag & Drop collection was used to clone and express the C. glabrata ORFs CAGL0H06017g and CAGL0H06039g in S. cerevisiae, as described before for other heterologous genes (Costa et al., 2013a,b, 2014b). CgFLR1 or CgFLR2 DNA was generated by PCR, using genomic DNA extracted from the sequenced CBS138 C. glabrata strain, and the following specific primers: 5′–GAATTCGATATCAAGCTTATCGATACCGTCGACAGCAAAGATGAATTATCTTC -3′ and 5′-GCGTGACATAACTAATTACATGACTCGAGGTCGACTCACCTGTTGTATTTAGACATGG -3′; or 5′-GAATTCGATATCAAGCTTATCGATACCGTCGACAATGTATATCGGTGCATTTCAGGAC -3′ and 5′-GCGTGACATAACTAATTACATGACTCGAGGTCGACTCATGAATCTGGACTAAATCTTG -3′, respectively. These plasmids include a S. cerevisiae CEN/ARS element which had been shown before to work in C. glabrata (Willins et al., 2002). The GAL1 promoter present in the pGREG576_CgFLR1 and pGREG576_CgFLR2 plasmids was then replaced by the copper-induced MTI C. glabrata promoter, giving rise to the pGREG576_MTI_CgFLR1 and pGREG576_MTI_CgFLR2 plasmids. The MTI promoter DNA was generated by PCR, using genomic DNA extracted from the sequenced CBS138 C. glabrata strain, and the following specific primers: 5′-TTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCTGTACGACACGCATCATGTGGCAATC -3′ and 5′-GAAAAGTTCTTCTCCTTTACTCATACTAGTGCGGCTGTGTTTGTTTTTGTATGTGTTTGTTG -3′. The recombinant plasmids pGREG576_CgFLR1, pGREG576_CgFLR2, pGREG576_MTI_CgFLR1, and pGREG576_MTI_CgFLR2 were obtained through homologous recombination in S. cerevisiae and verified by DNA sequencing. As before (Costa et al., 2013a,b, 2014b), the transformation of L5U1 C. glabrata cells with the pGREG576 plasmids, as well as plasmid propagation was ensured by growth in selective uracil depleted medium.

The sub-cellular localization of the CgFlr1 and CgFlr2 proteins was determined based on the observation of BY4741 S. cerevisiae or L5U1 C. glabrata cells transformed with the pGREG576-CgFLR1 and pGREG576-CgFLR2 or pGREG576-MTI-CgFLR1 and pGREG576-MTI-CgFLR2 plasmids, respectively. These cells express the CgFlr1_GFP or CgFlr2_GFP fusion proteins, whose localization may be determined using fluorescence microscopy. S. cerevisiae cell suspensions were prepared by cultivation in BM-U medium, containing 0.5% glucose and 0.1% galactose, at 30°C, with orbital shaking (250 rpm), until a standard culture OD_600nm = 0.4 ± 0.04 was reached. At this point cells were transferred to the same medium containing 0.1% glucose and 1% galactose, to induce protein expression. C. glabrata cell suspensions were prepared in BM-U medium, until a standard culture OD_600nm = 0.4 ± 0.04 was reached, and transferred to the same medium supplemented with 50 μM CuSO₄ (Sigma), to induce the expression of the fusion protein. After 5 h of incubation, the distribution of CgFlr1_GFP or CgFlr2_GFP fusion proteins in S. cerevisiae or in C. glabrata living cells was detected by fluorescence microscopy in a Zeiss Axioplan microscope (Carl Zeiss MicroImaging), using excitation and emission wavelength of 395 and 509 nm, respectively. Fluorescence images were captured using a cooled CCD camera (Cool SNAPFX, Roper Scientific Photometrics).

The susceptibility of the parental strain KUE100 toward toxic concentrations of the selected drugs was compared to that of the deletion mutants KUE100_Δcgflr1 and KUE100_Δcgflr2 by spot assays, using the steps described elsewhere (Costa et al., 2013b). The ability of CgFLR1 and CgFLR2 gene expression to increase wild-type resistance to the tested chemical stresses was also examined in the URA3- strain L5U1 C. glabrata strain, using the pGREG576_MTI_CgFLR1 and pGREG576_MTI_CgFLR2 centromeric plasmids. Additionally, the effect of CgFLR1, and CgFLR2 expression in S. cerevisiae BY4741 wild-type strain and BY4741_Δflr1 single deletion mutant was also carried out as described elsewhere (Costa et al., 2013b). The tested drugs included the following compounds, used in the specified concentration ranges: the azole antifungal drugs ketoconazole (10–60 mg/L), fluconazole (75–250 mg/L), miconazole (0.10–0.50 mg/L), tioconazole (0.2–0.9 mg/L), itraconazole (0.1–20 mg/L), and clotrimazole (1–15 mg/L), the polyene antifungal drug amphotericin B (0.10–0.30 mg/L), the fluoropyrimidine 5-flucytosine (0.01–4 mg/L) and the pesticide mancozeb (0.5–2.5 mg/L) (all from Sigma).

The internal accumulation of flucytosine or clotrimazole was determined by calculating the ratio between the radiolabeled compound measured within the yeast cells and in the external medium (Intracellular/Extracellular). The parental strain KUE100 and the mutant strains KUE100_Δcgflr1 and KUE100_Δcgflr2 were grown in BM medium until mid-exponential phase and harvested by filtration. Cells were washed and resuspended in BM medium, to obtain dense cell suspensions (OD_600nm = 0.5 ± 0.1, equivalent to ~ 1.57 mg (dry weight) mL⁻¹). Readily, 0.1 μM of ³H- flucytosine or ³H- clotrimazole (American Radiolabelled Chemicals; 1 mCi/ml) and sub-inhibitory concentrations of the corresponding cold drug were added to the cell suspensions. Incubation proceeded for an additional period of 30 min. The intracellular accumulation of labeled antifungal was followed by filtering 200 μl of cell suspension, at adequate time intervals, through pre-wetted glass microfiber filters (Whatman GF/C). The filters were washed with ice-cold TM buffer and the radioactivity measured in a Beckman LS 5000TD scintillation counter. Extracellular ³H-drug was estimated, by radioactivity assessment of 50 μl of the supernatant. Non-specific ³H-drug adsorption to the filters and to the cells (<5% of the total radioactivity) was assessed and taken into consideration. To calculate the intracellular concentration of labeled antifungal drug, the internal cell volume (Vi) of the exponential cells, grown in the absence of drug and used for accumulation assays, was considered constant and equal to 2.5 μl (mg dry weight)⁻¹ (Rosa and Sá-Correia, 1996). Statistical analysis of the results was performed using analysis of variance, and differences were considered significant for P < 0.05.

The levels of CgFLR1 and CgFLR2 transcripts were assessed by real-time PCR, using the approach described before (Costa et al., 2013b). Synthesis of cDNA for real time RT-PCR experiments, from total RNA samples, was performed using the Multiscribe™ reverse transcriptase kit (Applied Biosystems) and the 7500 RT-PCR Thermal Cycler Block (Applied Biosystems), following the manufacturer's instructions. The quantity of cDNA for the following reactions was kept around 10 ng. The subsequent RT-PCR step was carried out using SYBR® Green reagents. Primers for the amplification of the CgFLR1, CgFLR2, and CgACT1 cDNA were designed using Primer Express Software (Applied Biosystems) and are—TCTTATTCACGATGCTACAAATTGG -3′ and 5′-GAATCACAAGGCCAGCAAAGTT -3′; 5′-GCAGCGGCATTCCCATTAT -3′ and 5′-CGGGATACTTTTTTGTGCTCAAT -3′; and 5′-AGAGCCGTCTTCCCTTCCAT -3′ and 5′-TTGACCCATACCGACCATGA -3′, respectively. The RT-PCR reaction was carried out using a thermal cycler block (7500 Real-Time PCR System—Applied Biosystems). Default parameters established by the manufacturer were used and fluorescence detected by the instrument and registered in an amplification plot (7500 System SDS Software—Applied Biosystems). The CgACT1 mRNA level was used as an internal control. The relative values obtained for the wild-type strain in control conditions were set as 1 and the remaining values are presented relative to that control. To avoid false positive signals, the absence of non-specific amplification with the chosen primers was confirmed by the generation of a dissociation curve for each pair of primers. Statistical analysis of the results was performed using analysis of variance, and differences were considered significant for P < 0.05.

Given the importance of membrane proteins as a first line of defense against external stress agents, the membrane proteome of C. glabrata cells exposed to flucytosine-induced stress was compared to that of unstressed cells. Details on the protein quantification can be assessed at the Mass spectrometry Interactive Virtual Environment (MassIVE) repository (https://massive.ucsd.edu/ProteoSAFe/static/massive.jsp; MassIVE ID: MSV000079209). Annotated spectra for single peptide identification for each protein in the membrane-associated proteome is provided in MS-viewer (http://prospector2.ucsf.edu/prospector/cgi-bin/msform.cgi?form=msviewer; Search keys: qrvm65goix; xffxn22szm; tm0y9x0hqd) (Pais et al., 2016).

Among the identified membrane-associated proteins, 32 were found to exhibit more than 1.5-fold increased or decreased concentrations in C. glabrata cells exposed to inhibitory concentrations of flucytosine, when compared to the same cells growing in the absence of stress. Within these proteins, 21 were found to be down-regulated and 11 up-regulated in flucytosine challenged cells. Categorization of these proteins, based on their function predicted by homology to their S. cerevisiae homologs, enabled their clustering into seven groups: Glucose metabolism; Mitochondrial function; Amino acid/Nucleotide metabolism; Ribosome components and translation machinery; Lipid metabolism; Cell wall assembly; Multidrug Resistance transporters (Figure 1; Table 1).

The largest functional group identified in the 5-FC membrane proteome response, including a third of the proteins with altered content, is related to RNA metabolism. The expression of seven proteins involved in ribosome biogenesis and translation was found to increase in flucytosine stressed cells, whereas three proteins of the same category were found to be down-regulated in these conditions. It is difficult to say what the exact consequences of the altered expression of each of them individually may be. Additionally, the concentration of several proteins related to glucose metabolism and mitochondrial function related proteins was found to decrease in the presence of flucytosine. The expression of one amino acid biosynthetic protein, Ilv5, and two pyrimidine biosynthetic proteins, Ura1, and Ura3, was also found to decrease in cells exposed to this antifungal agent. Interestingly, Ura3 is responsible for the conversion of 5-FOA into 5-fluorouracil, a key step in the conversion of flucytosine into its toxic sub-products. The repressed expression of the Ura proteins may confer an advantage to flucytosine stressed cells as it may delay the conversion of this pro-drug into its toxic subproducts. Finally, a group of five multidrug transporters was found to exhibit altered levels of expression in flucytosine stressed cells. Four of them, previously implicated in azole drug resistance (Sanglard et al., 1999; Vermitsky et al., 2006; Torelli et al., 2008; Costa et al., 2013b), were actually found to be down-regulated, while the fifth, CgFlr1, was found to be more than 2-fold up-regulated upon C. glabrata exposure to flucytosine.

To assess the possible involvement of the transcription factor Pdr1 in the resistance to 5-flucytosine, the growth of the C. glabrata strains 66032u and 66032u_Δcgpdr1 (Vermitsky and Edlind, 2004) was compared in solid medium containing inhibitory concentrations of flucytosine, clotrimazole and fluconazole (Figure 2). CgPDR1 deletion fully abrogates growth in the presence of the tested azole drug concentrations, as expected based on numerous reports on the pivotal role of this transcription factor in azole drug resistance. Interestingly, the Δcgpdr1 deletion mutant was also found to display higher susceptibility to the antifungal drug 5-FC than the wild-type parental strain, suggesting that it plays a role in the resistance to this drug as well. Based on this result, the analysis of the membrane-enriched fraction of the C. glabrata proteome obtained from cells exposed to 5-flucytosine in the absence of the transcription factor CgPdr1 was assessed and compared to that of the C. glabrata wild-type cells exposed to 5-flucytosine. Considering an at least 1.5-fold difference in protein expression activation in wild-type vs. Δcgpdr1 cells exposed to 5-flucytosine, nine proteins were found to be repressed by CgPdr1; while eight proteins were found to be activated by CgPdr1 (Table 1). The PDRE loci BCCRYYRGD, TCCRYGGA (Tsai et al., 2010), TCCACGGA, and HYCCGTGGR (Paul et al., 2014), were searched for in the promoters of the referred genes using the PathoYeastract database (Monteiro et al., 2016). Interestingly, considering these 17 proteins, at least one CgPdr1-binding site is found in the promoter regions of nine genes, suggesting the action of CgPdr1 in their expression may be direct. For the remaining 15 proteins, no statistically significant change could be detected in the current experiment. The proteins whose expression was found to be higher in the wild-type strain than in the Δcgpdr1 deletion mutant include the multidrug transporters CgCdr1 and CgQdr2, but also two proteins related to mitochondrial function, CgCyb5 (ORF CAGL0L03828g) and CgRip1 (ORF CAGL0I03190g), and four proteins involved in RNA metabolism, CgDbp2 (ORF CAGL0L03846g), CgNop1 (ORF CAGL0K01859g), CgRpl20B (ORF CAGL0K07414g), and CgRps16A (ORF CAGL0I00792g).

The involvement of CgFlr1 and CgFlr2 in antifungal drug resistance was evaluated, through susceptibility assays, considering a total of nine antifungal drugs of four different families and one agricultural fungicide mancozeb. The results obtained by screening the susceptibility phenotypes of Δcgflr1 and Δcgflr2 mutants, when compared to the wild-type strain, reveal that CgFLR1 confers resistance to mancozeb, whereas CgFLR2 confers resistance to azoles and amphotericin B (Figure 3).

Both CgFLR1 and CgFLR2 were found to confer resistance to flucytosine, although the effect of CgFLR2 is stronger (Figure 3). The expression of CgFLR1-GFP or CgFLR2-GFP in the L5U1 C. glabrata wild-type strain, as verified by anti-GFP western analysis (Figure S1), was concordantly found to increase C. glabrata natural resistance toward the antifungal drugs to which the deletion of each gene was found to lead to a susceptibility phenotype (Figure 4).

Using S. cerevisiae as a heterologous expression system, the effect of CgFLR1 and CgFLR2 expression on yeast drug resistance was further investigated. When expressed in S. cerevisiae, the CgFLR1 and CgFLR2 genes were found to rescue the susceptibility phenotype exhibited by the S. cerevisiae Δflr1 mutant against flucytosine and mancozeb, and azole drugs, respectively (Figure 5).

Upon expression induction, C. glabrata cells harboring the pGREG576_MTI_CgFLR1 and pGREG576_MTI_CgFLR2 plasmids were inspected by fluorescence microscopy. The CgFlr1_GFP and CgFlr2_GFP fusion proteins were found to be localized to the cell periphery (Figure 6). In a similar approach, CgFlr1_GFP and CgFlr2_GFP were found to be localized to the cell periphery when expressed heterologously in S. cerevisiae (Figure 6). These results strongly suggest plasma membrane localization for both CgFlr1 and CgFlr2.

Consistent with the observed susceptibility phenotypes, Δcgflr1 and Δcgflr2 deletion mutants were found to accumulate 2-fold more radiolabeled flucytosine than the KUE100 parental strain (Figures 7A,B).

Additionally, Δcgflr2 mutant cells were found to accumulate around 8-fold more radiolabelled clotrimazole than the parental strain (Figure 8). These results strongly suggest that CgFlr1 and CgFlr2 activities increase C. glabrata resistance toward flucytosine, and in the case of CgFlr2 toward azoles, by reducing their accumulation in yeast cells.

In order to evaluate whether or not the expression of CgFLR1 and CgFLR2 is affected upon drug exposure, quantitative RT-PCR was used to study the effect of flucytosine, clotrimazole, and mancozeb stress exposure in the transcript levels of these genes. No up-regulation of CgFLR1 or CgFLR2 genes could be detected in wild-type cells upon flucytosine exposure. Interestingly, however, CgFLR1 was found to be up-regulated in mancozeb exposed cells, whereas both CgFLR1 and CgFLR2 were found to be up-regulated upon exposure to clotrimazole or fluconazole stress, which is consistent with the role of CgFLR1 and CgFLR2 in mancozeb and azole drug resistance, respectively (Figures 9A,B).

Additionally, given the fact that the transcription factor CgPdr1 is the master regulator of azole drug resistance (Tsai et al., 2006) and CgYap1 had been previously linked to the control of CgFlr1 expression (Chen et al., 2007), the effect of CgYap1 and CgPdr1 deletion in the control of the expression of CgFLR1 and CgFLR2 was further evaluated. CgFLR1 and CgFLR2 up-regulation, registered under clotrimazole exposure—but not under fluconazole stress —, was found to be abrogated in the absence of CgPDR1 (Figure 9B), while CgPdr1 and CgYap1 were found to control the basal expression of both CgFLR1 and CgFLR2 (Figures 9A,B). As expected, based on the proteomics data, none of the genes was found to be controlled by CgPdr1 in flucytosine exposed cells. Unexpectedly, the up-regulation of CgFLR1, and CgFLR2 registered under mancozeb stress was found not to be controlled by CgYap1. Indeed, in Δcgyap1 cells the mancozeb-induced up-regulation of these genes was found to be even stronger than that registered in the wild-type strain (Figures 9A,B).

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.