Escherichia coli strains were grown at 37°C under aerobic conditions in Luria-Bertani medium (LB) (Difco) or on LB agar plates. Escherichia coli strains DH5α (Invitrogen, Carlslab, CA), TOP 10 (Invitrogen), and XL1-Blue (Stratagene, La Jolla, CA) were used to propagate the plasmids for protein purification, point mutations, and the two-hybrid system (the bacterial strains and plasmids used in this study are listed in Table 1). Escherichia coli strain BL21-Rosetta(DE3) (Novagen, Gibbstown, NJ) was used for overexpression and protein purification. When required, the medium was supplemented with ampicillin (100 μg/ml), tetracycline (10 μg/ml), kanamycin (50 μg/ml), or chloramphenicol (25 μg/ml). All antibiotics and chemicals were purchased from Sigma (St. Louis, MO).

Liberibacter crescens BT-1 was cultured at 25°C with moderate aeration (150 RPM), in modified BM7 media (Leonard et al., 2012) containing 1% Brain Heart Infusion (Difco Laboratories, Detroit, MI), 15% Fetal Bovine Serum (Sigma, St. Louis, MO), 30% TMN-FH insect medium (Sigma), α-Ketoglutaric acid (2 mg/ml), ACES (10 mg/ml), and potassium hydroxide (3.75 mg/ml), at pH 6.9. For determinations of the antimicrobial activity of metronidazole, dimetridazole, ronidazole, and tolfenamic acid, each chemical was added to the liquid media at increasing concentrations (1–500 μM). The optical density was determined at 600 nm every 24 h during 5 days.

Standard methods were used for chromosomal DNA isolation, restriction enzyme digestion, agarose gel electrophoresis, ligation, and transformation (Pagliai et al., 2010). Plasmids were isolated using the QIAprep® Spin Miniprep Kit (Qiagen, Valencia, CA), and PCR products were purified using Qiaquick® Purification Kits (Qiagen). All of the primers used in this study are described in Table 2. For protein expression and purification, the prbP (CLIBASIA_01510) gene was amplified by PCR, using total DNA extractions from L. asiaticus infected tissue, and cloned into the p15TV-L plasmid as described previously (Pagliai et al., 2010).

The two-hybrid system previously described by Borloo et al. (2007) was used (Borloo et al., 2007). Proteins of interest were fused to complementing β-galactosidase truncations (Δα and Δω), where the resulting level of complemented β-galactosidase activity corresponds directly to the level of interaction between the proteins. Proteins of interests were cloned into vectors pB2HΔα and pB2HΔω using the NotI and BamHI restriction sites. All subcloning steps were performed in E. coli XL-1 Blue (Stratagene, La Jolla, CA). Fusion proteins in pB2HΔα and pB2HΔω were transformed by heat shock and subsequently co-expressed in E. coli TOP10. Empty vectors were used as a control to determine baseline activity. The minimal inhibitory concentration (MIC) was determined for each chemical in E. coli (Table 3). The highest concentration that did not adversely affect the base levels in the controls was used for subsequent in vivo assays.

Escherichia coli cells were grown at 37°C in LB medium until reaching OD600 of 0.8 (late exponential phase). Cells were collected and lysed in Z-buffer (60 mM Na₂HPO₄, 40 mM NaH₂PO₄, 10 mM KCl, 1 mM MgSO₄, 50 mM β-mercaptoethanol; Miller, 1972). β-galactosidase activity was assayed by following the catalytic hydrolysis of chlorophenol red-β-D-galactopyranoside (Sigma-Aldrich). The absorbance at 570 nm was read continuously using a Synergy HT 96-well plate reader (BioTek, Winooski, VT). β-galactosidase activity, expressed as arbitrary units (AU), was calculated using the slope of absorbance curve normalized with the initial cell density. Preliminary β-galactosidase assays were performed with strains LB01 and LB02, in the absence and presence (0–1 mM) of each chemical to determine baseline activity. Each assay was performed in triplicates.

Protein purification was performed as previously described (Lorca et al., 2007). Briefly, PrbP was cloned into vector p15TV-L. The His-tagged fusion protein was then overexpressed in E. coli BL21-Rosetta(DE3) (Novagen). Cells were grown in LB broth at 37°C, to an OD600 of 0.6. Expression was induced with 0.5 mM isopropyl -thio-β-D-galactopyranoside (IPTG). After induction, the cells were incubated at 17°C for 16 h. The cells were harvested and resuspended in binding buffer (500 mM NaCl, 5% glycerol, 50 mM HEPES, 5 mM imidazole, pH 7.5) with Roche EDTA-free protease inhibitor cocktail (Roche Applied Science, Germany). Phenylmethylsulfonyl fluoride (0.5 mM) and Tris(2-carboxyethyl)phosphine hydrochloride (0.5 mM) were added to the cells immediately before lysing. Cells were lysed using a french press. The lysates were clarified by centrifugation (30 min at 17,000 × g) and applied to a metal chelate affinity column charged with nickel. The column was washed extensively with binding buffer containing 20 mM imidazole, and the proteins were subsequently eluted from the column with elution buffer (binding buffer containing 250 mM imidazole). The purified proteins were dialyzed against 10 mM HEPES (pH 7.5), 500 mM NaCl, 2.5% glycerol, 0.5 mM TCEP, and stored at −80°C. The identity of the purified proteins was confirmed by Mass Spectrometry (as a service in the Interdisciplinary Center for Biotechnology Research, University of Florida) from protein bands isolated from SDS-PAGE gels.

Gel shift assays for PrbP were performed using aliquots of protein purified and concentrated according to the procedures described above. Fragments of the rplK, prbP, rpsJ, dnaK, and radA promoter regions were generated by PCR using pre-labeled 5′-biotin primers (Table 2). PCR products were purified using QIAquick spin columns (Qiagen). EMSA reaction mixtures (20 μL) contained 1 ng of 5′ biotin-labeled DNA probe, 12.5 ng/μL of both Poly(dI-dC) and Poly(dA-dT) nonspecific competitor DNAs, 10 mM Hepes pH 7.5, 150 mM NaCl, 5% glycerol, purified PrbP protein (0–7 μM), and ligand (0–2 mM)as indicated. Competition assays were carried out using unlabeled fragments of the promoter regions generated by PCR. After incubation at 37°C for 20 min, samples were separated on 6% acrylamide-bisacrylamide non-denaturing gels, in ice cold Tris borate-EDTA buffer, pH 8.3 (TBE). Electrophoresis was performed on ice at 100 V for 2 h. DNA was transferred to a Hybond-N⁺ membrane (GE Healthcare, Pittsburgh, PA) with a Semi-Dry electroblotter (Fisher Scientific, Pittsburgh, PA) at 250 mA for 45 min. Transferred DNA was cross-linked to the membrane using a Spectrolinker XL-1000 UV cross-linker equipped with 312 nm UV bulbs. Biotin labeled DNA was detected using a Phototope-Star Detection Kit (New England Biolabs, Ipswich, MA). Membranes were exposed to Kodak X-ray film.

Protection assays were performed on both minus and plus strands using 5′-6FAM or 5′-VIC labeled probes that were generated by PCR (primers described in Table 2). 1.5 μg of labeled P_rplK probe was combined with 40 μM PrbP, 0.5 mM CaCl₂, 2.5 mM MgCl₂, and 0.025 U of DNase I (New England Biolabs) in a 200 μl reaction. After incubation at 37°C for 20 min, the reaction was stopped by the addition of 50 mM EDTA, pH 8.0. As a control, a digestion reaction was performed under the same conditions without PrbP. The digested DNA and the sequencing reaction products were analyzed at the Plant and Microbe Genomics facility, Ohio State University, Columbus, using a 3730 DNA analyzer. The protected regions were identified using GeneMapper software (Life Technology), as previously described (Zianni et al., 2006).

Purified PrbP protein was screened against the Prestwick chemical library of 1152 compounds (Prestwick Chemical, France) using differential scanning fluorimetry as previously described (Vedadi et al., 2006; Niesen et al., 2007; Wrench et al., 2013). Briefly, purified PrbP protein was diluted to a final concentration of 20 μM in 100 mM HEPES, pH 7.5, 150 mM NaCl. 20 μl aliquots of a protein solution containing the chemical compounds were placed in duplicate, into 96-well plates (Bio-Rad) and heated from 25 to 80°C, at the rate of 1°C per min. A real time PCR device (iCycler IQ™, Bio-Rad) was used to monitor protein unfolding by an increase in the fluorescence of the fluorophore SYPRO Orange (Invitrogen). Fluorescence intensities were plotted against temperature for each sample well, and transition curves were fitted with the Boltzmann equation using Origin 8 software (Northampton, MA). The midpoint of each transition was calculated and compared with the midpoint calculated for the reference sample. If the difference between the midpoints was greater than 2.0°C, the corresponding compound was considered to be a “hit.”

Leaves were collected from HLB-symptomatic Valencia Orange (C. sinensis) trees, maintained at the University of Florida main campus. All leaves used in this study were collected from new flushes on highly symptomatic branches. Prior to treatment all solutions were autoclaved or filter sterilized. 100 μM stocks of the chemical were prepared in 10 mM Tris pH 8.0. A solution of 10 mM Tris pH 8.0 was used for the controls. A scalpel was used to harvest leaves from the tree, with a horizontal cut at the base of the petiole. Each leaf was immediately suspended in 8 ml of treatment solution (with or without chemicals). Leaves were supported in a vertical position throughout the incubation period, with only the lower inch of the petiole submerged in solution (with or without chemical). Steady air flow was maintained over the leaf blades throughout the incubation period, to facilitate transpiration and the adsorption of each solution. Each treatment group consisted of 12 leaves that were processed after 24 h of incubation (with or without chemical).

For each treatment group, biological quadruplicates were prepared from the twelve leaves. The leaf midribs and petioles were collected and incubated overnight at 4°C in RNAlater solution (Life Technologies, Grand Island, NY). Following treatment with RNAlater, samples were rinsed twice with RNase free water and immediately frozen in liquid nitrogen. Samples were then freeze dried over a period of 3 days and homogenized using a GenoGrinder 2000. Homogenized samples were stored at −80°C.

Plant and bacterial RNA was extracted from 75 mg of homogenized tissue. Extractions were carried out using the Isolate II RNA Plant Kit (Bioline, London, UK) with lysis buffer RLY. Zirconia beads (0.1 mm) were added to each sample during lysis, to aid with the disruption of bacterial cells. Purified RNA was eluted with 60 μl of RNase/DNase-free water, and subsequently treated with TURBO DNA-free DNase (Thermo Scientific, Wilmington, DE) to eliminate trace amounts of DNA. Purified RNA samples were quantified using a NanoDrop ND 1000 (Thermo Scientific, Wilmington, DE) and stored at −80°C. cDNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA) with random hexamer primers and 0.5 μg of RNA. cDNA products were diluted 50% with DNase/RNase-free water and stored at −80°C.

qRT-PCR was carried out in a iCycler IQ apparatus (Bio-Rad) using Platinum SYBR Green qPCR SuperMix for iCycler (Life Technologies) in accordance with the manufacturer's recommended protocol. Reactions were carried out using 2 μl of cDNA, in a total reaction volume of 26 μl. The genes measured for L. asiaticus included prbP (CLIBASIA_01510), L25 (CLIBASIA_01515), rplK (CLIBASIA_00130), rpsJ (CLIBASIA_00735), gyrA (CLIBASIA_00325), and 16S rRNA (CLIBASIA_r05785). The mRNA levels of rplK, CLIBASIA_r05785, rpsJ and prbP genes were normalized to the abundance of the plant genes cox2 and 18S rRNA. The expression of each plant control gene was previously examined in absence and presence of tolfenamic acid (data not shown). Quantitative reverse transcription-PCR primers are described in detail in Table 2.

Twelve-month old seedlings were randomly divided into ten groups of 8 seedlings. Tolfenamic acid was prepared in 10 mM tris buffer, and applied at concentrations of 1, 10, 100, 1000, and 10,000 μM by root soaking (with 100 ml), foliar spray (to saturation), or root soaking and foliar spray combined. A control group was also treated with 10 mM tris buffer only. Each treatment was applied twice at 2 week intervals. A non-treated control group was also maintained throughout the duration of the experiment. Seedlings were monitored for symptoms of phytotoxicity during a period of 12 months following treatment. No phytotoxic effects were observed following treatment with tolfenamic acid (up to 10 mM). Tolfenamic acid had no effect on the transcription of Cox2 or 18S rRNA (data not shown).

Citrus sinensis “Valencia” inoculation: Twelve-month old seedlings were graft inoculated with budwood collected from HLB-infected trees. Prior to grafting, the source of the infected tissue was analyzed by PCR to confirm the presence of viable L. asiaticus. PCR confirmation was carried out using primers for 16S rRNA (CLIBASIA_r05781) and gyrA (CLIBASIA_00325) genes (see Table 2 for primer sequences). Inoculated plants were kept in a secure greenhouse approved by the USDA Animal and Plant Health Inspection Service (APHIS). The plants were watered in accordance with the standard watering schedule for the commercial citrus industry. Citrus fertilizer (Sunniland Citrus 6-4-6, N-P-K) was applied every 2 months as instructed by the manufacturer. Two months after grafting, each plant was tested for HLB by PCR as described above.

Seedlings treatment study: After 9 months of testing positive for HLB, the highly symptomatic, infected sweet orange seedlings (described above) were randomly divided into two groups. 100 μM tolfenamic acid (TA) was applied to one group of infected seedlings as a foliar spray (to saturation), and by root soaking (with 100 ml of 100 μM TA). The buffer vehicle (10 mM tris) was applied to the control group as a foliar spray (to saturation), and by root soaking (with 100 ml of 10 mM tris). Each treatment was applied twice, at 2 week intervals. Evaluation of HLB symptoms (leaf yellowing and mottling) and L. asiaticus transcriptional activity (as a measure of viability) was performed as described above.

qRT-PCR statistical significance was assessed using a two-tail P-value, calculated with the Mann–Whitney nonparametric test.

Previous studies in PrbP homologs have found that these proteins may bind non-specifically to the promoter regions of the rrnA, and rpsH genes (Gulten and Sacchettini, 2013; Srivastava et al., 2013). In this study, we examined the DNA binding properties of PrbP in L. asiaticus, using the promoter region of genes encoding the ribosomal proteins rplK (CLIBASIA_00130; P_rplK) and rpsJ (CLIBASIA_00735; P_rpsJ), as well as the promoter regions of 16S rRNA (CLIBASIA_r05785; P_16S), prbP (CLIBASIA_01510; P_prbP), dnaK (CLIBASIA_02620; P_dnaK), and radA (CLIBASIA_01095; P_radA). We found that PrbP was able to bind P_rplK at 3.5 μM and P_16S at 5 μM, while binding to P_rpsJ, P_prbP, P_dnaK, and P_radA was only observed with higher concentrations (10–15 μM) of PrbP (Figure 1). Competition assays were used to confirm the specificity of the PrbP:P_rplK interaction, where a 10-fold excess of unlabeled P_rplK was found to completely out-compete the labeled P_rplK fragment (Figure 2). At higher concentrations (100–400-fold excess), P_dnaK was found to compete with the labeled P_rplK fragment, but to a lesser extent than observed with unlabeled P_rplK. The addition of excess (up to 400-fold) unlabeled P_radA or unlabeled P_prbP had no effect (Figure 2). These results indicate that PrbP binds to a specific sequence in the promoter region of rplK, with higher affinity. DNase I footprinting was used to identify the DNA binding site for PrbP in the promoter region of rplK (Figure 3A). The 24 nucleotide protected site (GTAGGTTGGTTGTTTTTTAGAAAG), is located 31 bp from the translational start codon, on the plus strand. The critical DNA contact residues were identified by EMSA analysis, following site directed mutagenesis of the rplK promoter region (Figures 3B,C). Of the twelve mutant EMSA probes tested, only rplK-M1, rplK-M4, rplK-M5, rplK-M10, and rplK-M11 resulted in decreased binding to PrbP (Figure 3C). These results indicate that nnAnnnnGGTTnnnnnnnnnAAAn is the PrbP recognition sequence for this promoter. These results confirm that L. asiaticus PrbP interacts with a specific sequence in the promoter region.

A bacterial two-hybrid system was used to investigate potential interactions between PrbP and the β-subunit of the RNAP. Plasmids pB2HΔα and pB2HΔω were used to create fusions of the L. asiaticus genes CLIBASIA_01510 (prbP) and CLIBASIA_00110_21–150 (rpoB, residues 21–150), to the β-galactosidase truncations Δα and Δω as described by Borloo et al. (2007). Protein-protein interactions were followed by β-galactosidase activity. High levels of β-galactosidase activity were observed in strains LB02 (carrying pB2HΔα-prbP and pB2HΔω-rpoB_21–150) and LB03 (carrying pB2HΔα-rpoB_21–150 and pB2HΔω-prbP) (5823 ± 345 AU and 3252 ± 217AU, respectively), when compared to the control strains (Figure 4). These results confirm that L. asiaticus PrbP interacts with the RNAP.

Our approach to study the biological role of PrbP was to identify small molecules that bind and/or interact with the protein to regulate its activity. To this end, the L. asiaticus prbP gene was cloned into vector p15TV-L, and subsequently overexpressed in E. coli BL21. The purified protein was screened against the Prestwick chemical library of small molecules, by differential scanning fluorimetry (Vedadi et al., 2006; Pagliai et al., 2010; Wrench et al., 2013). The midpoint transition temperature of PrbP was determined to be 37.3 ± 0.5°C. From the 1200 small molecules examined in the screening, 8 compounds were found to induce a shift in the midpoint transition temperature (ΔTm) of PrbP. Metronidazole, cotine, gramine, menadione, folic acid, and tolfenamic acid were found to have the strongest effect, inducing a Tm shift of 1.8°, 2.1°, −2.5°, −2.5°, −3.5°, and −4.5°C, respectively (Table 3). Berberine chloride and acetazolamide were found to interact with PrbP to a lesser degree, with a ΔTm of 1.5° and 1.7°C, respectively.

A bacterial two-hybrid system was used to further investigate the interactions between PrbP and RNAP, in the absence and presence of each chemical. The MIC was determined for each chemical in E. coli (Table 3). Preliminary β-galactosidase assays were performed using strains LB01 and LB02, in absence and presence (1 μM−1 mM) of each chemical to determine baseline activity. The highest concentration that did not adversely affect the base levels in the controls was used for subsequent in vivo assays (Table 3). Metronidazole showed the strongest effect, decreasing PrbP/RpoB interactions by 53.7%, while berberine, acetazolamide, gramine, cotine, menadione, folic acid, and tolfenamic acid had a lesser effect, decreasing the interaction by 5.1, 3.7, 15.3, 5.2, 9.8, 2.2, and 17.5%, respectively (Table 3).

Consequently, we identified five compounds with chemical scaffolds similar to metronidazole (dimetridazole, 2-methyl-4(5)-nitroimidazole, 1,2-dimethylimidazol, ornidazole, and ronidazole) and their effect was tested on the interaction between PrbP and RpoB. The inhibition values obtained were low for ornidazole (11.6%), 2-methyl-4(5)-nitroimidazole (17.5%), and dimetridazole (25.8%). When tested at higher concentrations (200 μM), 1,2-dimethylimidazole was found to decrease PrbP/RpoB interactions by 37.6%, however, no effect was observed at lower concentrations (<50 μM). Conversely, a lower concentration (1 μM) of ronidazole was found to significantly decrease (48%) PrbP/RpoB interactions (Table 3).

EMSA were performed with PrbP in the presence and absence of the small molecules identified by differential scanning fluorimetry. The promoter region of rplK (P_rplK) was used as the target DNA in all assays. Of the compounds tested, tolfenamic acid was the only effective inhibitor of interactions between PrbP and P_rplK (Figure 5A). Complete disruption of the PrbP:P_rplK complex was observed with 350 μM tolfenamic acid (Figure 5B). Metronidazole, ronidazole, acetazolamide, gramine, cotine, menadione, and folic acid had no effect on the PrbP:P_rplK complex when present at concentrations up to 2 mM.

As propagation of L. asiaticus still remains elusive under laboratory conditions, we used the culturable close relative L. crescens to determine the antimicrobial activity of metronidazole, dimetridazole, ronidazole, and tolfenamic acid. It was found that metronidazole, dimetridazole and ronidazole were not inhibitory at concentrations up to 500 μM. When combined with the results of the bacterial two hybrid system, these results suggest that interactions between PrbP and RNAP may not be critical for the persistence of L. crescens under the conditions tested. Conversely, growth inhibition of L. crescens was observed in presence of tolfenamic acid (70 μM), indicating interactions between PrbP and DNA are indeed essential for the survival of L. crescens (Figure 6).

An infected leaf assay was used to assess the efficacy of tolfenamic acid against L. asiaticus, in vitro (Pagliai et al., 2014). Leaves were collected from Valencia Orange (C. sinensis) trees infected with L. asiaticus. Upon collection, leaves were immediately immersed in 1, 10, or 100 μM tolfenamic acid. Following incubation, each sample was analyzed by qRT-PCR to determine the relative change in gene expression for 16S rRNA, DNA gyrase subunit A, L10 ribosomal, PrbP and RplK protein (encoded by CLIBASIA_r05785, gyrA, rplJ, prbP, and rplK, respectively) as viability parameters for L. asiaticus (Pagliai et al., 2014). Due to the variability in bacterial load, samples were normalized to the plant gene cox2 and 18S rRNA. Samples incubated with 10 or 100 μM tolfenamic acid showed a significant (p < 0.05) decrease in the expression of all five genes (Figure 7). These results suggest that tolfenamic acid may be inhibitory to L. asiaticus at 10 and 100 μM.

The addition of 1 μM tolfenamic acid did not have a significant effect on the expression levels of gyrA, prbP, or rplJ, however, a significant (p < 0.005) decrease in expression was observed for rplK and 16S rRNA (93 and 77% reduction, respectively). These results indicate that PrbP is a transcriptional activator for rplK and the 16S ribosomal genes in L. asiaticus. Additionally, these results indicate that expression of prbP is not auto-regulated at the level of transcription, in a manner dependent on DNA binding.

Prior to testing the efficacy of tolfenamic acid in L. asiaticus infected citrus trees, a phytotoxicity assessment was performed using healthy 12 month-old citrus seedlings. Following 6 months of treatment with tolfenamic acid (1, 10, and 100 μM), no phytotoxic effects were observed in any of the treatment groups. The efficacy of tolfenamic acid was subsequently determined in L. asiaticus-infected citrus seedlings (Citrus sinensis, “Valencia”). Seedlings were infected with L. asiaticus (via grafting) and maintained in a greenhouse for 12 months to allow the infection to spread throughout the entire plant. Each plant had symptoms of advanced L. asiaticus infection and the presence of L. asiaticus was confirmed by PCR prior to beginning treatments with tolfenamic acid (Figures 8, 9).

Tolfenamic acid (100 μM) was administered to infected seedlings via root soaking and as a foliar spray (to saturation). Two applications were made over a period of 2 weeks. Four infected seedlings were also maintained under the same conditions as a control. Each plant was examined and photographed every 2 weeks to monitor the canopy and root tissue for signs of recovery or disease progression. New root tissue was observed in several of the treated plants 2 weeks after treatment. Two months after treatment, healthy new flush growth began to push on several of the treated plants, and continued to grow over the next 11 months with no visible signs of infection (Figure 8). Eleven months after treatments were applied, three of the four plants treated with tolfenamic acid showed clear signs of recovery in both root and canopy tissues (Figure 8). In contrast, in the control group treated with the buffer vehicle only, three out of the four plants died (Figure 9). In the treated plants, qRT-PCR analysis of root tissue revealed the absence of L. asiaticus infection in plants TA-1, TA-2, and TA-3 while plant TA-4 showed only a 10% reduction in the expression of rplJ (Figure 10). A significant drop (80–95% reduction) in L. asiaticus titer was also observed in the canopy tissue of 75% of the treated plants (Figure 10).

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. A patent application has been submitted for the use of tolfenamic acid for the treatment of HLB.