Ten E. faecium strains were used in this study (Table 1). Dog' strain isolation criteria were the presence of a relatively recent (2007–2012) clinical infection, isolation in pure culture, and PCR identification as E. faecium species. Based on these criteria only five canine E. faecium isolates were recovered over this period from the diagnostic laboratory of the Faculty of Veterinary Medicine at the University of Montreal and these were from UTI, wounds and cholangiohepatitis infections. The human isolates (n = 5) were provided by the “Centre de Recherche Hospitalier de l'Université Laval (CRCHUL)” and randomly chosen from a culture collection of E. faecium from hospitalized patients over the same period. Some of the human isolates (CCRI no. 18581, 16717 and 16354) were from colonization/surveillance studies of hospitalized patients. All isolates were identified by multiplex PCR assay using species-specific primer sets for the ddl faecium (ddl F-5′TTGAGGCAGACCAGATTGACG3′ and ddl R-5′TATGACAGCGACTCCGATTCC3′) identification gene as previously described (Tremblay et al., 2011). E. faecium HA-56038 was used as a positive control.

Isolates were tested for MIC using the Sensititre plate CMV3AGPF (Trek™ Diagnostic System Ltd, Cleveland, OH) according to the Clinical and Laboratory Standards Institute (CLSI, M31-A3 and M100-S20) guidelines (Clinical and Laboratory Standards Institute, 2008, 2010). Ciprofloxacin and ampicillin susceptibilities were further analyzed by standard broth macrodilution method (CLSI, M31-A3 and M100-S20). Breakpoints from CLSI and the Canadian Integrated Program for Antimicrobial Resistance Surveillance (CIPARS) were used (Anonymous, 2008). Staphylococcus aureus ATCC29213 and Enterococcus faecalis ATCC29212 were used as control strains.

Isolates were analyzed for clonal diversity by pulsed-field gel electrophoresis (PFGE) after SmaI (New England Biolabs, Inc., Beverly, Ma, USA) digestion as described by Garcia-Migura et al. (2005). Digested DNA was electrophoresed as previously described (Vankerckhoven et al., 2008). Computer analysis of PFGE banding patterns was performed with Bionumerics Version 6.5 software (Applied Maths, Austin, TX, USA). Banding pattern similarities were analyzed by the Dice coefficient, and cluster analysis was performed by the unweighted-pair group method using average linkages (UPGMA). PFGE types were determined as =80% similarity. MLST was based on seven E. faecium housekeeping genes (atpA, ddl, gdh, purk, gyd, pstS, and adk). Different sequences were assigned allele numbers, and different allelic profiles were assigned STs based on the MLST database (http://www.mlst.net/databases/). Analysis was performed using the eBURST version 3 algorithm implemented as a Java applet at http://eburst.mlst.net.

Microarray hybridization experiments were performed as previously described (Champagne et al., 2011). This enterococcal virulence microarray was developed (Diarra et al., 2010) at the National Research Council in Montreal and carries 70 taxonomic probes for species identification as well as 15 virulence factors, and 173 antibiotic resistance probes for a total of 262 probes. The microarray was used for the detection of putative target genes. Briefly, bacterial DNA isolated from single colonies was labeled with Cy5-dCTP (GE Healthcare, Little Chalfont, UK). Hybridization, washing, scanning, image processing, scoring, and data analysis were done as previously described (Champagne et al., 2011). Arrays were scanned by a ScanArray Express microarray Scanner (Packard Biosciences, Billerica, MA, USA). Oligonucleotide spots with a signal-to-noise fluorescence ratio above 3 were considered positive. Positive microarray results were confirmed by PCR with specific primers for the following genes tet(M), tet(O), tet(L), erm(B), agg and esp (Table 2). Since erm(AM) and erm(B) shared over 80% similarity and are perfectly correlated, they were considered as the same in this study as previously proposed (Roberts et al., 1999).

PCR amplifications of virulence genes acm and hyl and of the quinolone resistance-determining regions (QRDR) genes were performed as previously described (Nallapareddy et al., 2003; Vankerckhoven et al., 2004; Billstrom et al., 2008; Werner et al., 2010). The N-terminal and C-terminal regions of the pbp5 gene were amplified by PCR (Aarestrup et al., 2002; Poeta et al., 2007). Both strands of the purified QRDRs and pbp5 amplicon products were sequenced. Sequences of gyrA/B and parC/E were compared with the E. faecium DO genome (GenBank accession no. CP003583) whereas sequences of the C- and N-terminal regions of pbp5 gene were compared with pbp5 gene reference sequence (GenBank accession no. X84860).

All isolates were screened for rep-like sequences by PCR as previously described (Jensen et al., 2010) with few modifications (Table 2). Briefly, fourteen different rep-family plasmids (rep_1–2, rep₄, rep₆, rep_8–9, rep₁₁, rep_13–15, rep_16–18 and rep_Unique) were tested for their presence in E. faecium isolates. The PCR amplified and sequenced amplicons from selected strains (E. faecium strain no. 07-5598, M2146-08, 18581 and 16717) from this study were used as positive controls for rep_1–2, rep₄, rep₆, rep₁₄, rep_17–18 and rep_Unique whereas control strains for rep_8–9, rep₁₁, rep₁₃, and rep_15–16 were from a previous study (Tremblay et al., 2012). The families' rep₃, rep₅, rep₇, rep₁₀, and rep₁₉ could not be tested because no positive PCR products were obtained and no control strains were available.

The CRISPR1-cas and CRISPR3-cas loci were screened by PCR as previously described (Palmer and Gilmore, 2010) with slight modifications. Briefly, the PCR reactions were performed in a total of 50 μl, using 80 pmol of each primer, 1.5 mM MgCl₂, 10 mM each of dNTPs, 2 U of Taq DNA, 1X Buffer mix (New England Biolabs) and sample DNA. Amplification reactions were carried out using a Whatman Biometra thermocycler (Montreal Biotech Inc, Québec, Canada) programmed as follows: an initial denaturation step of 94°C for 2 min, 30 cycles of denaturation at 94°C for 1 min, annealing for 1 min and extension at 72°C for 1 min, followed by a final elongation at 72°C for 5 min. For visualization, 5 μl of the PCR reaction were subjected to electrophoresis in 1.2% agarose gel stained with ethidium bromide. A 100 bp ladder (TrackIt, Invitrogen, Ontario, Canada) was used as a marker. Enterococcus faecalis strain no. 02-A701 and 06-6225 were used as positive controls.

Isolates were inoculated in tryptic soy broth (TSB) supplemented with 1% glucose in 96 well microtiter plates (Fisher scientific) for bacterial growth and biofilm formation as described elsewhere (Zoletti et al., 2011). Biofilm was quantified using crystal violet staining method as described by Zoletti et al. (2011). Staphylococcus epidermidis ATCC 35984 (biofilm producer) and wells containing uninoculated medium were used as controls. ODs were obtained using a microplate reader Biotek Synergy HT (Bio-tek Instruments Inc., Winooski, VT, USA) at a wavelength of 570 nm. Analyses were based on two different experiments where isolates were tested in triplicate. The quantification of biofilm formation in microtiter plates was performed as previously described (Stepanovic et al., 2000, 2007). Briefly, strains were divided into the following categories: no biofilm producer (−), weak biofilm producer (+), moderate biofilm producer (++) and strong biofilm producer (+++), based upon the previously calculated OD values: OD ≤ ODc = no biofilm producer; ODc < OD ≤ 2X ODc = weak biofilm producer; 2X ODc < OD ≤ 4X ODc = moderate biofilm producer; 4X ODc < OD = strong biofilm producer. ODc is defined as three standard deviations (SD) above the mean OD of the negative control.

A chi-square exact test was used to examine the association between isolate, origin, antibiotic resistance, virulence genes, biofilm formation, plasmid families and CRISPR genes. Statistical analyses were carried out using SAS software v. 9.2 (SAS Institute Inc., Cary, N.C., USA). The level of statistical significance was set at 0.05.

MLST allelic profiles are presented in Table 1. A total of six STs were found among the E. faecium isolates, ST1 (n = 1), ST18 (n = 2), ST65 (n = 1), ST202 (n = 2), ST205 (n = 1) and one novel, ST803 (isolates M2146-08, M5853-09 and M20638-11) (Table 1). Canine ARE belonged to ST202 (n = 2) and ST803 (n = 3) both SLV of ST17. Human clinical isolates belonged to ST65 (n = 1), a singleton known to be found only among clinical strains (Werner et al., 2011), and ST205 (n = 1), a SLV of ST17 (Table 1). Human surveillance isolates belonged to ST18 (n = 2), and ST1 (n = 1, linked to CC1). Therefore, all these STs were linked to HA-ARE except for ST1 which was shown to belong to a cluster containing primarily isolates from calves in the Netherlands (http://efaecium.mlst.net/). Following genomic SmaI digestion and PFGE, the E. faecium isolates (n = 10) of human and canine origins produced ten macro-restriction patterns clustered into eight PFGE types, termed A through H (Table 1). Canine E. faecium isolates of subtypes A and E were ≥ 80% similar whereas the remaining E. faecium isolates were considered unrelated (≤80%). The E. faecium PFGE types B and H were set as a same group by MLST (ST18) whereas the new ST803 was grouped as PFGE types E and F (Table 1).

Chloramphenicol, ciprofloxacin, erythromycin, lincomycin, tylosin, gentamicin, kanamycin, streptomycin, penicillin, ampicillin, and tetracycline resistances were observed in E. faecium clinical isolates of canine origin with no resistance observed to daptomycin, linezolid, nitrofurantoin, quinupristin/dalfopristin, vancomycin and tigecycline (Tables 1, 3). Resistances to ciprofloxacin, erythromycin, lincomycin, tylosin, gentamicin, kanamycin, streptomycin, nitrofurantoin, penicillin, ampicillin, tetracycline and vancomycin but not to chloramphenicol, daptomycin, linezolid, quinupristin/dalfopristin and tigecycline were observed in human E. faecium clinical isolates (Tables 1, 3). All E. faecium isolates were resistant to ampicillin, ciprofloxacin and lincomycin. Seven isolates were considered as high-level ciprofloxacin-resistant (MICs of > 16 μg/ml) whereas nine isolates showed high-level ampicillin resistance (MICs of ≥ 256 μg/ml) (Table 3). Also, erythromycin resistance (n = 6) was positively associated (p-value < 0.05) with aminoglycoside resistance (n = 6), whereas ciprofloxacin resistance (n = 10) correlated (p-value < 0.05) with ampicillin (n = 9) resistances. All vancomycin resistant E. faecium (n = 3) isolates were of human origin.

Virulence and antibiotic resistant genotypes are presented in Table 1. Results demonstrated all canine ARE isolates were acm-positive but were negative for esp and hyl genes. The majority of these isolates were shown to harbor efaA_fm gene, encoding for a cell wall adhesin. One canine ARE isolate also had the agg gene encoding for an aggregation substance of pheromone-responsive plasmid. The efaA_fm gene was detected in all human isolates but one. The two human clinical isolates (CCRI-18707 and -18231) were also positive for the glycosyl hydrolase gene (hyl). Acquisition of multiple antibiotic resistance genes was observed ranging from 2 to 14 per isolate. Correlation between MICs and the presence of resistance genes has indicated that tetracycline resistance was attributable to tet(M) (n = 2); tet(M) and tet(L) (n = 3); and tet(M), tet(L) and tet(O) (n = 2). Resistance to erythromycin, lincomycin and tylosin could be explained by the presence of msrC, erm(AM)/ erm(B) in all strains with the exception of one (07-5598). Streptomycin resistance was associated with the aadE gene in all strains except one (07-5598). Kanamycin resistance was explained by aph(3′)-IIIa in all strains except two (07-5598 and M2971-08) whereas gentamicin resistance was attributable to aac(6′)-Ie-aph(2′)-Ia in all strains but two (07-5598 and CCRI-16717). Chloramphenicol resistance (n = 1) could not be explained because both cat and floR genes were absent in the two canine ARE resistant isolates. The gene aac(6′)-Ii is intrinsic in E. faecium and confers resistance to low-level aminoglycosides. Also, the transposase genes trans and trans1 (both GenBank accession no. AF516335) associated with transposons Tn1546 and Tn5405-like on the plasmid pUW786 carrying multiresistance gene cluster were identified in many isolates (n = 9). A correlation (p-value < 0.05) was observed between aadE (high-level streptomycin resistance), aph(3′)-IIIa, (aminoglycoside resistance), sat(4) (streptothricin acetyltransferase) and IS1182 transposase gene (also associated with plasmid pUW786) in human isolates of E. faecium (Diarra et al., 2010). The antibiotic resistance genes erm(AM)/erm(B) (macrolide-lincosamide-streptogramin B, MLS_b), aadE, sat(4), aph(3′)-IIIa were significantly (p-value < 0.05) associated with human isolates. Positive associations (p-value < 0.05) were observed between trans1 and IS150 transposase genes, aac(6′)-Ie-aph(2″)-Ia (encoding for a bi-functional aminoglycoside-modifying enzyme) and erm(AM)/erm(B). No beta-lactamase genes were detected in this study.

Enterococcus faecium isolates spanned a range of ciprofloxacin MICs from 4 μg/ml to > 256 μg/ml with seven isolates considered as high-level ciprofloxacin-resistant (MICs of > 16 μg/ml) (Table 3). High-level ciprofloxacin resistance was attributable to ParC (Ser80 → Arg, Ile or Asp; and Asn73 → Asp) and GyrA (Ser83 → Arg, Tyr, or Ile; Met127 → Trp; and Glu87 → Lys) mutations (Table 4). All high-level ciprofloxacin-resistant isolates had mutations in both GyrA (Ser83 → Arg or Tyr or Ile) and ParC (Ser80 → Arg or Ile or Asp). Corresponding fragments of subunits B (parE/gyrB) were also investigated. Two isolates demonstrated mutations in GyrB (Asp436 → Asn, Leu371 → Trp and Pro455 → Ser) whereas no changes in ParE were detected (Table 4). Isolates with MICs of < 16 μg/ml did not harbor mutational changes.

Nine isolates showed high-level ampicillin resistance (MICs of ≥ 256 μg/ml) with all canine ARE being high-level. Both the N-terminal and C-terminal regions were analyzed and revealed that PBP5 contained 25 amino acid changes, as shown in Table 5. The insertion of aspartic acid at position 466′ was mostly observed in isolates of animal origin. Alleles were designated 1-5 based on important amino acid substitutions in the C-terminal region with none showing 100% identity with the reference sequence (GenBank accession no. X84860). The same pbp5 alleles (alleles 1 and 2) were observed in clonal isolates with PFGE patterns A1 and A2 and E1 and E2.

Nine different rep-family plasmid genes (rep_1–2, rep₄, rep₆, rep₁₁, rep₁₄, rep_17–18 and rep_Unique) were detected in E. faecium isolates (Table 1). The predominant rep-family among E. faecium isolates was rep₁₁ (pEF1071) with seven isolates. Other rep-families were also observed: rep₁ (pIP501) (n = 2), rep₂ (pRE25) (n = 6), rep₄ (pMBB1) (n = 1), rep₆ (pS86) (n = 5), rep₁₄ (pRI1) (n = 5), rep₁₇ (pRUM) (n = 3), rep₁₈ (pEF418) (n = 1) and rep_Unique (pUB101) (n = 3). Overall, rep₁₁ and rep₆ families were significantly (p-value < 0.05) associated with isolates of canine origin. The families' rep_8–9, rep₁₃, and rep_15–16 were not detected.

To determine whether there is an association between CRISPR elements and plasmid family genes, virulence and/or antibiotic resistance genes, CRISPR-cas genes were investigated by PCR. Because potential sequence divergence among csn1 genes, an internal region of CRISPR-cas locus-specific genes, may lead to false-negative PCR results, isolates with negative PCR results were further screened with primers flanking the conserved locations of the CRISPR1-cas and CRISPR3-cas loci, between homologues of EF0672-EF0673 and EF1760-EF1759, respectively, as compared with the E. faecalis genome V583 (Palmer and Gilmore, 2010). According to Palmer and Gilmore (2010), one CRISPR-cas locus was identified in three E. faecium genomes. However, this locus could not be detected in our ten ARE strains. No significant correlations could be made with the absence of antibiotic resistance, virulence, and plasmid family genes due to low number of isolates.

Both isolates producing biofilm were recovered from infections, one weak and one strong both harboring the esp gene (Table 1), contrasting with those from surveillance. However, one ARE isolate which colonized a hospitalized patient was positive for the esp gene and did not produce a biofilm.

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.