Human bone marrow MSCs (ZQ0266, Shanghai Zhongqiaoxinzhou Biotech, Shanghai, China) were cultured in Dulbecco's modified Eagle's medium (DMEM)/F-12 medium (R8758, Sigma, St. Louis, MO, USA) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (SV30010, Beyotime Biotechnology, Shanghai, China). Human colonic epithelial cells (HCOEPICs; 2950, Shanghai Zhongqiaoxinzhou Biotech) were cultured in HCOEPIC Medium (2951, Shanghai Zhongqiaoxinzhou Biotech). Lipopolysaccharide (LPS; 10 μg/ml, 24 h) was used to stimulate the MSCs and HCOEPICs.

Exos were extracted from the MSC culture supernatant. Firstly, MSCs were divided into three groups, including a phosphate-buffered saline (PBS) group, an Exo group, and a LPS-Exos. The PBS group was a negative control without Exos. The Exo group and LPS-Exos were Exo extracted from MSCs that are not stimulated by LPS and stimulated via LPS (10 μg/ml, 24 h), respectively. To verify transfection efficiency, MSCs were divided into another three groups, containing the Exo group, an inhibitor-negative control (inhi-NC), and an inhibitor group. MSCs in the Exo group were treated the same way as before. MSCs in the inhi-NC and inhibitor groups were transfected with 100 nM scrambled sequences and inhibitor using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA) complexes, respectively. After a predetermined time, the Exos were isolated from the aforementioned MSCs. An Exo extraction kit (EXOQ5A-1, SBI, Palo Alto, CA, USA) was used according to the manufacturer's instructions. MSCs were cultured in serum-free DMEM. The supernatant was collected for 48–72 h, and Exos were extracted for subsequent detection. The extracted Exos were resuspended in PBS in an appropriate volume. The morphology and size of Exos were analyzed via transmission electron microscopy (TEM). The diameter of exosomal particles was further detected via Nanoparticle Tracking Analysis (NTA). Exos were labeled with live-cell fuel PKH26 (PKH26PCL, Sigma) and then cocultured with HCOEPICs for 12 h. The fluorescence of each group was observed by laser scanning confocal microscopy (LSCM). In the control group, the HCOEPICs were treated with the same volume of PBS as the Exo group for 12 h.

Forty healthy C57BL/6 mice (6–8 weeks old) were purchased from Hunan SJA Laboratory Animal Co., Ltd. (Hunan, China) and randomly divided into four groups (n = 10): (i) a control group (Control), (ii) a dextran sodium sulfate DSS group, (iii) an MSC-Exo group, and (iv) an LPS-MSC-Exo group. Mice with DSS treatment received 4% DSS in drinking water on days 3–9 to establish the DSS model. The MSC-Exos and LPS-MSC-Exo groups were treated with DSS in water and Exos (32 mg/kg) via intravenous injection on days 1, 3, 5, and 7, which were extracted from MSCs without or with LPS stimulation, respectively (20). On the last day of administration, the mice were anesthetized with 2% pentobarbital sodium (30 mg/kg). All the mice were given free access to water and food and were kept in an environment with a constant room temperature (25 ± 2°C), 55% humidity, and a 12/12-h light–dark cycle.

Next, the HCOEPICs were divided into four groups according to different processing methods: (i) a control group, (ii) an LPS group, (iii) an MSC-Exo group, and (iv) an LPS-MSC-Exo group in vitro. The cells in the control group were cultured normally. The cells in the LPS group were treated with LPS (10 μg/ml, 24 h) (21, 22). Furthermore, under LPS stimulation, the cells in the MSC-Exos and LPS-MSC-Exo groups were treated with Exos, which were extracted from MSCs without or with LPS stimulation for 24 h, respectively.

To further determine the effect of miR-181a in MSC-Exos on experimental colitis, 40 mice were randomly divided into four groups: (i) a control group, (ii) a DSS group, (iii) an MSC-con group, and (iv) an MSC-miR-181-inhibitor group (MSC-miR-181-inhi). Mice in the control and DSS groups were treated as above, respectively. The MSC-miR-181-inhibitor group was injected with Exos (32 mg/kg) extracted from MSCs that were transfected with miR-181-inhibitor. The MSC-con group was treated with Exos (32 mg/kg) extracted from MSCs that were transfected with negative control.

Then, in vitro assays were performed. The HCOEPICs were divided into another four groups according to different processing methods: (i) a control group, (ii) an LPS group, (iii) an MSC-con group, and (iv) an MSC-miR-181a-inhibitor group. The control and DSS groups were treated as described earlier. The cells in the MSC-con and MSC-miR-181a-inhibitor groups were treated with Exos derived from transfected cells under LPS stimulation. Next, the cells were collected for follow-up experiments.

After 4 h of fixation with 4% paraformaldehyde, the colonic tissues of mice were dehydrated, embedded, and sliced. After H&E staining, a microscope (BA210T, Motic, Kowloon, Hong Kong) was used to observe the pathological structure of the colon.

Colonic tissues were sectioned with paraffin wax, and apoptosis was detected using a TUNEL kit (40306ES50, Yeasen, Shanghai, China) according to the manufacturer's instructions. Tissue apoptosis was observed via fluorescence microscopy. Three fields were randomly selected to calculate the number of TUNEL-positive cells.

Serum and colonic TNF-α (CSB-E04741m, CusaBio, Wuhan, China), IL-6 (CSB-E04639m, CusaBio, China), IL-1β (CSB-E08054m, CusaBio, China), IL-17 (CSB-E04608m, CusaBio, China), IL-18 (CSB-E04609m, CusaBio, China), and myeloperoxidase (MPO) (A044-1-1, NanJing JianCheng Bioengineering Institute, Nanjing, China) quantitative ELISA kits were used according to the instructions. All experiments were repeated three times in each group.

To analyze HCOEPIC apoptosis, an Annexin V-FITC apoptosis detection kit (KGA108, KeyGEN, Nanjing, China) was used. According to the manufacturer's instructions, 500 μl of binding buffer was added to suspend the HCOEPICs, and then 5 μl of Annexin V-FITC was added. After mixing, 5 μl of propidium iodide was added and incubated with the cells at room temperature for 15 min. Cell apoptosis was analyzed via flow cytometry (A00-1-1102, Beckman, Brea, California, USA). The cells in the different groups were treated with 10 μM of DCFH-DA (mother liquid concentration: 10 mM) and incubated at 37°C for 20 min. The cells were washed three times with a serum-free medium and digested with trypsin. After cell collection, flow cytometry (A00-1-1102, Beckman) was used to detect reactive oxygen species (ROS) accumulation.

HCOEPICs in the logarithmic growth phase were digested and counted. The cells were seeded in 96-well-plates at a density of 1 × 10⁴ cells/well (100 μl/well). A 10% Cell Counting Kit 8 (CCK-8) solution (NU679, DOJINDO, Kumamoto, Japan) was added to each well and incubated with the cells at 37°C for 4 h. The absorbance was measured at 450 nm using a Bio-Tek microplate (MB-530, Heales, Shenzhen, China).

Total protein was from the mouse colonic tissue or HCOEPICs. The extracted protein in each group was quantified using a bicinchoninic acid (BCA) protein concentration determination kit (CB86198073, Chemical Book). The expression levels of CD81, CD63, TSG101, Claudin-1, ZO-1, TNF-α, IκB, Caspase-3, Bax, and Bcl-2 were detected by Western blotting. After blocking, the membranes were incubated with antibodies against CD81 (ab109201, 1:4,000, Abcam, Cambridge, UK), CD63 (25682-1-AP, 1:1,000, ProteinTech, Rosemont, IL, USA), TSG101 (14497-1-AP, 1:2,000, ProteinTech), Claudin-1 (1:4,000, 13050-1-AP, ProteinTech), ZO-1 (1:8,000, 21773-1-AP, ProteinTech), TNF-α (1:600, 17590-1-AP, ProteinTech), IκB (1:2,000, 10268-1-AP, ProteinTech), Caspase-3 (1:500, 19677-1-AP, ProteinTech), Bax (1:6,000, 50599-2-Ig, ProteinTech), and Bcl-2 (1:2,000, 12789-1-AP, ProteinTech) overnight at 4°C. The membranes were then rinsed three times with PBS-T and incubated with anti-rabbit IgG (1:6,000, SA00001-2, ProteinTech) and anti-mouse IgG (1:5,000, SA00001-1, ProteinTech) antibodies at room temperature for 1.5 h. After enhanced chemiluminescence (ECL) exposure, an Odyssey infrared imaging system (Li-Cor Biosciences, Lincoln, NE, USA) was used to detect the protein bands. β-Actin (1:5,000, 66009-1-Ig, ProteinTech) was used as the internal reference.

Total RNA was extracted from mouse colonic tissue, HCOEPICs, and Exos after treatment with TRIzol reagent (Thermo, USA). Total mRNA was used as a template to reverse transcribe cDNA. β-Actin was used as an internal reference to analyze the expression of miR-181a and mRNAs. The specific primers used for qRT-PCR were as follows: miR-181a-F, AACATTCAACGCTGTCGGTG, and miR-181a-R, RAGCCATAGGGTACAATCAAC-GGG; TNF-α-F, GAACCCCGAGTGACAAGCCT, and TNF-α-R, TATCTCTCAGCT-CCACGCCAT; IκB-F, CAAATCTTTCAGGGCAGAGTCCGA, and IκB-R, TGCCGAA-AAGAGGACAACCAC; β-actin-F, ACCCTGAAGTACCCCATCGAG, and β-actin-R, AGCACAGCCTGGATAGCAAC. PCR amplification was commonly used. The 2^−ΔΔCt method was used to measure the RNA expression levels.

Data were obtained from the Gene Expression Omnibus (GEO) database research cohort GSE68306. The samples were divided into a UC01 patient group (n = 20), UC02 patient group (n = 9), and normal control group (n = 16). The data type was miRNA chip. Differential miRNA expression was analyzed with the R package limma in the UC01 vs. normal and UC02 vs. normal groups. The screening criteria were |logFC| > 1 and P < 0.05. The R package heatmap was used to cluster the expression patterns of differentially expressed miRNAs in the two groups of samples, and heat maps of the two groups were drawn to screen the significantly low-expression miRNAs in the UC samples. Pearson correlation coefficient analysis was performed between the mRNA microarray data of GSE68306 and the selected differentially expressed miRNAs. The screening criterion was |Pearson correlation coefficient| > 0.75. Then, a coexpression network was constructed using Cytoscape software. The R package ClusterProfiler was used to annotate the Gene Ontology (GO) functions of differentially expressed mRNAs in the coexpression network, and the significantly enriched pathways were plotted.

Paraffin-embedded tissues were divided into four groups. After paraffin sections were dewaxed to water, antigen was heat repaired, endogenous enzymes were inactivated, and the tissues were incubated with primary antibodies against Claudin-1 (1:50, 13050-1-AP, ProteinTech) and ZO-1 (1:50, 21773-1-AP, ProteinTech). After being washed with PBS, the tissues were incubated with secondary antibody for 30 min. Then, DAPI solution was used to stain the nuclei at 37°C. Images were collected and analyzed using fluorescence microscopy and Image-Pro Plus (IPP) software (Media Cybernetics, Inc., Rockville, MD, USA).

According to the manufacturer's instructions, a fecal genomic DNA Kit (#DP328-02, TIANGEN, Beijing, China) was used to extract DNA. A dsDNA HS Assay Kit (12640ES76, Yeasen) was used to detect the concentration of extracted DNA. After amplification and purification, the whole genome of the sample was sequenced on an Illumina NovaSeq platform. After the original data for quality control were obtained, the species composition of the samples was analyzed by comparison with the Silva-132-99 database. QIIME 2 (QIIME 2-2020.2) and R software 4.0.2 were used for sequence data analysis.

Statistical analysis was performed using GraphPad Prism 8 Software (GraphPad Software, Inc., La Jolla, CA, USA). All data are presented as the mean ± standard error of mean (SEM). Differences between two or more groups were analyzed using unpaired t-tests or one-way analysis of variance. P < 0.05 indicated a significant difference.

To identify MSC-Exos, the round and oval vesicle-like structure of Exos was observed via TEM (Supplementary Figure 1A). NTA results showed that the exosomal particle diameter was concentrated at about 100 nm (Supplementary Figure 1B). Western blotting analysis showed that the expression levels of TSG101, CD81, and CD63 in Exos were higher in the LPS-MSC-Exo group than in the MSC-Exo group (Supplementary Figure 1C). To verify the ability of HCOEPICs to absorb Exos, an absorbance assay was performed. The control, in which PBS was added instead of MSC-Exos, did not show red fluorescence under LSCM. When HCOEPICs were cocultured with Exos (the Exo group), a large number of red vesicles gradually infiltrated the cells. Moreover, most of these proteins were concentrated in the cytoplasm (Supplementary Figure 1D). qRT-PCR results indicated that miR-181a was upregulated in Exos with and without LPS stimulation compared with the control group, and miR-181a was more highly expressed in Exos with LPS stimulation (Supplementary Figure 1E). These results indicate that HCOEPIC can effectively absorb Exos. Further, MSCs were transfected with miR-181a inhibitor. In the MSC-Exos miR-181a inhibitor group (inhibitor), the expression level of miR-181a was significantly reduced (Supplementary Figure 1F). These results indicate that we successfully extracted Exos from MSCs and that HCOEPIC effectively absorbed Exos. Additionally, the expression level of miR-181a in the Exos was noteworthy.

We established a DSS-induced colitis mouse model to investigate the effects of MSC-Exos on experimental colitis. Compared with that in the control group, the colon length in the DSS model group was shorter, which was significantly reversed in the MSC-Exos and LPS-MSC-Exo groups (Figure 1A). The results of H&E and TUNEL staining indicated that DSS treatment induced colonic injury, while the colon from the MSC-Exos and LPS-MSC-Exo groups showed less inflammatory cell infiltration, better structural integrity, and less apoptosis (Figures 1B,C). The expression of inflammatory cytokines in serum, including TNF-α, IL-6, IL-1β, IL-17, and IL-18, in the DSS group, was increased. In contrast, the serum inflammatory cytokines in MSC-exo-treated and LPS-MSC-exo-treated mice were decreased. Specifically, significant changes were observed in the expression of TNF-α, IL-6, and IL-1β. After MSC-Exo treatment, the expression levels of IL-1β, IL-17, and IL-18 had a decreasing trend (Figure 1D). These data suggested that both MSC-Exos and LPS-MSC-Exos played a protective role during colon inflammatory injury in DSS-induced colitis. In addition, LPS-MSC-Exos might be more efficient than MSC-Exos.

Next, we investigated whether MSC-Exos have a direct effect on HCOEPICs. Flow cytometry and CCK-8 assay results revealed that the cells in the MSC-Exos and LPS-MSC-Exo groups showed markedly rescued apoptosis and viability after LPS-induced injury (Figures 2A–C). To further determine the antiapoptotic effects of MSC-Exos, the expression of apoptosis-related proteins, including Caspase-3, Bax, and Bcl-2, were detected. The results demonstrated that the expression levels of Caspase-3 and Bax were increased in the LPS group compared with the control group. However, their expression levels were significantly decreased in the MSC-Exos and LPS-MSC-Exo groups compared with the LPS group. Bcl-2 showed the opposite pattern (Figure 2D). Together, the MSC-Exos contribute to protection against LPS-induced injury. More importantly, the Exos derived from LPS-induced MSCs might be more efficient. Furthermore, to determine the effect of TNF-α signaling in MSC-Exos on LPS-induced injury, qRT-PCR was performed. The results showed that the relative TNF-α expression was downregulated in the MSC-Exos and the LPS-MSC-Exo groups, while IκB expression was upregulated compared with that in the LPS group (Figure 2E). Moreover, Western blotting results showed that the expression levels of tight junction proteins, including Claudin-1 and ZO-1, were increased in the MSC-Exos and LPS-MSC-Exo groups compared with the LPS group (Figure 2F). These results indicate that the MSC-Exo group showed a good therapeutic effect in reversing LPS-induced injury in vitro. Specifically, the LPS-MSC-Exo group showed a better therapeutic effect. These results were consistent with those of the in vivo experiments.

Differential expression analysis of miRNAs associated with UC in normal and diseased samples showed differentially expressed miRNAs in Group 1 and 2 (volcano plot in Figures 3A,B). Forty differentially expressed miRNAs were shared by the two groups. Of these, 28 were downregulated and 12 were upregulated (Figure 3C). The clustering heat map showed the top 20 differentially expressed miRNAs that were significantly downregulated in Group 1 and 2 (Figures 3D,E). Box plots indicated the top four differentially expressed miRNAs decreased in both Group 1 and 2 (Figures 3F,G): miR-23a, miR-181a, miR-192, and miR-194. Of these, miR-181a was the most significantly different. Therefore, we focused on the regulatory mechanism of miR-181a in UC.

To forecast the potential biological function of miR-181a, we analyzed the coexpression network of differentially expressed miRNAs and mRNAs. As shown in Figure 4A, the blue circular nodes represent miRNAs, a total of 13 miRNAs, which were all significantly downregulated in patients with UC. The red rectangular nodes represent genes regulated by differentially expressed miRNAs (Figure 4A). In addition, GO and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses of miR-181a were performed. Significant GO annotation included BP (regulation of cellular amide metabolic process, regulation of translation, and response to steroid hormone), CC (chromatin, nuclear speck, and cytoplasmic ribonucleoprotein granule), and MF (transcription coregulator activity, proximal promoter sequence-specific DNA binding, and enhancer sequence-specific DNA binding) (Figure 4B). The main KEGG pathways were involved in miRNAs in cancer, glioma, and the p53 signaling pathway (Figure 4C).

To further investigate whether the effects of MSC-Exos in colitis mice were related to miR-181a, the DSS-induced mice were injected with Exos via a caudal vein extracted from human MSCs (hMSCs) transfected with miR-181a inhibitor. The results showed that the colon length in the MSC-con group was longer than that in the DSS group, while this was reversed in the MSC-miR-181a-inhi group (Figure 5A). Furthermore, mice in the MSC-Con groups had less severe colitis by H&E staining than in the DSS group (Figure 5B). However, in the MSC-miR-181a-inhi group, the protection effect of MSC-miR-181a against colitis was partially reversed. These results suggested that miR-181a in MSC-Exos might play an important role in recovery from colitis. Compared with the DSS group, the serum levels of inflammatory cytokines, including TNF-α, IL-6, IL-17, and IL-18, were downregulated in the MSC-con group. Moreover, the effects were reversed in the MSC-miR-181a-inhi group. Among them, the changes in the IL-6 concentration were significant (Figure 5C). In addition, the MPO concentration in colon tissue in the MSC-con group and MSC-miR-181a-inhi group was downregulated compared with that in the DSS model group (Figure 5D). To further investigate the mechanism of MSC-Exo-mediated protection on intestinal barrier function, Western blotting demonstrated that the expression levels of Claudin-1 and ZO-1 were significantly increased in the MSC-con group compared with the DSS group (Figure 5E). However, in the MSC-miR-181a-inhi group, the above impacts were significantly reversed. These results indicated that the Exos extracted from MSCs with miR-181a silenced reversed the therapeutic effects of MSC-Exos in colitis mice in vivo.

To further study the role of MSC-derived exosomal miR-181a on LPS-induced HCOEPICs in vitro, flow cytometry assays were conducted. The apoptosis and ROS results showed that the apoptosis and oxidative stress levels in the MSC-con group were significantly inhibited compared with those in the LPS group. However, the miR-181a inhibitor exacerbated the apoptosis and oxidative stress levels in the cells, in contrast to the MSC-con group (Figures 6A,B). Furthermore, Western blotting analysis of apoptosis-related proteins showed that compared with those in the LPS group, the expression levels of Caspase-3 and Bax were significantly decreased and those of Bcl-2 were increased in the MSC-con group. Notably, the opposite impacts were observed in the MSC-miR-181a-inhi group (Figure 6C). We wondered whether Exos affect the TNF-α/IκB signaling pathway in LPS-induced colitis; therefore, qRT-PCR and Western blotting experiments were performed. The expression levels of TNF-α were significantly downregulated at both the transcriptional and translational levels in the MSC-miR-181a-inhi group, while those of IκB were upregulated, in contrast to those in the MSC-con group (Figures 6D,E). The Western blotting results further showed that the expression levels of Claudin-1 and ZO-1 were significantly reversed in the MSC-miR-181a-inhi group compared with the MSC-con group (Figure 6F). Altogether, these results indicated that exosomal miR-181a mediated protection against LPS-induced inflammation. In addition, the TNF-α/IκB signaling pathway might be involved in the protective effect of miR-181a.

To further analyze whether MSC-Exos have effects on the gut microbiota structure in colitis mice, 16S rRNA sequencing was performed. The result of the rank-abundance graph showed that the richness and uniformity of each group of samples were eligible (Figure 7A). According to the results of operational taxonomic unit (OTU) cluster analysis, the Venn plot showed that the number of OTUs in the control group, DSS group, and MSC-Exo group was 230, 313, and 225, respectively, among which 85 were common OTUs (Figure 7B). ANOSIM analysis results showed the significant differences in community structure among the different groups (Figure 7C). Alpha diversity analysis showed that the observed OTUs, Chao1, and ACE indexes in the DSS group were higher than those in the control group. After treatment with MSC-Exos, we found that the indexes of observed OTUs, Chao1, and ACE were similar to those in the control group (Figure 7D). The relative abundance of species at the genus level showed the top 20 species, among which the expression abundance of Lactobacillus decreased in the DSS group, while the expression abundance of Bacteroides increased compared with the control group. After treatment with MSC-Exos, the changes in related bacteria were partially reversed. The expression abundance of Lactobacillus showed an upward trend, while that of Bacteroides showed a downward trend after treatment with MSC-Exos (Figure 7E). The relative abundance of species at the species level showed the top 20 species, among which the expression abundance of Lactobacillus_murinus decreased in the DSS group, while the expression abundance of g_Bacteroides_ASV_1 increased compared with that of the control group. After treatment with MSC-Exos, the changes in related bacteria were partially reversed. The expression abundance of Lactobacillus showed an upward trend, while that of Bacteroides showed a downward trend after treatment with MSC-Exos (Figure 7F). These results suggested that MSC-Exo treatment can alleviate the disturbance in the gut microbiota induced by DSS.