P. tricornutum Bohlin (CCMP2561) was prepared in this research. Microalga strain was purchased from the Freshwater Algae Culture Collection of the Institute of Hydrobiology, CAS, China (No. FACHB-863). Microalgae were cultured in f/2 si⁻ medium, which contains Na₂MoO₄ · 2H₂O and filtered using 0.22-μm filter membranes (Millipore, Billerica, MA, USA). PMo₁₂ (1 mol/L), which was purchased from TCI America, with purity of 99%, was added in the medium as a photocatalyst, and the culture was maintained at 21 ± 0.5°C under a light/dark cycle of 15 h and 9 h, respectively. The light intensity is 4,000 lx.

The growth of the algae was monitored daily for 10 consecutive days using a hemocytometer and microscope. The number of algal cells was counted under an inverted microscope with a blood cell counting plate at the same time each day during the growth cycle. The growth status of the algal cells was calculated using the formula: cell density = (total number of 80 small square cells/80) × 4 × 10⁶ × dilution times, and the growth curve was generated.

The morphology of engineered microalgae cells was observed under laser scanning confocal microscope LSM 510 META (Zeiss, Oberkochen, Germany). After culture to the plateau stage (7 days), 1 mL algal solution was taken into 1.5 mL EP tube, and 10 μL Nile red solution (0.1mg/mL, soluble in acetone) was added to the algal solution, then incubated for 30 min under 37℃ in the dark. The fluorescence detection was 488 nm for excitation and 505–550 nm for emission.

Nile red as a fluorescent marker has been widely used in the determination of neutral lipid content in cells. Consequently, Nile red was employed as a fluorescent probe to assess the neutral lipid content in P. tricornutum cells (Yang et al., 2013). Algal cells were initially collected using a refrigerated centrifuge, followed by treatment with 20% DMSO for 20 min at room temperature. A total of 30 μL of Nile red, dissolved in 0.1 mg/mL acetone, was added to a 3-mL aliquot of pretreated cell culture in triplicates. The mixture was inverted rapidly and shielded with tin foil for 20 min at room temperature. Subsequently, the P. tricornutum cell cultures were transferred to a 96-well plate for fluorescence intensity determination using a Hitachi F4600 microplate reader (Hitachi, Japan). Fluorescence intensity was measured at 580 nm under 530 nm light excitation, with the intensity of the unstained algal liquid at this wavelength subtracted from the readings. Concurrently, the density of algal cells was assessed using a hemocytometer and microscope, enabling the calculation of neutral lipid content per algal cell.

Fatty acid composition of microalgae was detected by the previous research (Yang et al., 2013). The fatty acid extraction steps are as follows: first, diatom cells were harvested by centrifugation at 3,000×g for 10 min at 4°C. Then, 5 mL KOH–CH₃OH(2 mol/L) was added to the cell culture. After ultrasonic breaking in an ice bath, the cell culture was filled with nitrogen for 1 min. The crushed algal cell culture was shaken with a turbine shaker and then reacted in a water bath at 75°C for 10 min. The layering is left standing at room temperature, and the supernatant is transferred to a new centrifuge tube. The above steps were repeated twice, and all the supernatant was collected in a centrifuge tube. Then, 4 mL of n-hexane was added to the centrifuge tube, and the upper extract was transferred to a new centrifuge tube after standing for stratification. Total lipids of microalgae were detected by gas chromatography–mass spectrometry according to Yang et al. (GC-MS) (Finnigan TRACE DSQ; Thermo Fisher, Waltham, MA, USA) at the Guangdong University of Technology. To calculate the content of EPA and DHA at dry cell weight (DCW), 150 μL of N-nonadecyl ester (1 mg/mL) was added as an internal standard to the samples for analysis of fatty acid composition by gas chromatography−mass spectrometry (GC−MS). The concentration of fatty acids (C_FA, mg/g) was determined by comparing the peak area of fatty acid in the sample with the peak area of internal standard, according to the following equation: C_FA = A_S/A_IS × C_IS/W_S, where A indicates the peak area; C is the concentration; W is the weight; IS is the internal standard; S is the sample (Abdulkadir and Tsuchiya, 2008).

To investigate the influence of PMo₁₂ on regulatory genes associated with lipid metabolism in Phaeodactylum tricornutum, several molecular biological experiments were conducted. For the detection of mRNA expression levels in P. tricornutum, quantitative real-time PCR (qPCR) was performed. The target gene are Δ5 fatty acid desaturase gene (PTD5b), Δ4 fatty acid desaturase gene (PTD4), and glycerol-3-phosphate acyltransferase (PTGPAT). Primers used for qPCR were as follows: Δ5 fatty acid desaturase gene PTD5b (forward primer, CATCACGGACCCAATCAATAC; reverse primer, CGACGGACAATCTGGAAGAC), PTD4 (forward primer, GCGAC GATTGGGCTTGACCT; reverse primer, TCCG TGGAT GATG CTTTGATTTCT), PTGPAT (forward primer, ACGATTCGGACGAAGATCAG; reverse primer, CCA TGCAACAATCGTAGTGG), and β-actin (forward primer, AGGCAAAGCGTGGTGTT CTTA; reverse primer, TCTGGGGAGCCTCAGTCAATA). In P. tricornutum genome, putative β-actin (ACT1, Phatrdraft_51157) was used as a housekeeping marker. The relative expression level of PTD5b, PTD4, and PTGPAT gene was calculated by normalization to β-actin expression.

Cultured solution of P. tricornutum after a culture cycle was dried at 95℃, then resolved in D₂O for ³¹P NMR; the spectral data were collected on a Bruker Avance/DMX 400MHz NMR spectrometer with an 8-s pulse delay, and the internal standard is triphenyl phosphate (TPP).

SPSS software was used for statistical analysis. In the study, we used t-test to analyze whether there were significant differences between the experimental algae strains and wild strains. p<0.05 indicates a significant difference, p < 0.01 indicates an extremely significant difference.

As shown in the growth curves, the overexpression of Δ5 fatty acid desaturase gene in P. tricornutum did not adversely affect the growth of the algae ( Figure 1A ). Moreover, the growth rate of the microalgae with PMo₁₂ (1mol/L) added to the medium was slightly slower compared to both the wild-type and transgenic strains. Notably, during the late exponential growth phase, the algae with PMo₁₂ supplementation exhibited a significantly lower growth rate than the wild type, and the inclusion of PMo₁₂ caused P. tricornutum to enter the decline phase more rapidly. The slower growth rate observed in P. tricornutum supplemented with PMo₁₂ may be attributed to the photocatalytic properties of PMo₁₂. As a photocatalyst, PMo₁₂ can oxidize and degrade photosynthetic products under light conditions. These products, including natural antioxidants, carotenoids, proteins, polysaccharides, PUFAs, triacylglycerols (TAGs), sterols, and vitamins, are crucial for the growth and survival of P. tricornutum. The degradation of these essential compounds likely contributes to the observed reduction in growth rate.

Observations from confocal laser scanning microscopy indicated that the morphology and size of the engineered microalgae cells were comparable to those of the wild type. However, the volume of organelles (oil bodies) storing triacylglycerol (TAG) in the engineered microalgae strains was significantly larger, and their number was also slightly increased ( Figure 2 ). Furthermore, when compared to transgenic algae, the volume and number of organelles (oil bodies) storing TAG in engineered algae strains treated with PMo₁₂ (1 mol/L) showed a slight increase. The neutral lipid content in microalgae supplemented with PMo₁₂ (1mol/L) demonstrated a notable increase of 69.7% and 25.7% compared to the wild-type and transgenic microalgae, respectively ( Figure 1B ). These findings suggest that PMo₁₂ more effectively promotes neutral lipid accumulation in P. tricornutum than the overexpression of the PtD5b gene. Monoacylglycerols (MAGLs), diacylglycerols (DAGs), and triacylglycerols (TAGs) are the most abundant neutral lipids found in the microalgae (Muñoz et al., 2021). A substantial accumulation of TAG has been observed in the microalgae Nannochloropsis gaditana under nitrogen starvation conditions (Janssen et al., 2018). The first step of TAG synthesis is catalyzed by glycerol 3-phosphate acyltransferase (GPAT), which is considered a key regulator in this process (Yu et al., 2018). The overexpression of endogenous GPAT in the P. tricornutum resulted in a significant increase in neutral lipid accumulation compared to the wild type, without any growth inhibition (Niu et al., 2016; Balamurugan et al., 2017; Wang et al., 2020). The subsequent enzyme in TAG synthesis, lysophosphatidic acid acyltransferase (LPAT), has also been overexpressed in C. reinhardtii, leading to an increase in lipid content (Yamaoka et al., 2016). Diacylglycerol acyltransferase (DGAT) is the final enzyme involved in triacylglycerol (TAG) synthesis, and the overexpression of genes encoding DGAT has emerged as a promising strategy for enhancing TAG content in microalgae, including C. reinhardtii, Nannochloropsis, and Phaeodactylum (La Russa et al., 2012; Ahmad et al., 2014; Zienkiewicz et al., 2017). In this context, PMo₁₂ may be considered a putative positive regulator of genes related to GPAT or DGAT.

The results indicate that the contents of polyunsaturated fatty acid (PUFA), monounsaturated fatty acid (MUFA), and saturated fatty acid (SFA) in P. tricornutum have significantly increased due to PMo₁₂ ( Figure 1C ). Specifically, the contents of EPA and overall PUFA nearly doubled in P. tricornutum with PMo₁₂ treatment, while both MUFA and SFA also exhibited significant increases compared to the wild type. Similar results were observed in transgenic microalgae. However, it is noteworthy that the content of DHA in P. tricornutum decreased by 27.2% with PMo₁₂ compared to the transgenic microalgae. The fatty acid desaturases (FADs) and elongases (ELOs) are critical enzymes in PUFA synthesis, and regulating the expression of these genes through genetic engineering is a common approach to enhance PUFA accumulation in P. tricornutum. The results suggest that PMo₁₂ may stimulate the expression of genes related to fatty acid desaturases and elongases, thereby promoting PUFA and EPA synthesis in P. tricornutum. In contrast, the key enzymes involved in DHA synthesis in P. tricornutum exhibited lower activity than the overexpression of PtD5b. Previous research has identified Δ4-FAD as a critical enzyme for DHA synthesis in microalgae. For instance, overexpression of Δ4-FAD in C. reinhardtii resulted in a 66.7% increase in total monogalactosyldiacylglycerol (MGDG) content (Zäuner et al., 2012). Future studies should focus on the key enzymes involved in DHA synthesis in microalgae to further understand and optimize DHA production.

The transcript abundance of PTD5b in P. tricornutum was quantified using qPCR ( Figure 3A ), revealing a similar increase of 3.1-fold in both transgenic and PMo₁₂ compared to the wild type. Δ5-FAD is the key enzyme responsible for EPA synthesis in P. tricornutum. The results indicate that PMo₁₂ exhibits effects comparable to those of genes associated with the overexpression of Δ5 fatty acid desaturase in P. tricornutum, leading to a greater accumulation of EPA relative to the wild type. In contrast, Δ4 fatty acid desaturase (Δ4-FAD) serves as the key regulator of DHA synthesis in microalgae. The mRNA expression of the PTD4 gene was assessed through qPCR ( Figure 3B ), showing a relative expression level that increased by 2.3-fold in transgenic microalgae compared to the wild type. However, the mRNA expression of the PTD4 gene in PMo₁₂ was similar to that of the wild type, suggesting that PMo₁₂ negatively affects the expression of Δ4 fatty acid desaturase-related genes in P. tricornutum. Additionally, the transcript abundance of PTGPAT was also measured using qPCR ( Figure 3C ), revealing significant increases of 3.1- and 4.3-fold in transgenic microalgae and PMo₁₂, respectively, compared to the wild type. Thus, PMo₁₂ promotes the expression of the GPAT gene in P. tricornutum more effectively than in transgenic algae. Overall, these results demonstrate that PMo₁₂ enhances the accumulation of neutral lipids in P. tricornutum more effectively than genetic engineering approaches involving transgenic microalgae.

The ³¹P NMR results indicate peak species at −3.75 ppm and −5.36 ppm ( Figure 4 ). According to the NMR spectrum, PMo₁₂ and its reduced form are present independently in the microalgal culture medium after one culture cycle (Ishikawa and Yamase, 2000). Previous studies have shown that PMo₁₂ acts as an oxidizing agent capable of catalyzing biomass degradation and functioning as an electron donor. The redox reaction cannot occur at room temperature, and PMo₁₂ is only effective when exposed to light or elevated temperatures. In this study, carbohydrates produced through algal photosynthesis, such as starch, are degraded by PMo₁₂ under illuminated conditions, leading to the generation of CO₂. Subsequently, the reduced form of phosphomolybdate is reoxidized to its original state by oxygen produced during photosynthesis. This principle can be illustrated by the following reactions (Liu et al., 2016):

Consequently, PMo₁₂ has been demonstrated to enhance the accumulation of neutral lipids and PUFAs in P. tricornutum by modulating the algal photosynthetic processes.