<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Mar. Sci.</journal-id>
<journal-title>Frontiers in Marine Science</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Mar. Sci.</abbrev-journal-title>
<issn pub-type="epub">2296-7745</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fmars.2023.1257343</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Marine Science</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Propidium Monoazide based selective iDNA monitoring method improves eDNA monitoring for harmful algal bloom <italic>Alexandrium</italic> species</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Yun</surname>
<given-names>Kun-Woo</given-names>
</name>
<uri xlink:href="https://loop.frontiersin.org/people/2433469"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Son</surname>
<given-names>Hwa-Seong</given-names>
</name>
<uri xlink:href="https://loop.frontiersin.org/people/2433478"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Seong</surname>
<given-names>Min-Jun</given-names>
</name>
<uri xlink:href="https://loop.frontiersin.org/people/2433482"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Kim</surname>
<given-names>Mu-Chan</given-names>
</name>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2375158"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<institution>Department of Marine Environmental Engineering, Gyeongsang National University</institution>, <addr-line>Tongyeong, Gyeongnam</addr-line>, <country>Republic of Korea</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Conghui Liu, Chinese Academy of Agricultural Sciences, China</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Feng Zhao, Chinese Academy of Sciences (CAS), China; Hyun Woo Kim, Pukyong National University, Republic of Korea</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Mu-Chan Kim, <email xlink:href="mailto:kmc81@gnu.ac.kr">kmc81@gnu.ac.kr</email>
</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>15</day>
<month>09</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>10</volume>
<elocation-id>1257343</elocation-id>
<history>
<date date-type="received">
<day>12</day>
<month>07</month>
<year>2023</year>
</date>
<date date-type="accepted">
<day>29</day>
<month>08</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Yun, Son, Seong and Kim</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Yun, Son, Seong and Kim</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>eDNA, also known as environmental DNA, has garnered significant attention due to its potential applications in various fields such as biodiversity assessment, species distribution monitoring, ecological interaction analysis, and quantitative analysis. However, the presence of non-selective DNA signals in eDNA samples poses challenges in accurately detecting species, assessing biodiversity, and conducting quantitative analysis. To address these limitations, this study developed a novel method for selectively detecting iDNA from specific species in eDNA samples. The method involved the application of PMA treatment to <italic>Alexandrium</italic> spp. effectively preventing the detection of non-selective exDNA signals. Additionally, by optimizing the filter size used in the sampling process, the researchers were able to selectively collect and analyze iDNA from species of interest, particularly <italic>Alexandrium</italic> spp. Furthermore, the study successfully demonstrated the selective collection and analysis of iDNA from <italic>Alexandrium</italic> spp. cysts present in the sediment layer, further strengthening the findings. The results indicated that the combined use of PMA treatment and filter size optimization significantly enhanced the selective detection capability of iDNA. The successful selective detection of iDNA from eDNA in the sediment layer highlights the practical applicability of the developed method. This study holds promise for advancing eDNA monitoring technology by providing a selective iDNA detection method utilizing PMA. Moreover, these findings lay the foundation for effectively utilizing iDNA in environmental conservation, monitoring, and ecological research.</p>
</abstract>
<kwd-group>
<kwd>eDNA</kwd>
<kwd>IDNA</kwd>
<kwd>exDNA</kwd>
<kwd>
<italic>Alexandrium</italic> spp.</kwd>
<kwd>filter size optimization</kwd>
<kwd>selective detection</kwd>
<kwd>quantitative analysis</kwd>
</kwd-group>
<contract-sponsor id="cn001">Ministry of Oceans and Fisheries<named-content content-type="fundref-id">10.13039/501100003566</named-content>
</contract-sponsor>
<counts>
<fig-count count="9"/>
<table-count count="3"/>
<equation-count count="0"/>
<ref-count count="42"/>
<page-count count="12"/>
<word-count count="6138"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Marine Molecular Biology and Ecology</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Harmful algal blooms (HABs) are widespread, with severe implications for public health and aquatic ecosystems. They can significantly negatively impact fisheries, leading to reduced productivity and economic losses. <italic>Alexandrium</italic> spp. is a species known to cause HABs and is one of the organisms responsible for paralytic shellfish poisoning (PSP), a serious threat to human health when contaminated shellfish are consumed (<xref ref-type="bibr" rid="B37">Samsur et&#xa0;al., 2006</xref>). <italic>Alexandrium</italic> spp. produce saxitoxins (<xref ref-type="bibr" rid="B42">Whedon, 1936</xref>), which can accumulate in shellfish such as mussels, clams, and oysters and have harmful or fatal effects on humans or animals that consume them. Impacts of PSP outbreaks include poisoning and death from contaminated shellfish or fish, loss of wild and farmed seafood resources, damage to tourism and recreational activities, changes in ocean trophic structure, and deaths of marine mammals, fish, and seabirds (<xref ref-type="bibr" rid="B4">Anderson et&#xa0;al., 2012</xref>). This distribution of <italic>Alexandrium</italic> spp. has expanded to regional and global scales (<xref ref-type="bibr" rid="B17">Hallegraeff and Bolch, 1992</xref>).</p>
<p>
<italic>Alexandrium</italic> spp. reproduce by both asexual and sexual reproductive cycles (<xref ref-type="bibr" rid="B2">Anderson, 1980</xref>), with trophozoites developing into blooms through cell division. Sexual reproduction results in the formation of swimming zygotes (planozygotes) by sexual induction, which develop into dormant spores in subsequent stages (<xref ref-type="bibr" rid="B3">Anderson, 1998</xref>). This sexual reproduction may contribute to maintaining genetic heterogeneity and maintaining and enhancing adaptability to the environment. Moreover, spores are more resistant to unfavorable environments compared to trophozoites and play an important role as a seed population for subsequent seasonal flowering the following year (<xref ref-type="bibr" rid="B6">Anderson and Wall, 1978</xref>). Therefore, it is very important to monitor the density distribution of cells and dormant spores in order to minimize PSP. However, it is difficult to identify microalgae by morphological features and dormant spores do not have species-specific morphological features that can be distinguished (<xref ref-type="bibr" rid="B14">Fukuyo, 1985</xref>). Furthermore, these methods require specialized expertise (<xref ref-type="bibr" rid="B19">Hopkins and Freckleton, 2002</xref>).</p>
<p>Environmental DNA (eDNA) refers to genetic material acquired from environmental samples, encompassing DNA originating from a wide range of sources including unicellular or small multicellular organisms, tissue particles (such as shed cells and feces), as well as gametes from multicellular organisms. Furthermore, eDNA also includes distinct fractions such as extracellular DNA (exDNA) and intracellular DNA (iDNA) (<xref ref-type="bibr" rid="B34">Pietramellara et&#xa0;al., 2009</xref>; <xref ref-type="bibr" rid="B30">Nagler et&#xa0;al., 2022</xref>). eDNA has emerged as a valuable tool for monitoring the presence and distribution of aquatic organisms (<xref ref-type="bibr" rid="B24">Lawson Handley, 2015</xref>). eDNA-based monitoring allows for qualitative detection using metabarcoding (<xref ref-type="bibr" rid="B15">Grzebyk et&#xa0;al., 2017</xref>) and quantitative analysis of single species using quantitative polymerase chain reaction (qPCR) with species-specific primers and probes (<xref ref-type="bibr" rid="B36">Salter et&#xa0;al., 2019</xref>). In comparison to conventional monitoring methods, eDNA monitoring offers advantages. Traditional monitoring relies on the ability to discern morphological characteristics, a task that can be challenging or even unfeasible for elusive organisms, such as microbes, which are difficult to identify. However, eDNA-based approaches overcome these limitations by relying solely on the organism&#x2019;s DNA for identification. Additionally, while conventional monitoring involves time-consuming field sampling, sample sorting, and consulting identification guidebooks, eDNA monitoring offers a relatively easy and rapid process of water sampling and species identification. Quantifying biomass directly at the eDNA level in seawater samples is difficult (<xref ref-type="bibr" rid="B16">G&#xfc;nther et&#xa0;al., 2018</xref>). Presumably, this is because eDNA decays at different rates depending on environmental variables such as temperature, UV, pH, etc. (<xref ref-type="bibr" rid="B39">Strickler et&#xa0;al., 2015</xref>) and varies with organism distribution and habitat. Nevertheless, assessment of eDNA diversity and species can provide a more accurate approximation than traditional monitoring, and quantitative analysis of eDNA using qPCR is showing promise (<xref ref-type="bibr" rid="B33">Park et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B41">Valentini et&#xa0;al., 2016</xref>; <xref ref-type="bibr" rid="B35">Pont et&#xa0;al., 2023</xref>). While a cell is in a viable state, iDNA can remain relatively stable and contains the genetic information of that cell. On the other hand, exDNA is the DNA of an organism that has been released into the external environment. It can be derived from cellular decay, cellular effluents, feces, or dead organisms. Detection of exDNA is likely to overestimate microbial abundance by up to 55% (<xref ref-type="bibr" rid="B8">Carini et&#xa0;al., 2016</xref>) and detect organisms that have already died or moved on to other locations. If only iDNA can be selectively collected, quantitative changes in iDNA can indicate when a cell or organism is surviving or when cells are actively reproducing. Also, since iDNA is related to cell number, it can be correlated with cell density or biomass.</p>
<p>Propidium monoazide (PMA) is a photoreactive binding reagent (<xref ref-type="bibr" rid="B32">Nocker and Camper, 2006</xref>) that is impermeable to cell membranes. This means that PMA is permeable to the DNA of damaged or dead cells, but does not bind to the DNA of normally viable cells. Because of this property, PMA can be utilized to reduce false positives by binding to exDNA. PMA tends not to bind effectively to iDNA. This is because PMA is only permeable to the damaged cell membrane, whereas iDNA located inside the cell is more reliably protected. Therefore, the application of PMA to eDNA samples enables selective binding to exDNA, predominantly situated outside the cell. This approach facilitates the exclusive detection of iDNA, significantly enhancing the precision of eDNA monitoring. By detecting only DNA present within intact cells, this approach reduces potential false positives due to exDNA and enables sensitive detection of eDNA signals associated with microbial activity or the presence of biological species. In conclusion, PMA can reduce false positives in eDNA monitoring by selectively binding to exDNA as a photo-reactive DNA insertion agent. This can help minimize the influence of iDNA and obtain accurate biological information.</p>
<p>In this study, the applicability of PMA to cells and dormant spores of the marine harmful alga <italic>Alexandrium</italic> spp. was evaluated, and the feasibility of iDNA monitoring was confirmed by comparing live and dead cells at known concentrations. In addition, only iDNA was selectively collected from field samples by filtering seawater using pore size-specific filters, and the eDNA present in sediments was compared by the PMA-iDNA method. Thus, the PMA-iDNA monitoring method is expected to contribute to quantitative eDNA monitoring techniques by reducing the possibility of false positives. In addition, given the characteristics of iDNA, it is expected to provide a more accurate estimate of the presence or activity of living cells. The introduction of these PMA-iDNA monitoring techniques is expected to improve the reliability and usefulness of eDNA monitoring in various fields such as environmental monitoring, ecological research, and aquatic life management.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Target species and controls</title>
<p>The target species <italic>Alexandrium catenella</italic> (LIMS-PS-3427), <italic>A. Pacificum</italic> (LIMS-PS-2611), and <italic>Gymnodinium impudicum</italic>, (LIMS-PS-3373) were obtained from the Library of Marine Samples (LIMS, Korea) in May 2022. In addition, <italic>Thalassionema</italic> spp., <italic>Skeletonema</italic> spp., <italic>Nitzschia</italic> spp., and <italic>Akashiwo sanguinea</italic> were collected, isolated, and cultured under a microscope. In addition, the dominant species <italic>Alexandrium tamarense</italic> was collected from Masan Bay, Korea in April 2023 and isolated and cultured. They were amplified using Euk-A (5&#x2032;-AACCTGGTTGATCCTGCCAGT-3&#x2032;) and Euk-B (5&#x2032;-GATCCTTCTGCAGGTTCACCTAC-3&#x2032;) primers (<xref ref-type="bibr" rid="B27">Medlin et&#xa0;al, 1988</xref>). Species identification was made by sequencing, and all were used as controls for false positive tests. All organisms were cultured for at least 6 weeks in f/2 medium under fluorescent lights with a 24 hr photoperiod of 3,000-10,000 Lux at a temperature of 20 &#xb1; 2&#xb0;C<italic>. A. catenella</italic> cells were cultured for 4 weeks at 15&#xb0;C without f/2 medium to induce cyst formation. <italic>A. catenella</italic> cells, cysts, and A. <italic>tamarense</italic> cells were diluted to concentrations ranging from 10,000-1, 6,000-1, and 50,000-5 cells/mL, respectively, in order to create a standard curve for qPCR quantification. It&#x2019;s important to acknowledge that variations in cell size can lead to varying amounts of DNA when using DNA dilution methods (<xref ref-type="bibr" rid="B7">Behrenfeld et&#xa0;al., 2021</xref>). These standard curves provide a means to accurately determine the concentration of <italic>A. catenella</italic> cells, cysts, and <italic>A. tamarense</italic> based on their corresponding Ct values, enabling precise quantitative analysis (<xref ref-type="bibr" rid="B25">Lee et&#xa0;al., 2017</xref>).</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Cell disruption and PMA treatment</title>
<p>To selectively detect only iDNA using PMA, exDNA was generated using two methods: heat treatment of <italic>A. catenella</italic> cells (1,000 cells/mL) and cyst cultures (1,000 cells/mL) at 60&#xb0;C for 30 min and exposure to 1% Triton x-100 (Junsei, Japan) for 10 min to selectively disrupt cell membranes. Dead cells were assumed to be exDNA and non-dead cells were assumed to be iDNA. The iDNA and exDNA were mixed at ratios of 100, 75, 50, 25, and 0% (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>) and the mixed DNA was defined as eDNA. Samples for each concentration were treated with 10 mM of PMAxx&#x2122; dye (Biotium, USA). The samples were incubated in the dark at room temperature for 10 min and then exposed to blue LED on ice for 30 min. Furthermore, to add credibility to, we utilized <italic>A. tamarense</italic> at a concentration of 1,000 cells/mL. The sample was partitioned into two distinct groups representing 100% and 0% viable cell counts, achieved through treatment with Triton X-100. The evaluation was organized into the following experimental groups: A) PMA untreated, DNase untreated, B) PMA untreated, DNase treated, C) PMA treated, DNase treated, D) PMA treated, DNase untreated. The DNase treatment was administered, with a 5 &#x3bc;L volume used instead of the manufacturer-recommended 1 &#x3bc;L, as per their protocol, employing DNase I, RNase-free (Thermo Scientific, USA). Additionally, Group C involved treating with DNase first, followed by the application of PMA. Each sample was centrifuged at 13,000 x g for 5 min and extracted using the AccuPrep<sup>&#xae;</sup> Plant Genomic DNA Extraction Kit (Bioneer, Korea) according to the manufacturer&#x2019;s instructions.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>exDNA and iDNA mixing ratios for quantification of <italic>A.catenella</italic>, and <italic>A. tamarense</italic> PMA-iDNA.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="center"/>
<th valign="top" align="center">100%</th>
<th valign="top" align="center">75%</th>
<th valign="top" align="center">50%</th>
<th valign="top" align="center">25%</th>
<th valign="top" align="center">0%</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="center">iDNA (cells/mL)</td>
<td valign="top" align="center">1000</td>
<td valign="top" align="center">750</td>
<td valign="top" align="center">500</td>
<td valign="top" align="center">250</td>
<td valign="top" align="center">0</td>
</tr>
<tr>
<td valign="top" align="center">exDNA (cells/mL)</td>
<td valign="top" align="center">0</td>
<td valign="top" align="center">250</td>
<td valign="top" align="center">500</td>
<td valign="top" align="center">750</td>
<td valign="top" align="center">1000</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>DNA extraction and primer design for quantitative analysis</title>
<p>Primer was designed to specifically detect the LSU region of the <italic>A. catenella</italic> 18s rRNA gene (DQ785887.1) from the National Center for Biotechnology Information (<ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/blast">http://www.ncbi.nlm.nih.gov/blast</ext-link>) using Primer 3 (Whitehead Institute and Howard Hughes Medical Institute, MD) and Oligo Calc (Oligonucleotide Properties Calculator software). Multiple sequence alignments were performed using the NCBI, and data were visualized using NCBI MSA Viewer to confirm species specificity (<xref ref-type="supplementary-material" rid="SM1">
<bold>Figure S1</bold>
</xref>).</p>
<p>The designed primer sets Alx2 Forward (5&#x2032;ATTTTCCTGCGGGGTGTGGA&#x2032;3), and Alx2 Reverse (5&#x2032;TCCGTGTTTCAAGACGGGGTCA&#x2032;3) were used to adjust the qPCR template final concentration to 20 &#x3bc;L. qPCR template was 10 &#x3bc;L Prime Q-Master Mix with UDG (Genetbio, Korea), 7 &#x3bc;L tertiary distilled water, 1 &#x3bc;L Alx2 Foward, 1 &#x3bc;L Alx2 Reverse, and 1 &#x3bc;L DNA template. SYBR Green qPCR was performed using a CFX Opus 96 (BioRad, USA) at 95&#xb0;C for 5 min with 35 cycles (95&#xb0;C for 30 sec, 59&#xb0;C for 30 sec, 72&#xb0;C for 30 sec), and all qPCR runs were performed in triplicate for reliability.</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Field sampling methods and marine samples preparation</title>
<p>Masan Bay, a representative semi-enclosed sea in South Korea, is well known for its contaminated waters in the past. In April 2023, samples were collected at 3 Stations in Masan Bay (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>). All filters used in the study have a diameter of 47 mm. The filter pore size was set to 30 &#x3bc;m in order to selectively collect iDNA, considering the typical size range of <italic>Alexandrium</italic> spp. (30-40 &#x3bc;m) (<xref ref-type="bibr" rid="B5">Anderson et&#xa0;al., 2005</xref>). To compare PMA-iDNA monitoring, samples from the field were taken to the lab and subjected to comparison using filters commonly utilized in many eDNA studies, specifically 0.2, and 1.2 &#x3bc;m filters (<xref ref-type="bibr" rid="B23">Lacoursi&#xe8;re-Roussel et&#xa0;al., 2016</xref>). To selectively collect and compare iDNA, seawater filtration in the field was improvised using a filter with 30 &#x3bc;m pores and a custom 3D-printed filter holder connected to a pump (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>; <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). The filter was stored in 5 ml tubes on ice and transported to the laboratory. In order to verify primer specificity, sampling was conducted in August 2023, a period when <italic>Alexandrium</italic> spp. were not anticipated to appear due to high water temperatures. Water samples were collected from the coastal waters of Tongyeong using a 0.2 &#x3bc;m filter to capture eDNA (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>The sampling locations. <bold>(A)</bold> map of Korea, <bold>(B)</bold> stations 1, 2, and 3 in Masan Bay for field sampling in April 2023 to compare filter pore sizes, and <bold>(C)</bold> stations 4, 5, and 6 off the coast of Tongyeong in August 2023, when <italic>Alexandrium</italic> spp. are not present.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-10-1257343-g001.tif"/>
</fig>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Filters and seawater filtration volumes are used to collect eDNA (exDNA and iDNA) in the field.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Station</th>
<th valign="middle" align="center">pore size (&#x3bc;m)</th>
<th valign="middle" align="center">Filter type</th>
<th valign="middle" align="center">Manufacturer</th>
<th valign="middle" align="center">Amount of water filtered (mL)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" rowspan="3" align="center">1</td>
<td valign="middle" align="center">0.2</td>
<td valign="middle" align="center">Clellulose Nitrate</td>
<td valign="middle" align="center">Whatman, UK</td>
<td valign="middle" align="center">960</td>
</tr>
<tr>
<td valign="middle" align="center">1.2</td>
<td valign="middle" align="center">Nylone</td>
<td valign="middle" align="center">Millipore, USA</td>
<td valign="middle" align="center">2,680</td>
</tr>
<tr>
<td valign="middle" align="center">30</td>
<td valign="middle" align="center">Nylone</td>
<td valign="middle" align="center">Millipore, USA</td>
<td valign="middle" align="center">30,000</td>
</tr>
<tr>
<td valign="middle" rowspan="3" align="center">2</td>
<td valign="middle" align="center">0.2</td>
<td valign="middle" align="center">Clellulose Nitrate</td>
<td valign="middle" align="center">Whatman, UK</td>
<td valign="middle" align="center">1,020</td>
</tr>
<tr>
<td valign="middle" align="center">1.2</td>
<td valign="middle" align="center">Nylone</td>
<td valign="middle" align="center">Millipore, USA</td>
<td valign="middle" align="center">3,000</td>
</tr>
<tr>
<td valign="middle" align="center">30</td>
<td valign="middle" align="center">Nylone</td>
<td valign="middle" align="center">Millipore, USA</td>
<td valign="middle" align="center">30,000</td>
</tr>
<tr>
<td valign="middle" rowspan="3" align="center">3</td>
<td valign="middle" align="center">0.2</td>
<td valign="middle" align="center">Clellulose Nitrate</td>
<td valign="middle" align="center">Whatman, UK</td>
<td valign="middle" align="center">1,510</td>
</tr>
<tr>
<td valign="middle" align="center">1.2</td>
<td valign="middle" align="center">Nylone</td>
<td valign="middle" align="center">Millipore, USA</td>
<td valign="middle" align="center">3,490</td>
</tr>
<tr>
<td valign="middle" align="center">30</td>
<td valign="middle" align="center">Nylone</td>
<td valign="middle" align="center">Millipore, USA</td>
<td valign="middle" align="center">30,000</td>
</tr>
<tr>
<td valign="middle" align="center">4</td>
<td valign="middle" align="center">0.2</td>
<td valign="middle" align="center">Clellulose Nitrate</td>
<td valign="middle" align="center">Whatman, UK</td>
<td valign="middle" align="center">1,300</td>
</tr>
<tr>
<td valign="middle" align="center">5</td>
<td valign="middle" align="center">0.2</td>
<td valign="middle" align="center">Clellulose Nitrate</td>
<td valign="middle" align="center">Whatman, UK</td>
<td valign="middle" align="center">1,200</td>
</tr>
<tr>
<td valign="middle" align="center">6</td>
<td valign="middle" align="center">0.2</td>
<td valign="middle" align="center">Clellulose Nitrate</td>
<td valign="middle" align="center">Whatman, UK</td>
<td valign="middle" align="center">1,550</td>
</tr>
</tbody>
</table>
</table-wrap>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Filtration of eDNA using filters with 30um pore size in the field. <bold>(A)</bold> Filter holder fabricated with a 3D printer, <bold>(B)</bold> Filter holder connected to a pump.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-10-1257343-g002.tif"/>
</fig>
<p>To fabricate the filter holder, 132D Design software (<ext-link ext-link-type="uri" xlink:href="http://www.123dapp.com/">http://www.123dapp.com/</ext-link>) was utilized to design the model, and subsequently, the design file was converted using Cubicreator4 V4.4.0. (Cubicon, Korea). 3D printing was performed on a Cubicorn Single Plus printer (Cubicorn, Korea) using PLA filament (3DBUYER, UK). The filter holder has an 800 &#x3bc;m pore-size plate in the inlet for primary filtration of other suspended solids.</p>
<p>In addition, 4 L of seawater was collected at each vertex in sterilized collecting bottles, stored on ice, transported to the laboratory, and immediately filtered using filters with 0.2 and 1.2 &#x3bc;m pores until the filter clogged (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>). To collect sediment samples, a van Veen Grab with a surface area of 0.1 m<sup>2</sup> was used to collect sediment from each vertex. Sediment was transported to the laboratory on ice in sterile collection bags, stored at -4&#xb0;C for 24 hr, and DNA was extracted. Water quality survey data (water temperature, pH, DO, turbidity, salinity, Chl-a) for Masan Bay in April 2023 were obtained from the Korea Marine Environment Management Cooperation <xref ref-type="bibr" rid="B28">MEIS (Marine Environmental Information System)</xref> (KOEM, <ext-link ext-link-type="uri" xlink:href="https://www.meis.go.kr/mei/observe/port.do">https://www.meis.go.kr/mei/observe/port.do</ext-link>) (<xref ref-type="supplementary-material" rid="SM1">
<bold>Table S1</bold>
</xref>). In addition, Suspended Solids affecting sample collection using filters are described in the Supplementary Material (<xref ref-type="supplementary-material" rid="SM1">
<bold>Table S2</bold>
</xref>). Seawater was collected from all sampling sites, fixed with Lugol&#x2019;s solution, and concentrated for analysis. A Sedgwick-Rafter chamber under a phase contrast microscope counting in triplicate, and data are shown in <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Tables&#xa0;3</bold>
</xref>, <xref ref-type="supplementary-material" rid="SM1">
<bold>4</bold>
</xref>. Qualitative analysis was performed at 400-1,000x magnification.</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Filter and sediment eDNA extraction</title>
<p>The sample filter from the field and the filter treated in the lab were transferred to a 60 mm diameter Petri dish to which 3 mL of PBS was added. Then, it was shaken at 150 rpm for 2 hr in a shaker at 20&#xb0;C. Using sterilized forceps and a scalpel, collect the filtered sample and divide it equally between two 1.5 mL tubes. The PMA-Untreated eDNA group was composed of one sample, while the PMA-Treated eDNA group consisted of another sample. The PMA-Untreated eDNA group was extracted by spin-down of 1.5 mL tubes at 13,000 RPM for 5 min, discarding the supernatant and using the AccuPrep<sup>&#xae;</sup> Plant Genomic DNA Extraction Kit (Bioneer, Korea) according to the manufacturer&#x2019;s instructions. For PMA treatment, the PMA-treated eDNA group was centrifuged at 13,000 RPM for 5 min, the supernatant discarded, and the DNA was extracted as above after exposure to 400 &#x3bc;L of PBS and 1 &#x3bc;L of PMAxx&#x2122; dye in blue light (450-490 nm) for 30 min.</p>
<p>To extract DNA from sediment samples, 20 g of sediment from each vertex was transferred to a 50 mL tube. Subsequently, 10 mL of PBS was added, and the mixture was centrifuged at 2,000 RPM for 20 min. The supernatant was carefully transferred to a new tube and further centrifuged at 13,000 RPM for 5 min. Following this step, the supernatant was discarded, and 800 &#x3bc;L of PBS was added to the sediment pellet. The resulting mixture was divided equally, with half of it transferred to one 1.5 mL tube for the PMA Untreated eDNA group and the other half transferred to another 1.5 mL tube for the PMA Treated eDNA group. DNA extraction was then performed on both groups following the same procedure as described above.</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Statistical analysis</title>
<p>The correlation between cell concentration and Cycle of Threshold (Ct) value was determined using a standard curve. Statistical analysis comparing the results PMA Untreated eDNA group and PMA Treated eDNA group was performed using a t-test after checking for normal distribution. All statistical analyses and graphs were visualized using R Studio and Excel.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<p>Species specificity testing was conducted using primers specifically designed to detect only <italic>Alexandrium</italic> spp. The tested species included <italic>Alexandrium catenella</italic>, <italic>Alexandrium pacificum</italic>, and <italic>Alexandrium tamarense</italic>. Additionally, the Dinoflagellata <italic>Gymnodinium impudicum</italic> and <italic>Akashiwo sanguinea</italic>, as well as the Diatoms <italic>Thalassionema</italic> species, <italic>Skeletonema costatum</italic>, and <italic>Nitzschia</italic> spp., which coexist in the same Marine region, were included in the testing (<xref ref-type="table" rid="T3">
<bold>Table&#xa0;3</bold>
</xref>). The results of the species specificity test for the primer indicate that no amplification was observed in any of the species tested, except for <italic>Alexandrium</italic> spp. This confirms the specific detection of <italic>Alexandrium</italic> spp. by the Alx2 primer set, as evidenced by the positive amplification observed exclusively in the tested <italic>Alexandrium</italic> spp. samples. Morphological analysis using traditional microscopy showed that <italic>Alexandrium</italic> spp. were the priority species at Stations 1, 2, and 3 in Masan Bay in April 2023 (<xref ref-type="supplementary-material" rid="SM1">
<bold>Table S3</bold>
</xref>), and <italic>Alexandrium</italic> spp. were not detected at Stations 4, 5, and 6 in August 2023 (<xref ref-type="supplementary-material" rid="SM1">
<bold>Table S4</bold>
</xref>).</p>
<table-wrap id="T3" position="float">
<label>Table&#xa0;3</label>
<caption>
<p>PCR results for control and target species in primer validation.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="center">Species</th>
<th valign="top" align="center">Origin</th>
<th valign="top" align="left">Positive/Negative</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="center">
<italic>Alexandrium catenella</italic>
</td>
<td valign="top" align="center">LIMS</td>
<td valign="top" align="center">+</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>Alexandrium pacificum</italic>
</td>
<td valign="top" align="center">LIMS</td>
<td valign="top" align="center">+</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>Alexandrium tamarense</italic>
</td>
<td valign="top" align="center">Feild</td>
<td valign="top" align="center">+</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>Gymnodinium impudicum</italic>
</td>
<td valign="top" align="center">LIMS</td>
<td valign="top" align="center">&#x2013;</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>Akashiwo sanguinea</italic>
</td>
<td valign="top" align="center">Field</td>
<td valign="top" align="center">&#x2013;</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>Thalassionema</italic> spp.</td>
<td valign="top" align="center">Field</td>
<td valign="top" align="center">&#x2013;</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>Skeltonema costatum</italic>
</td>
<td valign="top" align="center">Field</td>
<td valign="top" align="center">&#x2013;</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>Nitzschia</italic> spp.</td>
<td valign="top" align="center">Field</td>
<td valign="top" align="center">&#x2013;</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>In August 2023, the eDNA detection results for stations 4, 5, and 6 showed a significant contrast between the untreated and treated PMA groups. Specifically, the untreated PMA group showed a Ct value indicating DNA amplification, while the PMA-treated group showed no Ct value, suggesting that DNA amplification was successfully inhibited. This indicates that the Alx2 primer set specifically detects <italic>Alexandrium</italic> spp. and that exDNA is a potential source of error in eDNA monitoring (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Comparison of eDNA Detection between PMA Untreated Group and PMA Treated Group in the Tongyeong Coastal Area in August 2023.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-10-1257343-g003.tif"/>
</fig>
<p>Quantitative analysis is significantly facilitated by the utilization of standard curves. In this study, we formulated standard curves to establish a correlation between the concentration of A. catenella cells, cysts, and <italic>A. tamarense</italic> cells and their corresponding Ct values (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>). The generation of Standard curves using the dilution series of <italic>A. catenella</italic> cells and cysts yielded high R<sup>2</sup> values of 0.9963 and 0.9965, which are close to 1, while <italic>A. tamarense</italic> cells also showed a value of 0.9919, close to 1. These R<sup>2</sup> values indicate a strong correlation between the concentrations of <italic>A. catenella</italic> cells and cysts and their corresponding Ct values. The high R<sup>2</sup> values suggest that the standard curves are highly reliable and accurate in quantifying the target species. Finally, to obtain log cell counts for field samples, the standard curve for cells of <italic>A. catenella</italic> and <italic>A. tamarense</italic> (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4D</bold>
</xref>) showed an R<sup>2</sup> value of 0.9911.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Standard Curve of Cell Concentration (log) and Ct Values. <bold>(A)</bold> <italic>Alexandrium catenella</italic> Cells Concentration, <bold>(B)</bold> <italic>Alexandrium catenella</italic> Cysts Concentration, <bold>(C)</bold> <italic>Alexandrium tamarense</italic> Cells Concentration, <bold>(D)</bold> <italic>Alexandrium catenella</italic> and <italic>Alexandrium tamarense</italic> Cells Concentration.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-10-1257343-g004.tif"/>
</fig>
<p>A standard curve enables the mathematical modeling of the relationship between concentration and Ct value, providing a means to accurately estimate the concentration in various samples. This makes standard curves valuable for comparative analysis across different samples or experimental conditions. By analyzing multiple samples on a consistent basis, it becomes possible to compare relative concentration differences or determine statistical variances between groups. These capabilities make standard curves an important tool in quantifying and comparing target concentrations in a study.</p>
<p>To assess the effectiveness of the PMA-iDNA monitoring method, laboratory-cultured <italic>A. catenella</italic> cells and cysts were divided into two groups: PMA Untreated and PMA Treated. This division allowed for a comparison of the performance of the monitoring method with and without the use of PMA. Furthermore, the slopes of the standard curves for Cells and Cysts presented in <xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4A, B</bold>
</xref> were used to convert the Ct values into logarithmic values. The results of PMA treatment for each percentage of the sample heat-treated at 60&#xb0;C for 30 min (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref>) showed no significant difference between PMA Untreated and PMA Treated groups at 100% for both cells and cysts. However, as the percentage of exDNA increased, the Log cells abundance also decreased, indicating that PMA selectively detects only iDNA. However, even in the PMA Untreated group, the Log value decreased as the percentage of exDNA increased. It is worth noting that the heat treatment method used could potentially affect the eDNA.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>PMA Treatment Comparison for Samples Heat-Treated at 60&#xb0;C for 30 min. <bold>(A)</bold> <italic>Alexandrium catenella</italic> cells (1,000 cells/mL). <bold>(B)</bold> <italic>Alexandrium catenella</italic> cysts (1,000 cells/mL). *P&lt;0.05.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-10-1257343-g005.tif"/>
</fig>
<p>Triton X-100 (1%), a non-ionic surfactant, was used to selectively disrupt cells without causing DNA damage; this method showed no decrease in log values for the PMA Untreated group, contrast the heat-treated method, for both cells and cysts, and both cells and cysts showed P-values above 0.05 at 100% concentration. Similarly, the log cell abundance of the PMA-treated group decreased as the percentage of exDNA increased (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>). The results obtained from the study suggest that Triton X-100 (1%) effectively disrupts cells without causing eDNA damage. The findings also confirm the ability of PMA treatment to selectively detect iDNA. Notably, no significant differences were observed between the PMA Untreated and PMA Treated groups at a concentration of 100% for both cells and cysts, regardless of PMA treatment. However, as the percentage decreased, the Log cells abundance decreased, indicating that PMA selectively detects iDNA. However, both cells and cysts showed a log cell count in the 0% group. The findings of this study have the potential to make a significant contribution to the enhancement and standardization of eDNA quantification methods utilizing qPCR. The accurate analysis of iDNA and exDNA through the application of PMA treatment shows promise for advancing eDNA monitoring techniques. By effectively differentiating between iDNA and exDNA, researchers can improve the accuracy and reliability of eDNA-based assessments, thereby enhancing our understanding of ecosystems and facilitating more robust environmental monitoring and management strategies. Furthermore, to add credibility to the above experiment, the results of each of the four groups treated with DNase and PMA showed that log cell abundance remained consistent in Group A regardless of the percentage of viable cells at 100% and 0%. In contrast, Groups B, C, and D showed higher values of log cell abundance at 100% viable cells and lower values at 0% (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>PMA Treatment Comparison for Samples Treated with Triton X-100 (1%). <bold>(A)</bold> <italic>Alexandrium catenella</italic> cells (1,000 cells/mL). <bold>(B)</bold> <italic>Alexandrium catenella</italic> cysts (1,000 cells/mL). *P&lt;0.05.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-10-1257343-g006.tif"/>
</fig>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Experimental Setup and Treatment Categories for PMA Verification using <italic>Alexandrium tamarense</italic>. Experiments were performed involving <italic>Alexandrium tamarense</italic> with live cell ratios of 100% and 0%. The samples were systematically divided into four distinct treatment groups: <bold>(A)</bold> Untreated with PMA, Untreated with DNase. <bold>(B)</bold> Untreated with PMA, Treated with DNase. <bold>(C)</bold> Treated with PMA, Treated with DNase. <bold>(D)</bold> Treated with PMA, Untreated with DNase.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-10-1257343-g007.tif"/>
</fig>
<p>PMA-treated and untreated groups were compared with pore size filters of 0.2 &#x3bc;m and 1.2 &#x3bc;m (<xref ref-type="bibr" rid="B40">Turner et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B22">Kumar et&#xa0;al., 2022</xref>), which are commonly used pore sizes in conventional eDNA sampling methods, as well as a relatively large filter pore of 30 &#x3bc;m, in order to selectively collect only iDNA from field sampling (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8</bold>
</xref>). In the absence of PMA treatment, the log cell abundance of <italic>Alexandrium</italic> spp. at all vertices was observed to be in the order of 1.2 &#x3bc;m, 0.2 &#x3bc;m, and 30 &#x3bc;m. However, upon treating the filter samples with PMA and extracting DNA, it was found that the abundance order shifted to 30 &#x3bc;m, 1.2 &#x3bc;m, and 0.2 &#x3bc;m. This observation suggests that the smaller pore size filter successfully captures a wide range of eDNA types, including both exDNA and iDNA. Pore size filters of 30 &#x3bc;m selectively capture iDNA and relatively large microorganisms larger than 30 &#x3bc;m, while allowing exDNA and other microorganisms to pass through. As a consequence, the yield of exDNA is reduced, but the filter effectively increases the yield of iDNA. The results presented highlight the distinction between conventional eDNA sampling methods utilizing small pore sizes and iDNA selective collection methods employing filters with relatively large pores and PMA treatment. By selectively collecting only iDNA through PMA processing, errors in eDNA analysis, such as quantitative overestimation and the inability to differentiate between living and dead organisms, can be minimized. The combination of PMA treatment and an appropriate filter size can indeed be a useful strategy for effectively collecting iDNA during field sampling. However, it is important to note that the size of the DNA can result in variations in the relative amount of iDNA generated by the method used in this study, particularly for certain microbial species, cells of higher organisms, and small microorganisms. This consideration should be taken into account when conducting comparative studies of iDNA from different organisms in the environment.</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>DNA yield by filter pore size in Masan Bay in April 2023. <bold>(A)</bold> PMA Untreated group. <bold>(B)</bold> PMA Treated group.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-10-1257343-g008.tif"/>
</fig>
<p>It is suggested that sediment layers have the ability to store DNA for long periods of time in biological monitoring (<xref ref-type="bibr" rid="B9">Corinaldesi et&#xa0;al., 2008</xref>). Deposits act as reservoirs for exDNA and iDNA, with exDNA predominantly representing the majority rather than iDNA (<xref ref-type="bibr" rid="B10">Corinaldesi et&#xa0;al., 2005</xref>). Therefore, the method can distinguish between living and dead organisms and has the capability to detect not only organisms that currently exist but also those that existed in the past. Given the low abundance of <italic>Alexandrium</italic> spp. at lower depths (<xref ref-type="bibr" rid="B26">Martin et&#xa0;al., 2005</xref>), it can be inferred that the DNA detected in the sediment layer originated from cysts or that exDNA was present within the sediment layer. In April 2023, the PMA untreated in Masan Bay sediments exhibited a high abundance of <italic>Alexandrium</italic> spp., whereas the treated samples showed a low abundance (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9</bold>
</xref>). In marine sediments, eDNA can originate from living cells or organisms, as well as natural or anthropogenic processes (<xref ref-type="bibr" rid="B13">Dell'Anno and Danovaro, 2005</xref>). Therefore, DNA extraction from sediment samples cannot exclude DNA derived from deceased organisms. Nevertheless, by selectively detecting only iDNA, the PMA-treated method appears to overcome the limitations from a sediment biomonitoring perspective. The application of selective iDNA targeted analysis can potentially prove valuable in biomonitoring studies, aiding in the differentiation between living and deceased organisms (<xref ref-type="bibr" rid="B11">Corinaldesi et&#xa0;al., 2018</xref>).</p>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>Comparison between PMA-treated and untreated eDNA groups of April 2023 Massan Bay sediment. <bold>(A)</bold> PMA Untreated group. <bold>(B)</bold> PMA Treated group.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-10-1257343-g009.tif"/>
</fig>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>
<italic>Alexandrium</italic> spp. are recognized as the main contributor to red tide blooms in various marine regions worldwide (<xref ref-type="bibr" rid="B38">Shikata et&#xa0;al., 2020</xref>). These organisms are also significant harmful algae, particularly in coastal or shelf waters, capable of disrupting marine ecosystems (<xref ref-type="bibr" rid="B4">Anderson et&#xa0;al., 2012</xref>). Red tide events, which can have adverse ecological and economic impacts, are often linked to <italic>Alexandrium</italic> spp. and can be influenced by environmental factors such as oceanic conditions, temperature, and nutrient levels (<xref ref-type="bibr" rid="B29">Min and Kim, 2023</xref>). As a result, monitoring <italic>Alexandrium</italic> spp. in the environment becomes essential to understanding the effects of human activities on marine ecosystems. For this purpose, targeted primers were developed. 3 <italic>Alexandrium</italic> species were cultivated in the laboratory for a minimum of 6 weeks, with an additional species from the same group used as a control for comparison. Significantly, no amplification was observed in species other than <italic>Alexandrium</italic> spp., confirming the specificity of this primer design. Such precision in primer design has the potential to enhance environmental monitoring and early warning systems. This primer configuration, tailored specifically for <italic>Alexandrium</italic> spp., demonstrates the promising potential for practical application in environmental assessment and protection.</p>
<p>In this study, for quantitative analysis using eDNA in sediment layers and seawater, standard curves were generated to investigate the relationship between <italic>A. catenella</italic> cells, cysts, and <italic>A. tamarense</italic> concentrations and Ct values. This analysis confirmed the feasibility of modeling the relationship between concentrations and Ct values, allowing us to estimate concentrations in other samples. In addition, a high R<sup>2</sup> value indicates that the standard curve fits the data well and contributes to the reliability and accuracy of the measurement results.</p>
<p>If protected from physical degradation, exDNA can persist for years (<xref ref-type="bibr" rid="B1">Agnelli et&#xa0;al., 2007</xref>). While iDNA is protected from external degradation factors in the environment and has a longer half-life, internal degradation factors associated with cell death can result in DNA fragmentation (<xref ref-type="bibr" rid="B20">Hotchkiss et&#xa0;al., 2009</xref>). In conclusion, the findings suggest that different forms of DNA, including extracellular eDNA, damaged intracellular eDNA, and intact intracellular eDNA, may undergo distinct degradation processes (<xref ref-type="bibr" rid="B18">Hirohara et&#xa0;al., 2021</xref>). These processes can be influenced by various factors such as environmental conditions, enzymatic activity, and the physiological state of the cells or organisms. Understanding these separate degradation processes is crucial for interpreting eDNA data accurately and assessing its persistence and reliability as a biomonitoring tool. Therefore, it is considered more reliable to selectively detect iDNA in seawater than to detect total eDNA. By specifically targeting and analyzing iDNA, the focus is shifted to intact cell-derived DNA, which provides a clearer indication of the presence and abundance of living organisms. This approach helps to minimize potential errors and biases associated with the detection of degraded or extracellular DNA, contributing to a more accurate assessment of biodiversity, ecological dynamics, and environmental monitoring in marine ecosystems.</p>
<p>The results presented in <xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref> demonstrate that the heat treatment method leads to the absence of log cell values in both the cell and cyst categories within the PMA 0% treatment group. Additionally, there is a gradual decrease in log cell counts for eDNA (iDNA, exDNA) in both cell and cyst categories in the absence of PMA treatment. These observations strongly suggest that the heat treatment method affects both iDNA and exDNA. However, the PMA-iDNA experiment, which generates randomized exDNA, highlights that only sufficient iDNA is detected. Contrastingly, Triton X-100 treatment did not impact the log cell count of eDNA (iDNA, exDNA) in the no PMA group, offering a distinct approach from the heat treatment. Nevertheless, DNA amplification occurred in the 0% PMA treatment group, implying that Triton X-100 might not completely degrade all iDNA. Furthermore, the higher log cell count observed in cysts in the PMA-treated group, as opposed to cells, aligns with the well-established understanding that cyst membranes are more resilient than cells. In summary, the heat treatment method&#x2019;s effect primarily pertained to exDNA without detecting iDNA in the 0% live cell group. On the other hand, the Triton X-100 treatment method identified iDNA while not affecting exDNA within the same group. Both methodologies collectively highlight PMA&#x2019;s exclusive covalent binding to exDNA, enabling the selective detection of iDNA while excluding exDNA. The potential of iDNA-PMA monitoring is further supported by the insights presented in <xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>. In this fig, the results of the four groups subjected to DNase and PMA treatment lend credibility to the aforementioned experiments. Specifically, the outcomes demonstrate that log cell abundance remained stable in Group A regardless of the percentage of viable cells, spanning from 100% down to 0%. In contrast, Groups B, C, and D exhibited higher log cell abundance values at 100% viable cells, which progressively decreased to lower values at 0% (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>). This reinforcement underscores the reliability and effectiveness of the iDNA-PMA monitoring approach.</p>
<p>In our study, we observed that the eDNA yields were high when using relatively small pore sizes of 0.2 and 1.2 &#x3bc;m filters in seawater. However, when it came to the selective detection of iDNA treated with PMA, which is designed to target DNA from living organisms, the yields with 0.2 and 1.2 &#x3bc;m filters were lower compared to the 30 &#x3bc;m filter. This suggests that employing a combination of PMA treatment and a larger pore size filter, such as 30 &#x3bc;m, may be a useful strategy for effectively collecting iDNA during field sampling. By selectively capturing iDNA while minimizing the capture of other particles and exDNA, this approach can enhance the accuracy and reliability of iDNA analysis, providing valuable insights into the presence and activity of living organisms in aquatic environments. In August 2023, eDNA detection at stations 4, 5, and 6 exhibited a notable contrast between untreated and PMA-treated groups (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>). exDNA is generated from cell breakdown post-mortem or active shedding by organisms in the environment (<xref ref-type="bibr" rid="B21">Ibanez de Aldecoa et&#xa0;al., 2017</xref>). Particularly, exDNA introduced into soil or water displays significant resistance to rapid degradation, persisting for hours to days (<xref ref-type="bibr" rid="B31">Nielsen et&#xa0;al., 2007</xref>). Therefore, DNA amplification in the PMA-untreated group likely indicates exDNA detection, while the absence of amplification in the PMA-treated group implies specificity of the Alx2 primer set for <italic>Alexandrium</italic> spp. These outcomes enable us to anticipate errors in eDNA monitoring due to the specificity of primers and the persistence of exDNA.</p>
<p>
<italic>Alexandrium</italic> spp. cysts exist in the sediment layer depending on environmental conditions and give rise to HABs (<xref ref-type="bibr" rid="B12">Dale, 1983</xref>). The eDNA derived from these cysts serves as a crucial indicator for detecting the distribution and occurrence of <italic>Alexandrium</italic> spp. in the ocean. However, DNA extraction from sediments carries the risk of overestimation or false positives. To tackle these challenges, sediment samples can be treated with PMA to assess the potential of environmental monitoring for <italic>Alexandrium</italic> spp. cysts. PMA-treated eDNA samples selectively detect only iDNA. Consequently, the separation of PMA-treated eDNA samples into exDNA and iDNA improves the accuracy of eDNA detection.</p>
<p>While eDNA monitoring serves various purposes in environmental monitoring, such as biodiversity surveys and species detection, it has limitations in quantitative detection and epidemiological surveys. However, PMA-iDNA monitoring selectively detects intact DNA and can overcome these limitations. However, in the future, there is a need to improve the capability of PMA-iDNA to investigate a wide range of biological groups by optimizing the target species&#x2019; iDNA size and the filter size used. It is essential to understand the variations in iDNA quantity that may arise based on the DNA size of specific microbial species, higher organisms, cells, and tiny microorganisms. This understanding will serve as the foundation for accurate iDNA monitoring of diverse biological groups.</p>
</sec>
<sec id="s5" sec-type="conclusion">
<label>5</label>
<title>Conclusion</title>
<p>To the best of our knowledge, the detection of iDNA in Seawater and sediments using PMA treatment and filter size optimization for improved selective detection of iDNA has been pioneered in this study. A method has been developed to prevent non-selective detection of eDNA through PMA treatment and minimize potential errors in eDNA sampling by optimizing the filter size. This approach reduces the risk of quantitative overestimation in eDNA studies and enhances the accuracy of species identification. The method is not only applicable to the analysis of <italic>Alexandrium</italic> spp. eDNA but also holds promise for the assessment of other harmful algal blooms (HABs) or phytoplankton, as well as for higher organism PMA-iDNA monitoring assays. Furthermore, it can serve as a rapid and reliable approach to mitigate errors in eDNA analysis.</p>
</sec>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>    <p>The original contributions presented in the study are included in the article/<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Material</bold>
</xref>. Further inquiries can be directed to the corresponding author.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>K-WY: Conceptualization, Data curation, Investigation, Methodology, Writing- original draft. H-SS: Data curation, Formal analysis, Investigation, Writing- review &amp; editing. M-JS: Formal analysis, Investigation, Data curation, Writing- review &amp; editing. MC-K: Conceptualization, Data curation, Funding acquisition, Methodology, Project administration, Resources, Supervision, Validation, Visualization, Writing- review &amp; editing, Writing- original draft.</p>
</sec>
</body>
<back>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>The authors declare financial support was received for the research, authorship, and/or publication of this article. This research was supported by Korea Institute of Marine Science &amp; Technology Promotion (KIMST) funded by the Ministry of Oceans and Fisheries, (20220252).</p>
</sec>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s11" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fmars.2023.1257343/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fmars.2023.1257343/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet_1.docx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Agnelli</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Ascher</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Corti</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Ceccherini</surname> <given-names>M. T.</given-names>
</name>
<name>
<surname>Pietramellara</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Nannipieri</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Purification and isotopic signatures (&#x394; 13 C, &#x394; 15 N, &#x394; 14 C) of soil extracellular DNA</article-title>. <source>Biol. Fertility Soils</source> <volume>44</volume>, <fpage>353</fpage>&#x2013;<lpage>361</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s00374-007-0213-y</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Anderson</surname> <given-names>D. M.</given-names>
</name>
</person-group> (<year>1980</year>). <article-title>Effects of temperature conditioning on development and germination of gonyaulax tamarensis (Dinophyceae) hypnozygotes 1</article-title>. <source>J. Phycology</source> <volume>16</volume> (<issue>2</issue>), <fpage>166</fpage>&#x2013;<lpage>172</lpage>. doi: <pub-id pub-id-type="doi">10.1111/j.1529-8817.1980.tb03013.x</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Anderson</surname> <given-names>D. M.</given-names>
</name>
</person-group> (<year>1998</year>). <article-title>Physiology and bloom dynamics of toxic alexandrium species, with emphasis on life cycle transitions</article-title>. <source>Nato Asi Ser. G Ecol. Sci.</source> <volume>41</volume>, <fpage>29</fpage>&#x2013;<lpage>48</lpage>.</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Anderson</surname> <given-names>D. M.</given-names>
</name>
<name>
<surname>Alpermann</surname> <given-names>T. J.</given-names>
</name>
<name>
<surname>Cembella</surname> <given-names>A. D.</given-names>
</name>
<name>
<surname>Collos</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Masseret</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Montresor</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>The globally distributed genus alexandrium: multifaceted roles in marine ecosystems and impacts on human health</article-title>. <source>Harmful Algae</source> <volume>14</volume>, <fpage>10</fpage>&#x2013;<lpage>35</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.hal.2011.10.012</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Anderson</surname> <given-names>D. M.</given-names>
</name>
<name>
<surname>Kulis</surname> <given-names>D. M.</given-names>
</name>
<name>
<surname>Keafer</surname> <given-names>B. A.</given-names>
</name>
<name>
<surname>Gribble</surname> <given-names>K. E.</given-names>
</name>
<name>
<surname>Marin</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Scholin</surname> <given-names>C. A.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Identification and enumeration of alexandrium spp. from the gulf of maine using molecular probes</article-title>. <source>Deep Sea Res. Part II: Topical Stud. Oceanography</source> <volume>52</volume> (<issue>19</issue>), <fpage>2467</fpage>&#x2013;<lpage>2490</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.dsr2.2005.06.015</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Anderson</surname> <given-names>D. M.</given-names>
</name>
<name>
<surname>Wall</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>1978</year>). <article-title>Potential importance of benthic cysts of Gonyaulax Tamarensis and G. excavata in initiating toxic dinoflagellate blooms 1, 2, 3</article-title>. <source>J. Phycol.</source> <volume>14</volume>, <fpage>224</fpage>&#x2013;<lpage>234</lpage>.</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Behrenfeld</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>O&#x2019;Malley</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Boss</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Karp-Boss</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Mundt</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Phytoplankton biodiversity and the inverted paradox</article-title>. <source>ISME Commun.</source> <volume>1</volume> (<issue>1</issue>), <fpage>52</fpage>. doi: <pub-id pub-id-type="doi">10.1038/s43705-021-00056-6</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Carini</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Marsden</surname> <given-names>P. J.</given-names>
</name>
<name>
<surname>Leff</surname> <given-names>J. W.</given-names>
</name>
<name>
<surname>Morgan</surname> <given-names>E. E.</given-names>
</name>
<name>
<surname>Strickland</surname> <given-names>M. S.</given-names>
</name>
<name>
<surname>Fierer</surname> <given-names>N.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Relic DNA is abundant in soil and obscures estimates of soil microbial diversity</article-title>. <source>Nat. Microbiol.</source> <volume>2</volume> (<issue>3</issue>), <fpage>1</fpage>&#x2013;<lpage>6</lpage>. doi: <pub-id pub-id-type="doi">10.1038/nmicrobiol.2016.242</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Corinaldesi</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Beolchini</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Dell&#x2019;Anno</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Damage and degradation rates of extracellular DNA in marine sediments: implications for the preservation of gene sequences</article-title>. <source>Mol. Ecol.</source> <volume>17</volume> (<issue>17</issue>), <fpage>3939</fpage>&#x2013;<lpage>3951</lpage>. doi: <pub-id pub-id-type="doi">10.1111/j.1365-294X.2008.03880.x</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Corinaldesi</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Danovaro</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Dell'Anno</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Simultaneous recovery of extracellular and intracellular DNA suitable for molecular studies from marine sediments</article-title>. <source>Appl. Environ. Microbiol.</source> <volume>71</volume> (<issue>1</issue>), <fpage>46</fpage>&#x2013;<lpage>50</lpage>. doi: <pub-id pub-id-type="doi">10.1128/AEM.71.1.46-50.2005</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Corinaldesi</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Tangherlini</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Manea</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Dell&#x2019;Anno</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Extracellular DNA as a genetic recorder of microbial diversity in benthic deep-sea ecosystems</article-title>. <source>Sci. Rep.</source> <volume>8</volume> (<issue>1</issue>), <fpage>1</fpage>&#x2013;<lpage>9</lpage>. doi: <pub-id pub-id-type="doi">10.1038/s41598-018-20302-7</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Dale</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>1983</year>). &#x201c;<article-title>Dinoflagellate resting cysts: benthic plankton</article-title>,&#x201d; in <source>Survival strategies of the algae</source>, <fpage>69</fpage>&#x2013;<lpage>136</lpage>.</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dell'Anno</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Danovaro</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Extracellular DNA plays a key role in deep-sea ecosystem functioning</article-title>. <source>Science</source> <volume>309</volume> (<issue>5744</issue>), <fpage>2179</fpage>. doi: <pub-id pub-id-type="doi">10.1126/science.1117475</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fukuyo</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>1985</year>). <article-title>Morphology of protogonyaulax tamarensis (Lebour) taylor and protogonyaulax catenella (Whedon and kofoid) taylor from Japanese coastal waters</article-title>. <source>Bull. Mar. Sci.</source> <volume>37</volume> (<issue>2</issue>), <fpage>529</fpage>&#x2013;<lpage>537</lpage>.</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Grzebyk</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Audic</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Lasserre</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Abadie</surname> <given-names>E.</given-names>
</name>
<name>
<surname>de Vargas</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Bec</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Insights into the Harmful Algal Flora in Northwestern Mediterranean Coastal Lagoons Revealed by Pyrosequencing Metabarcodes of the 28S rRNA Gene</article-title>. <source>Harmful Algae</source> <volume>68</volume>, <fpage>1</fpage>&#x2013;<lpage>16</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.hal.2017.06.003</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>G&#xfc;nther</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Knebelsberger</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Neumann</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Laakmann</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Mart&#xed;nez Arbizu</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Metabarcoding of marine environmental DNA based on mitochondrial and nuclear genes</article-title>. <source>Sci. Rep.</source> <volume>8</volume> (<issue>1</issue>), <fpage>14822</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41598-018-32917-x</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hallegraeff</surname> <given-names>G. M.</given-names>
</name>
<name>
<surname>Bolch</surname> <given-names>C. J.</given-names>
</name>
</person-group> (<year>1992</year>). <article-title>Transport of diatom and dinoflagellate resting spores in ships' Ballast water: implications for plankton biogeography and aquaculture</article-title>. <source>J. Plankton Res.</source> <volume>14</volume> (<issue>8</issue>), <fpage>1067</fpage>&#x2013;<lpage>1084</lpage>. doi: <pub-id pub-id-type="doi">10.1093/plankt/14.8.1067</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hirohara</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Tsuri</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Miyagawa</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Paine</surname> <given-names>R. T. R.</given-names>
</name>
<name>
<surname>Yamanaka</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>The application of PMA (Propidium monoazide) to different target sequence lengths of zebrafish eDNA: A new approach aimed toward improving environmental DNA ecology and biological surveillance</article-title>. <source>Front. Ecol. Evol.</source> <volume>9</volume>, <elocation-id>632973</elocation-id>. doi: <pub-id pub-id-type="doi">10.3389/fevo.2021.632973</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Hopkins</surname> <given-names>G. W.</given-names>
</name>
<name>
<surname>Freckleton</surname> <given-names>R. P.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Declines in the numbers of amateur and professional taxonomists: implications for conservation</article-title>. <source>Anim. Conserv.</source> <volume>5</volume>, <fpage>245</fpage>&#x2013;<lpage>249</lpage>.</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hotchkiss</surname> <given-names>R. S.</given-names>
</name>
<name>
<surname>Strasser</surname> <given-names>A.</given-names>
</name>
<name>
<surname>McDunn</surname> <given-names>J. E.</given-names>
</name>
<name>
<surname>Swanson</surname> <given-names>P. E.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Cell death</article-title>. <source>New Engl. J. Med.</source> <volume>361</volume> (<issue>16</issue>), <fpage>1570</fpage>&#x2013;<lpage>1583</lpage>. doi: <pub-id pub-id-type="doi">10.1056/NEJMra0901217</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ibanez de Aldecoa</surname> <given-names>A. L.</given-names>
</name>
<name>
<surname>Zafra</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Gonz&#xe1;lez-Pastor</surname> <given-names>Jos&#xe9;E.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Mechanisms and regulation of extracellular DNA release and its biological roles in microbial communities</article-title>. <source>Front. Microbiol.</source> <volume>8</volume>, <elocation-id>1390</elocation-id>. doi: <pub-id pub-id-type="doi">10.3389/fmicb.2017.01390</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kumar</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Farrell</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Reaume</surname> <given-names>A. M.</given-names>
</name>
<name>
<surname>Eble</surname> <given-names>J. A.</given-names>
</name>
<name>
<surname>Gaither</surname> <given-names>M. R.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>One size does not fit all: tuning eDNA protocols for high-and low-turbidity water sampling</article-title>. <source>Environ. DNA</source> <volume>4</volume> (<issue>1</issue>), <fpage>167</fpage>&#x2013;<lpage>180</lpage>. doi: <pub-id pub-id-type="doi">10.1002/edn3.235</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lacoursi&#xe8;re-Roussel</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Rosabal</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Bernatchez</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Estimating Fish Abundance and Biomass from eDNA Concentrations: Variability among Capture Methods and Environmental Conditions</article-title>. <source>Mol. Ecol. Resour.</source> <volume>16</volume> (<issue>6</issue>), <fpage>1401</fpage>&#x2013;<lpage>1414</lpage>. doi: <pub-id pub-id-type="doi">10.1111/1755-0998.12522</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lawson Handley</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>How will the &#x2018;molecular revolution&#x2019;contribute to biological recording</article-title>? <source>Biol. J. Linn. Soc.</source> <volume>115</volume> (<issue>3</issue>), <fpage>750</fpage>&#x2013;<lpage>766</lpage>. doi: <pub-id pub-id-type="doi">10.1111/bij.12516</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname> <given-names>S. Y.</given-names>
</name>
<name>
<surname>Jeong</surname> <given-names>H. J.</given-names>
</name>
<name>
<surname>Seong</surname> <given-names>K. A.</given-names>
</name>
<name>
<surname>Lim</surname> <given-names>A. S.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>J. H.</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>K. H.</given-names>
</name>
<etal/>
</person-group>. (<year>2017</year>). <article-title>Improved real-time PCR method for quantification of the abundance of all known ribotypes of the ichthyotoxic dinoflagellate cochlodinium polykrikoides by comparing 4 different preparation methods</article-title>. <source>Harmful Algae</source> <volume>63</volume>, <fpage>23</fpage>&#x2013;<lpage>31</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.hal.2017.01.006</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Martin</surname> <given-names>J. L.</given-names>
</name>
<name>
<surname>Page</surname> <given-names>F. H.</given-names>
</name>
<name>
<surname>Hanke</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Strain</surname> <given-names>P. M.</given-names>
</name>
<name>
<surname>LeGresley</surname> <given-names>M. M.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Alexandrium fundyense vertical distribution patterns during 1982, 2001 and 2002 in the offshore bay of fundy, eastern Canada</article-title>. <source>Deep Sea Res. Part II: Topical Stud. Oceanography</source> <volume>52</volume> (<issue>19</issue>), <fpage>2569</fpage>&#x2013;<lpage>2592</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.dsr2.2005.06.010</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Medlin</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Elwood</surname> <given-names>H. J.</given-names>
</name>
<name>
<surname>Stickel</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Sogin</surname> <given-names>M. L.</given-names>
</name>
</person-group> (<year>1988</year>). <article-title>The characterization of enzymatically amplified eukaryotic 16S-like rRNA-coding regions</article-title>. <source>Gene</source> <volume>71</volume> (<issue>2</issue>), <fpage>491</fpage>&#x2013;<lpage>499</lpage>. doi: <pub-id pub-id-type="doi">10.1016/0378-1119(88)90066-2</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="web">
<person-group person-group-type="author">
<collab>MEIS (Marine Environmental Information System)</collab>
</person-group>. <source>Marine environment observation &amp; Survey</source>. Available at: <uri xlink:href="https://www.meis.go.kr/mei/observe/port.do">https://www.meis.go.kr/mei/observe/port.do</uri>.</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Min</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>K. Y.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Seasonal change and subniche dynamics of three alexandrium species in the korea strait</article-title>. <source>Harmful Algae</source> <volume>125</volume>, <elocation-id>102420</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.hal.2023.102420</pub-id>.</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nagler</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Podmirseg</surname> <given-names>S. M.</given-names>
</name>
<name>
<surname>Ascher-Jenull</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Sint</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Traugott</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Why eDNA fractions need consideration in biomonitoring</article-title>. <source>Mol. Ecol. Resour.</source> <volume>22</volume> (<issue>7</issue>), <fpage>2458</fpage>&#x2013;<lpage>2705</lpage>. doi: <pub-id pub-id-type="doi">10.1111/1755-0998.13658</pub-id>.</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nielsen</surname> <given-names>K. M.</given-names>
</name>
<name>
<surname>Johnsen</surname> <given-names>P&#xe5;lJ.</given-names>
</name>
<name>
<surname>Bensasson</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Daffonchio</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Release and persistence of extracellular DNA in the environment</article-title>. <source>Environ. Biosafety Res.</source> <volume>6</volume> (<issue>1-2</issue>), <fpage>37</fpage>&#x2013;<lpage>53</lpage>. doi: <pub-id pub-id-type="doi">10.1051/ebr:2007031</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nocker</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Camper</surname> <given-names>A. K.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Selective removal of DNA from dead cells of mixed bacterial communities by use of ethidium monoazide</article-title>. <source>Appl. Environ. Microbiol.</source> <volume>72</volume> (<issue>3</issue>), <fpage>1997</fpage>&#x2013;<lpage>2004</lpage>. doi: <pub-id pub-id-type="doi">10.1128/AEM.72.3.1997-2004.2006</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Park</surname> <given-names>B. S.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>J. H.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>J.-H.</given-names>
</name>
<name>
<surname>Gobler</surname> <given-names>C. J.</given-names>
</name>
<name>
<surname>Han</surname> <given-names>M.-S.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Resolving the Intra-Specific Succession within Cochlodinium Polykrikoides Populations in Southern Korean Coastal Waters Via use of Quantitative PCR Assays</article-title>. <source>Harmful Algae</source> <volume>37</volume>, <fpage>133</fpage>&#x2013;<lpage>141</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.hal.2014.04.019</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pietramellara</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Ascher</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Borgogni</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Ceccherini</surname> <given-names>M. T.</given-names>
</name>
<name>
<surname>Guerri</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Nannipieri</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Extracellular DNA in soil and sediment: fate and ecological relevance</article-title>. <source>Biol. Fertility Soils</source> <volume>45</volume>, <fpage>219</fpage>&#x2013;<lpage>235</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s00374-008-0345-8</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>.Pont</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Meulenbroek</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Bammer</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Dejean</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Er&#x151;s</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Jean</surname> <given-names>P.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>Quantitative Monitoring of Diverse Fish Communities on a Large Scale Combining eDNA Metabarcoding and qPCR</article-title>. <source>Mol. Ecol. Resour.</source> <volume>23</volume> (<issue>2</issue>), <fpage>396</fpage>&#x2013;<lpage>409</lpage>. doi: <pub-id pub-id-type="doi">10.1111/1755-0998.13715</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Salter</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Joensen</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Kristiansen</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Steingrund</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Vestergaard</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Environmental DNA concentrations are correlated with regional biomass of atlantic cod in oceanic waters</article-title>. <source>Commun. Biol.</source> <volume>2</volume> (<issue>1</issue>), <fpage>461</fpage>. doi: <pub-id pub-id-type="doi">10.1038/s42003-019-0696-8</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Samsur</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Yamaguchi</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Sagara</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Takatani</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Arakawa</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Noguchi</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Accumulation and depuration profiles of PSP toxins in the short-necked clam tapes japonica fed with the toxic dinoflagellate alexandrium catenella</article-title>. <source>Toxicon</source> <volume>48</volume> (<issue>3</issue>), <fpage>323</fpage>&#x2013;<lpage>330</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.toxicon.2006.06.002</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shikata</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Taniguchi</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Sakamoto</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Kitatsuji</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Yamasaki</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Yoshida</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Phylogeny, growth and toxicity of the noxious red-tide dinoflagellate alexandrium leei in Japan</article-title>. <source>Regional Stud. Mar. Sci.</source> <volume>36</volume>, <elocation-id>101265</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.rsma.2020.101265</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Strickler</surname> <given-names>K. M.</given-names>
</name>
<name>
<surname>Fremier</surname> <given-names>A. K.</given-names>
</name>
<name>
<surname>Goldberg</surname> <given-names>C. S.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Quantifying Effects of UV-B, Temperature, and pH on eDNA Degradation in Aquatic Microcosms</article-title>. <source>Biol. Conserv.</source> <volume>183</volume>, <fpage>85</fpage>&#x2013;<lpage>92</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.biocon.2014.11.038</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Turner</surname> <given-names>C. R.</given-names>
</name>
<name>
<surname>Barnes</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>C. C. Y.</given-names>
</name>
<name>
<surname>Jones</surname> <given-names>S. E.</given-names>
</name>
<name>
<surname>Jerde</surname> <given-names>C. L.</given-names>
</name>
<name>
<surname>Lodge</surname> <given-names>D. M.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Particle size distribution and optimal capture of aqueous macrobial eDNA</article-title>. <source>Methods Ecol. Evol.</source> <volume>5</volume> (<issue>7</issue>), <fpage>676</fpage>&#x2013;<lpage>684</lpage>. doi: <pub-id pub-id-type="doi">10.1111/2041-210X.12206</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Valentini</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Taberlet</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Miaud</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Civade</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Herder</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Thomsen</surname> <given-names>P. F.</given-names>
</name>
<etal/>
</person-group>. (<year>2016</year>). <article-title>Next-generation monitoring of aquatic biodiversity using environmental DNA metabarcoding</article-title>. <source>Mol. Ecol.</source> <volume>25</volume> (<issue>4</issue>), <fpage>929</fpage>&#x2013;<lpage>942</lpage>. doi: <pub-id pub-id-type="doi">10.1111/mec.13428</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Whedon</surname> <given-names>W. F.</given-names>
</name>
</person-group> (<year>1936</year>). <article-title>Dinoflagellates of the san francisco region. I. on the skeletal morphology of two new species, gonyaulax catenella and G. Acatenella</article-title>. <source>Univ. Calif. Publ. Zool.</source> <volume>41</volume>, <fpage>25</fpage>&#x2013;<lpage>34</lpage>.</citation>
</ref>
</ref-list>
</back>
</article>