<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Mar. Sci.</journal-id>
<journal-title>Frontiers in Marine Science</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Mar. Sci.</abbrev-journal-title>
<issn pub-type="epub">2296-7745</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fmars.2022.897004</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Marine Science</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>A Shuttling Protein <italic>Kank1</italic> Plays Important Role in the Sex Determination in Yellow Drum</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Sun</surname><given-names>Sha</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/1704957"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liu</surname><given-names>Jieping</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname><given-names>Sen</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>He</surname><given-names>Qiwei</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Han</surname><given-names>Wei</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Ye</surname><given-names>Kun</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Han</surname><given-names>Fang</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Li</surname><given-names>Wanbo</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="author-notes" rid="fn001"><sup>*</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/1136401"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Wang</surname><given-names>Zhiyong</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="author-notes" rid="fn001"><sup>*</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/1717689"/>
</contrib>
</contrib-group>
<aff id="aff1"><sup>1</sup><institution>Key Laboratory of Healthy Mariculture for the East China Sea, Ministry of Agriculture and Rural Affairs, Jimei University</institution>, <addr-line>Xiamen</addr-line>, <country>China</country></aff>
<aff id="aff2"><sup>2</sup><institution>Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao National Laboratory for Marine Science and Technology</institution>, <addr-line>Qingdao</addr-line>, <country>China</country></aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Hadiseh Dadras, South Bohemia Research Center of Aquaculture and Biodiversity of Hydrocenoses, Czechia</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Jatindra Nath Mohanty, Siksha O Anusandhan University, India; Fan Lin, Shantou University, China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Wanbo Li, <email xlink:href="mailto:li.wanbo@jmu.edu.cn">li.wanbo@jmu.edu.cn</email>; Zhiyong Wang, <email xlink:href="mailto:zywang@jmu.edu.cn">zywang@jmu.edu.cn</email>
</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Marine Biology, a section of the journal Frontiers in Marine Science</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>04</day>
<month>05</month>
<year>2022</year>
</pub-date>
<pub-date pub-type="collection">
<year>2022</year>
</pub-date>
<volume>9</volume>
<elocation-id>897004</elocation-id>
<history>
<date date-type="received">
<day>15</day>
<month>03</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>11</day>
<month>04</month>
<year>2022</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2022 Sun, Liu, Zhang, He, Han, Ye, Han, Li and Wang</copyright-statement>
<copyright-year>2022</copyright-year>
<copyright-holder>Sun, Liu, Zhang, He, Han, Ye, Han, Li and Wang</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>Sex is one of the most important scientific topics, and the existence of sex dimorphism is a conserved feature in vertebrate taxa. The research on sex-determining genes and sex chromosome evolution is a hot topic in biology. The majority of sex-determining genes expressed in somatic cells, and reciprocal interactions between germ cells and somatic cells, are important for gonadal differentiation. However, the knowledge of how signals are transmitted between somatic cells and germ cells remains unclear. In this study, we confirmed the 36 dph was a sex determination critical stage in yellow drum through transcriptome analysis at the early development stages. We further found that Kank1 participated in the germ cells&#x2019; motility process in yellow drum through KEGG pathway analysis together with protein-protein interaction network. With the dual-luciferase reporter assay, we detected that Kank1 increased the transcription of <italic>dmrt1_Luc</italic> gene in CHO cells and 293T cells. Additionally, we observed that Kank1 was not only expressed in the cytoplasm but also in the nucleus in CHO cells through a fluorescence microscope. These results suggest that Kank1 acts as a shuttling protein as in humans and may play a difunctional role at the early gonad development stage in yellow drum, and it not only participated in the germ cells&#x2019; motility but also increased the expression of <italic>dmrt1</italic> in yellow drum.</p>
</abstract>
<kwd-group>
<kwd>RNAseq</kwd>
<kwd>kank1</kwd>
<kwd>dmrt1</kwd>
<kwd>sex determination</kwd>
<kwd>yellow drum</kwd>
</kwd-group>
<counts>
<fig-count count="9"/>
<table-count count="3"/>
<equation-count count="0"/>
<ref-count count="57"/>
<page-count count="12"/>
<word-count count="5661"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>Sex determination is one of the most primarily biological processes, while the way of initiating female and male development exhibits remarkable diversity and variability across vertebrates (<xref ref-type="bibr" rid="B29">Li and Gui, 2018</xref>). The existence of sex dimorphism is a conserved feature in vertebrate taxa. It has been shown that sex can induce profound cellular and molecular dimorphism in both sexual and somatic cells of vertebrates, which is an important issue in aquaculture and medical science (<xref ref-type="bibr" rid="B39">Niksirat et&#xa0;al., 2021</xref>). Therefore, sex determination is a key issue for managing problems arising from sexual dimorphism. Importantly, various sex determination mechanisms among vertebrates suggest that it is the ideal biological event helping us understand the evolutionary conundrums underlying speciation and species diversity (<xref ref-type="bibr" rid="B38">Nagahama et&#xa0;al., 2021</xref>). The rapid development of sequencing technologies has shed light on the investigation of genomic composition in many species. Recent research advancements mainly focus on the sex chromosome evolution, screening of the master sex-determining gene,s and a part of brief gene regulatory network. A major landmark in vertebrate sex-determining genes was the discovery of the <italic>SRY</italic> gene in 1990 (<xref ref-type="bibr" rid="B48">Sinclair et&#xa0;al., 1990</xref>). Since then, considerable progress in the discovery of sex-determining genes has been made over the last three decades, such as <italic>DMY</italic> in the <italic>Oryzias latipes</italic> (<xref ref-type="bibr" rid="B35">Matsuda et&#xa0;al., 2002</xref>), <italic>amhy</italic> in the <italic>Patagonian pejerrey</italic> (<xref ref-type="bibr" rid="B17">Hattori et&#xa0;al., 2012</xref>), <italic>gsdfY</italic> in the <italic>Oryzias luzonensis</italic> (<xref ref-type="bibr" rid="B37">Myosho et&#xa0;al., 2012</xref>), <italic>sdy</italic> in the <italic>Oncorchynchus mykiss</italic> (<xref ref-type="bibr" rid="B54">Yano et&#xa0;al., 2012</xref>), and <italic>BCAR1</italic> in the channel catfish (<xref ref-type="bibr" rid="B2">Bao et&#xa0;al., 2019</xref>), which are specifically expressed in somatic cells. The fact that sex determination of somatic cells precedes that of germ cells has been widely accepted. Furthermore, sex reversal in somatic cells leads to sex reversal in germ cells (<xref ref-type="bibr" rid="B3">Bowles and Koopman, 2010</xref>; <xref ref-type="bibr" rid="B4">Capel, 2017</xref>). However, the knowledge of how signals transmit between somatic cells and germ cells is still lacking.</p>
<p>Primordial germ cells (PGCs) are the stem cells of gametes, providing genome transmission to future generations (<xref ref-type="bibr" rid="B27">Lesch and Page, 2012</xref>), and germ cells have the potential to differentiate into eggs and spermatozoa (<xref ref-type="bibr" rid="B13">Golpour et&#xa0;al., 2016a</xref>; <xref ref-type="bibr" rid="B14">Golpour et&#xa0;al., 2016b</xref>; <xref ref-type="bibr" rid="B15">Golpour et&#xa0;al., 2017</xref>). Reciprocal interactions between germ cells and somatic cells are important for gonadal differentiation (<xref ref-type="bibr" rid="B25">Kocer et&#xa0;al., 2009</xref>). Recently, the regulatory role of germ cells during sexual development has been demonstrated. In teleost, the requirement of germ cells for gonadal development appears to be variable. Their absence leads to exclusive male development in medaka and zebrafish (<xref ref-type="bibr" rid="B26">Kurokawa et&#xa0;al., 2007</xref>; <xref ref-type="bibr" rid="B47">Siegfried and N&#xfc;sslein-Volhard, 2008</xref>) but not in goldfish or loach (<xref ref-type="bibr" rid="B11">Fujimoto et&#xa0;al., 2010</xref>; <xref ref-type="bibr" rid="B16">Goto et&#xa0;al., 2012</xref>). The number of PGCs likely plays an important role in teleost sexual differentiation, and females possess more germ cells than males due to their sexually dimorphic proliferation of germ cells in medaka (<xref ref-type="bibr" rid="B45">Saito et&#xa0;al., 2007</xref>), zebrafish (<xref ref-type="bibr" rid="B47">Siegfried and N&#xfc;sslein-Volhard, 2008</xref>) and stickleback (<xref ref-type="bibr" rid="B28">Lewis et&#xa0;al., 2008</xref>). During development, PGCs undergo specification, migration, and proliferation. These processes are regulated by transmembrane receptors that receive external chemoattractant signals, which are then translated to cytoskeletal changes by effector molecules such as phospholipids and small GTPases (<xref ref-type="bibr" rid="B43">Ridley et&#xa0;al., 2003</xref>). Meanwhile, highly regulated cell-to-cell and cell-substrate adhesion is important for PGCs motility, and localized growth factors may control PGC survival and PGC localization (<xref ref-type="bibr" rid="B43">Ridley et&#xa0;al., 2003</xref>; <xref ref-type="bibr" rid="B42">Richardson and Lehmann, 2010</xref>). In general, the expression pattern of genes corresponds to the developmental morphology of cells.</p>
<p>Yellow drum (<italic>Nibea albiflora</italic>) is an important fish species in fishery and aquaculture, widely distributed in southern Japan and East China Sea (<xref ref-type="bibr" rid="B50">Takita, 1974</xref>). The <italic>dmrt1</italic> gene may be the most vital sex determing gene in yellow drum (Sun et&#xa0;al., submitted). In medaka, <italic>dmrt1bY</italic> expression causes a cell cycle arrest in the G2 stage and mediates a mitotic arrest in the PGCs (<xref ref-type="bibr" rid="B20">Herpin et&#xa0;al., 2007</xref>; <xref ref-type="bibr" rid="B19">Herpin and Schartl, 2009</xref>). It is the reason that the number of germ cells in females tends to be more than in males. In zebrafish, the <italic>dmrt1</italic>-mutated testes displayed severe testicular development defects and gradual loss of all Vasa-positive germ cells <italic>via</italic> inhibiting their self-renewal and inducing apoptosis. The <italic>dmrt1</italic> gene might be required for the maintenance, self-renewal, and differentiation of male germ cells in zebrafish (<xref ref-type="bibr" rid="B30">Lin et&#xa0;al., 2017</xref>). In tilapia, knockdown of <italic>dmrt1</italic> resulted in feminization of gonadal somatic cells and loss of germ cells in males (<xref ref-type="bibr" rid="B7">Dai et&#xa0;al., 2021</xref>). Therefore, it seems that the function of the <italic>dmrt1</italic> gene in germ cell development is different in a variety of fish species. In yellow drum, two types of gonadal tissues were observed in the development stage of 40 days post-hatch (dph), which were designated as tissue type I and type II. Gonadal tissue type I showed a larger surface area and consisted of different populations of germ cells and was considered a presumptive ovary. Until 55 dph, the overall appearance of spermatogonia was similar to that of undifferentiated germ cells at 40 dph, referred to as the gonadal tissue type II (<xref ref-type="bibr" rid="B31">Lou et&#xa0;al., 2016</xref>). The different developmental stages of the germ cells in yellow drum may be associated with their different migration behavior or dimorphic proliferation. However, the connection between the sex-determining gene <italic>dmrt1</italic> with the germ cells remained unknown.</p>
<p><italic>Kank1</italic> belongs to the Kank family. It is characterized by their unique structure, coiled-coil motifs in the N-terminal region, and ankyrin-repeats in the C-terminal region, with an additional KN motif at the N-terminus (<xref ref-type="bibr" rid="B57">Zhu et&#xa0;al., 2008</xref>; <xref ref-type="bibr" rid="B10">Fan et&#xa0;al., 2020</xref>). <italic>Kank1</italic> was reported to play a significant role in the regulation of the action cytoskeleton (<xref ref-type="bibr" rid="B8">Ding et&#xa0;al., 2003</xref>). It can negatively regulate actin polymerization and cell motility through inhibiting the binding of Rac1 and insulin receptor substrate p53 (IRSp53) (<xref ref-type="bibr" rid="B36">Mhawech, 2005</xref>; <xref ref-type="bibr" rid="B21">Kakinuma et&#xa0;al., 2008</xref>; <xref ref-type="bibr" rid="B22">Kakinuma et&#xa0;al., 2009</xref>; <xref ref-type="bibr" rid="B44">Roy et&#xa0;al., 2009</xref>). In this study, we confirmed 36 dph was a sex determination critical stage in yellow drum through transcriptome analysis at the early development stages, and found that Kank1 participated in the cell motility process and interacted with Dmrt1 in yellow drum. With the dual-luciferase reporter assay, we detected that Kank1 increased the transcription of <italic>dmrt1_Luc</italic> gene in CHO cells and 293T cells. Additionally, we observed that Kank1 was not only expressed in the cytoplasm but also in the nucleus in CHO cells through a fluorescence microscope. These results suggest that Kank1 acts as a shuttling protein as in humans and may play a difunctional role at the early gonad development stage in yellow drum It not only participated in the germ cells&#x2019; motility but could increase the expression of <italic>dmrt1</italic> in yellow drum.</p>
</sec>
<sec id="s2">
<title>Materials And Method</title>
<sec id="s2_1">
<title>Ethical Approval</title>
<p>The sample collection and animal experiments were conducted in accordance with the regulations of the Guide for Care and Use of Laboratory Animals and were approved by the Animal Care and Use Committee of Jimei University.</p>
</sec>
<sec id="s2_2">
<title>Experimental Fish and Sampling, RNA Extraction and RNA Sequencing</title>
<p>To obtain samples for RNA-seq, artificially bred yellow drum of 26 days post-hatch (dph) purchased from a breeding farm in Zhangzhou, Fujian province, China. Fries were reared in two tanks (80&#xa0;cm &#xd7; 60&#xa0;cm &#xd7; 60&#xa0;cm) with temperature at 28&#xb0;C and salinity at 25 ~ 30, dissolved oxygen at 6 ppm. Fries were fed with compound feed three times a day. The sample collection at five critical stages (30 dph, 36 dph, 46 dph, 55 dph, and 61 dph) of yellow drum gonadal development according to Lou et&#xa0;al. (<xref ref-type="bibr" rid="B31">Lou et&#xa0;al., 2016</xref>), approximately 800 individuals were collected at each stage. Fries were anesthetized with tricaine methanesulfonate (MS-222, Shanghai Acmec Biochemical Co., China) at 300 mg/L before sampling, and the body length was recorded (<xref ref-type="table" rid="T1"><bold>Table&#xa0;1</bold></xref>). The head and tail of each fry was pruned, and the rest of the body was cut open from the abdomen and stored in RNA Later solution. Subsequently, gonads were dissected and collected from the body under a microscope for RNA extraction and the remaining part was stored at 75% ethanol for DNA extraction. The sex of each sampled fry was determined through PCR amplification with the sex specific markers (<xref ref-type="bibr" rid="B49">Sun et&#xa0;al., 2018</xref>). To obtain a sufficient quantity of RNA for sequencing, we generated three pools of gonads isolated from the fries for each sex at each stage. Total RNA was isolated using TRIZOL Reagent (Invitrogen, USA) according to the manufacturer&#x2019;s instructions. The purity and integrity of the RNA were verified with agarose gel electrophoresis and Bioanalyzer 2100 (Agilent Technologies, USA). RNA integrity number (RIN) &#x2265; 8.0 were subjected to RNA enrichment with magnetic beads with Oligo (dT), and RNA was disrupted into short fragments by adding fragmentation buffers. These short fragments were used as templates and random hexamers as primers to synthesize the first strand of cDNA, followed by the synthesis of second strand cDNA. The AMPure XP beads were employed to purify double-strand cDNA, EB buffer was used for end-repair and A-tailing. The purified fragments were ligated with Illumina sequencing adapters, and paired-end libraries were sequenced on an Illumina NovaSeq 6000 system.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Sampling body length data of juvenile of the yellow drum (mm).</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Stage</th>
<th valign="top" align="center">30dph</th>
<th valign="top" align="center">36dph</th>
<th valign="top" align="center">46dph</th>
<th valign="top" align="center">55dph</th>
<th valign="top" align="center">61dph</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">Body Length</td>
<td valign="top" align="center">22.5 &#xb1; 1.6</td>
<td valign="top" align="center">24.4 &#xb1; 2.2</td>
<td valign="top" align="center">29.0 &#xb1; 3.9</td>
<td valign="top" align="center">35.9 &#xb1; 3.0</td>
<td valign="top" align="center">47.1 &#xb1; 4.9</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_3">
<title>Transcriptome Analysis</title>
<p>The clean reads were obtained from raw data by filtering out adaptor contaminated reads and low-quality reads. The quality of the sequenced reads was assessed by FastQC v0.11.9 (<xref ref-type="bibr" rid="B1">Andrews, 2010</xref>). Clean reads were aligned to the male reference genome using STAR v2.5.3a (<xref ref-type="bibr" rid="B9">Dobin et&#xa0;al., 2013</xref>). After alignment, the transcripts were assembled using StringTie v1.3.3b (<xref ref-type="bibr" rid="B41">Pertea et&#xa0;al., 2015</xref>), and the number of reads that mapped to the genes and exons was calculated using FeatureCounts v2.0.1. The analysis of differentially expressed genes was performed with DESeq2, and the related R packages were employed for the PCA analysis. Significantly differentially expressed genes (DEG) were defined as adjust <italic>P</italic>-value &lt; 0.05 and log<sub>10</sub>2(Foldchange) &gt; 1. Gene Ontology (GO) terms analysis of DEGs and Kyoto Encyclopaedia of Genes and Genomes (KEGG) pathway enrichment were performed using clusterProfiler R packages.</p>
<p>The interaction network of differential genes between females and males at 36 dph was analyzed using the STRING data [STRING: functional protein association networks (string-db.org)]. The CytoScape software was used to display the result.</p>
</sec>
<sec id="s2_4">
<title>Phylogenetic Analysis and Collinearity Analysis of <italic>Dmrt1</italic>
</title>
<p>The protein sequences of 11 species including <italic>Homo sapiens</italic> (human), <italic>Gallus gallus</italic> (chicken), <italic>Lctalurus punctatus</italic> (spotted gar), <italic>Danio retio</italic> (zebrafish), <italic>Oryzia latipes</italic> (medaka), <italic>Takifugu rubripes</italic> (fugu), <italic>Tetraodon nigrovirids</italic> (spotted green pufferfish), <italic>Oreochromis niloticus</italic> (tilapia), <italic>Gasterosteus aculeatus</italic> (three spined stickleback), and <italic>Larimichthys crocea</italic> (large yellow croaker) were obtained from Ensembl website (<uri xlink:href="https://asia.ensembl.org/index.html">https://asia.ensembl.org/index.html</uri>). The phylogenetic tree was constructed with MEGA 5.0 using UPGMA method. The adjacent genes with <italic>dmrt1</italic> of the 11 species are referred to the Ensembl Genome Browser (<uri xlink:href="http://www.ensembl.org">http://www.ensembl.org</uri>).</p>
</sec>
<sec id="s2_5">
<title><italic>Kank1</italic> Gene Structure and Expression Analysis</title>
<p>The <italic>Kank1</italic> gene reference sequences were extracted from transcriptome data and the amino acid sequences were translated through DNAMAN. The nuclear localization signal (NLS) was predicted using online tools NLStradamus (utoronto.ca) and the nuclear export signal (NES) was predicted using online tools LocNES NES prediction tool provided by Chook Lab (swmed.edu). The <italic>Kank1</italic> gene expression was assessed using FPKM at different development stages in yellow drum and significant differences between the males and females were determined by <italic>t</italic>-test (<italic>p</italic> &lt; 0.05).</p>
</sec>
<sec id="s2_6">
<title>Construction of Plasmid</title>
<p><italic>Kank1</italic> expression vector (pCS2-<italic>dmrt1</italic>-mCherry) was constructed and the coding sequence was obtained through PCR cloning from cDNA library of yellow drum. The pCS2- <italic>kank1</italic>-mCherry vector was double digested with <italic>BmaHI</italic> and <italic>ClaI</italic>, then pCS2-dmrt1-mCherry was constructed with <italic>dmrt1</italic> coding sequence cloned into the digested site using ClonExpress<sup>&#xae;</sup> II One Step Cloning Kit (Vazyme, Nanjing, China). In order to distinguish with mCherry fluorescence, we amplified the EGFP coding sequences using the pEGFP-N1 vector as a template and replaced the mCherry coding sequences of the vector pCS2-dmrt1-mCherry using the <italic>ClaI</italic> and <italic>XhoI</italic> double digestion to construct the vector pCS2-dmrt1-EGFP. The <italic>dmrt1</italic> promoter sequences were amplified from the genomic DNA of the yellow drum, the product was double digested with <italic>Kpn</italic>I and <italic>Hind</italic>III, then cloned into the same site of pGL3-basic vector (Promega, USA) to construct the vector pGL3-basic-<italic>dmrt1</italic>_promoter. All the primers used in PCR cloning warelisted in <xref ref-type="table" rid="T2"><bold>Table&#xa0;2</bold></xref>.</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Primers used in this study.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Primer name</th>
<th valign="top" align="center">Primer sequence (5&#x2019; - 3&#x2019;)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">Kank1-F</td>
<td valign="top" align="left">GTTCTTTTTGCAggatccATGGCTCAAACCATGCACG</td>
</tr>
<tr>
<td valign="top" align="left">Kank1-R</td>
<td valign="top" align="left">GCCCTTGCTCACCATatcgatAAACATGCCCCTCCGAGTTG</td>
</tr>
<tr>
<td valign="top" align="left">Dmrt1-F</td>
<td valign="top" align="left">GTTCCAGATTACGCTgaattcATGAGCAAGGACAAGCCGAAC</td>
</tr>
<tr>
<td valign="top" align="left">Dmrt1-R</td>
<td valign="top" align="left">GCCCTTGCTCACCATatcgatATTGGTGGCATCACTATCAGTG</td>
</tr>
<tr>
<td valign="top" align="left">EGFP-F</td>
<td valign="top" align="left">AGTGATGCCACCAATatcgatATGGTGAGCAAGGGCGAG</td>
</tr>
<tr>
<td valign="top" align="left">EGFP-R</td>
<td valign="top" align="left">CTATAGTTCTAGAGGctcgagTTACTTGTACAGCTCGTCCATGC</td>
</tr>
<tr>
<td valign="top" align="left">Dmrt1-proF</td>
<td valign="top" align="left">ATTTCTCTATCGATA<underline>ggtacc</underline>CACTCTCTTACCTCCAACTGGT</td>
</tr>
<tr>
<td valign="top" align="left">Dmrt1-proR</td>
<td valign="top" align="left">CAGTACCGGAATGCC<underline>aagctt</underline>GTGATGAGCCTTTGTCTGGC</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>The restriction endonuclease cleavage sites were marked by underline.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s2_7">
<title>Cell Culture</title>
<p>CHO (a cell line from <italic>Cricetulus griseus</italic> ovary) and HEK293 were cultured in 1640 and high glucose DMEM medium (Dulbecco&#x2019;s modified eagle medium, Gibco), respectively, supplemented with 10% fetal bovine serum and 1% penicillin 100 units/ml with 100 ug/ml streptomycin, plated in 25 cm<sup>2</sup> flask, and placed in the carbon dioxide incubator. The detailed operation steps were followed according to the reference manual.</p>
</sec>
<sec id="s2_8">
<title>Cell Transfection</title>
<p>Lipo8000&#x2122; Transfection Reagent was used in vector transfection (Beyotime Biotechnology, China). Cells were plated in 12-well plates at 18 ~ 24 hours before transfection. While the cells were completely adherent and stuck to the wall, the fresh medium was replaced according to protocol. The cells were transfected with 50 &#x3bc;L Opti-MEM Medium, 1 &#x3bc;g DNA and 1.6 &#x3bc;L Lipo8000&#x2122;. The ratio of the pGL3-basic promoter vector and the pRT-TK vector (an internal control) was about 40: 1. In the co-transfection assay, the ratio of expression vector to promoter vector was 1: 48, 2: 48, 4: 48, 8: 48, respectively. Luciferase activity was measured at 24 hours after transfection using the dual-luciferase reporter assay system (Beyotime Biotechnology, China) and LB 9508 Lumat<sup>3</sup> (Berthold technologies, Germany) following the manufacturer&#x2019;s protocol. Assays were performed in triplicate and expressed as mean &#xb1; standard error.</p>
</sec>
<sec id="s2_9">
<title>DAPI Dyeing and Observation</title>
<p>Firstly, the medium in the 12-well cell plates was discarded and washed once with 1&#xa0;ml PBS. Cells were then fixed with 1 mL 4% paraformaldehyde for 10 minutes, and were permeabilized with 0.2% Tween 100 for 10 minutes and washed once again with 1 mL PBS. Nuclear staining was performed with 1 mL 0.2% DAPI for 15 minutes, and observation and photography were done with a laser confocal scanning microscope (TCSSP8, Leica).</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>Transcriptome Analysis and the Identification of the Sex Determination Critical Stage</title>
<p>RNA libraries generating from the gonad of the various early stages were sequenced on an Illumina NovaSeq 6000 system. The total raw data and clean data were 318.7 Gb and 307.7 Gb, respectively. The average reads map rate was 87.9% when aligned the clean reads to the assembly of yellow drum with STAR. Transcriptome assembly obtained 23,997 transcripts from 18,596 genes (<xref ref-type="table" rid="T3"><bold>Table&#xa0;3</bold></xref>).</p>
<table-wrap id="T3" position="float">
<label>Table&#xa0;3</label>
<caption>
<p>Statistics of RNA-Seq sequencing data of the gonad at the early stage.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Type data</th>
<th valign="top" align="center">Number</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">Raw data</td>
<td valign="top" align="center">318.7 GB</td>
</tr>
<tr>
<td valign="top" align="left">Clean data</td>
<td valign="top" align="center">307.7 GB</td>
</tr>
<tr>
<td valign="top" align="left">Q30</td>
<td valign="top" align="center">93.9%</td>
</tr>
<tr>
<td valign="top" align="left">Genes</td>
<td valign="top" align="center">18,596</td>
</tr>
<tr>
<td valign="top" align="left">Transcripts</td>
<td valign="top" align="center">23,997</td>
</tr>
<tr>
<td valign="top" align="left">Mapped rate</td>
<td valign="top" align="center">87.9%</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>We performed PCA analysis with all the samples (<xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1</bold></xref>). Clustering discovered that the samples were similarly grouped into two sections by the sex (dimension 1, <xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1A</bold></xref>) and the stage (dimension 2, <xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1B</bold></xref>). This result suggests that the samples before 36 dph formed a group and the samples after 36 dph formed another group, indicated 36 dph (body length = 24.4 &#xb1; 2.2&#xa0;mm) was a critical stage. Subsequently, we analyzed the different expression genes between females and males at each stage (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2A</bold></xref>) and counted the genes of up- or down-regulated (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2B</bold></xref>), and found that the number of genes with up- and down-regulated at 36 dph were more than at other stages. This could be due to the sex biased genes expressed in two kinds of gonad before 36 dph, and switched into sex-specific expression patterns once the sex-determining key gene was expressed. A previous study showed that the critical period of sex differentiation in the yellow drum occurred at the stage of 36 dph (total length = 21.2 &#xb1; 3.9&#xa0;mm) (<xref ref-type="bibr" rid="B31">Lou et&#xa0;al., 2016</xref>). Our results imply the 36 dph is a sex determination critical stage, which is inconsistent with the previous result.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>PAC analysis for all the samples. <bold>(A)</bold> The samples were analyzed according to sex, females are indicated in red and males are indicated in blue-green. <bold>(B)</bold> The samples were analyzed according to the stages.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-897004-g001.tif"/>
</fig>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p><bold>(A)</bold> The volcano plot demonstrates the differential expression genes between females and males at each stage, the numbers of differential expression genes are indicated in red (up-regulated) and blue (down-regulated). <bold>(B)</bold> The stacking histogram shows gene numbers of up-regulated, down-regulated and not significant at different stages.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-897004-g002.tif"/>
</fig>
</sec>
<sec id="s3_2">
<title>Gene Function Enrichment of DEGs at the Sex Determination Critical Stage (36 dph)</title>
<p>To investigate the function of these differential genes, we performed GO and KEGG analyses between females and males at 36 dph (<xref ref-type="fig" rid="f3"><bold>Figure&#xa0;3</bold></xref>). In females, the upregulated genes mainly participated in the biological processes associated with development process, reproductive process, gamete generation, germ cell development, and cellular process involved in reproduction in multicellular organisms (<xref ref-type="fig" rid="f3"><bold>Figure&#xa0;3A</bold></xref>). Of note, the cell cycle and Wnt signaling pathway were primarily enriched (<xref ref-type="fig" rid="f3"><bold>Figure&#xa0;3C</bold></xref>). In males, upregulated genes were mainly involved in transmembrane receptor protein tyrosine kinase signaling pathway, cell migration, cell motility, and tube morphogenesis (<xref ref-type="fig" rid="f3"><bold>Figure&#xa0;3B</bold></xref>). The KEGG pathway analysis suggested that Focal adhesion and TGF-beta signaling pathway played important roles in males at 36 dph (<xref ref-type="fig" rid="f3"><bold>Figure&#xa0;3D</bold></xref>). According to the general process of sexual development, we speculated that the primordial germ cells had migrated to the place of primitive gonad and began to proliferate and develop in females. However, the gonad development was relatively late in males. The primordial germ cells may be undergoing the cell migration process. In addition, we collected genes that have been reported to express in germ cells, somatic cells (<xref ref-type="bibr" rid="B35">Matsuda et&#xa0;al., 2002</xref>; <xref ref-type="bibr" rid="B42">Richardson and Lehmann, 2010</xref>). Comparing the genes expressed in germ cells, somatic cells, and the genes involved in the biological processes of cell cycle and cell migration at different stages (<xref ref-type="fig" rid="f4"><bold>Figure&#xa0;4</bold></xref>), we found that the genes participating in the cell migration process expressed higher in males than in females. However, the genes expressed in germ cells involved in the cell cycle expressed higher in females. The gene expression trend was consistent with the results of GO and KEGG enrichment.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p><bold>(A, B)</bold> are the GO enrichment results. <bold>(C, D)</bold> are the results of KEGG pathway analysis, respectively in females and in males at the 36 dph.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-897004-g003.tif"/>
</fig>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>The heatmap of the genes expressed in germ cells, somatic cells and the genes involved in the biological processes of cell cycle and cell migration at different stage.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-897004-g004.tif"/>
</fig>
</sec>
<sec id="s3_3">
<title>DEGs Interaction Network Analysis</title>
<p>The differential genes pathway analysis provided a clue that mabe the different behavior of the primordial germ cells caused the differences in gonad development between males and females. Given <italic>dmrt1</italic> plays a pivotal role in the sex determination of yellow drum, we wanted to understand the link between master sex determining gene <italic>Dmrt1</italic> and the development of primordial germ cells. We analyzed the protein-protein interaction networks with the differential genes associated with the behavior of primordial germ cells from the pathway analysis (<xref ref-type="fig" rid="f5"><bold>Figure&#xa0;5</bold></xref>). The result implies that the proteins interaction mainly involved in the cell motility process and in the cell cycle in males and females, respectively. The network of proteins interaction was complex. We paid close attention to which proteins may interact with <italic>Dmrt1</italic> in yellow drum, including Sox8, Sox9, Fgf6, Bmpr2, <italic>Kank1</italic>, Foxl2, Wnt4a, and Orc1. However, it seemed that only <italic>Kank1</italic> could act upon <italic>Dmrt1</italic> directly among the various genes. This result indicated that the Kank1 might take part in the germ cells migration process and could interact with <italic>Dmrt1</italic> in yellow drum. Previous studies reported that <italic>Kank1</italic> negatively regulated actin polymerization and cell motility through inhibiting the binding of Rac1 and insulin receptor substrate p53 (IRSp53) (<xref ref-type="bibr" rid="B36">Mhawech, 2005</xref>; <xref ref-type="bibr" rid="B21">Kakinuma et&#xa0;al., 2008</xref>; <xref ref-type="bibr" rid="B22">Kakinuma et&#xa0;al., 2009</xref>; <xref ref-type="bibr" rid="B44">Roy et&#xa0;al., 2009</xref>). Therefore, we suspected that <italic>Kank1 might</italic> inhibit the germ cells migration at the 36 dph in male individuals of yellow drum. However, the relationship between <italic>Dmrt1</italic> and <italic>Kank1</italic> is unclear, and has not been reported in previous related studies.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>The protein-protein interaction networks with the differential genes detected from pathway analysis. The red and blue cycles represent the upregulated proteins in males and females, respectively. The darker the dot, the more significantly upregulated of the protein. And the bigger the dot, the more interactions.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-897004-g005.tif"/>
</fig>
</sec>
<sec id="s3_4">
<title>Phylogenetic and Collinearity Analyses of <italic>Kank1</italic> and <italic>Dmrt1</italic>
</title>
<p>We found that the <italic>kank1</italic> gene os located in the sex chromosome near <italic>dmrt1</italic>. Previous studies have shown that sex chromosomes usually evolved from autosomes, and once the sex determining gene fixed in the chromosome, the sexually antagonistic allele genes would be located in the surroundings (<xref ref-type="bibr" rid="B5">Charlesworth et&#xa0;al., 2005</xref>). It seemed the <italic>kank1</italic> gene may be the sexually antagonistic allele gene. We then constructed the phylogenetic trees of <italic>dmrt1</italic>, and analyzed the collinearity between <italic>kank1</italic> and <italic>dmrt1</italic> in different species (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6</bold></xref>). The result suggests that the collinearity between <italic>kank1</italic> and <italic>dmrt1</italic> was conserved from fishes to humans. This result suggested that the <italic>kank1</italic> gene might act as an important role in the sex determination in yellow drum, and it should be very meaningful to study the gene function of <italic>kank1</italic>.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>The phylogenetic trees of <italic>dmrt1</italic> and collinearity analysis between <italic>dmrt1</italic> and <italic>kank1</italic>. The different genes are represented by different color boxes.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-897004-g006.tif"/>
</fig>
</sec>
<sec id="s3_5">
<title><italic>Kank1</italic> Gene Cloning and Expression Analysis</title>
<p>The ORF of <italic>kank1</italic> consisted of 3993 bp encoding 1330 amino acid residues in yellow drum (<xref ref-type="fig" rid="f7"><bold>Figure&#xa0;7A</bold></xref>). A KN motif and an Ank repeat were predicted in the C-terminal and N-terminal, respectively. The nuclear localization signal (NLS) and the nuclear export signal (NES) were predicted (<xref ref-type="fig" rid="f7"><bold>Figure&#xa0;7A</bold></xref>), implying Kank1 may be a shuttling protein. The <italic>kank1</italic> gene expressed significantly higher in males than females from 46 dph to 55 dph, which was the stage that the cytological characteristics of male gonad differentiation were gradually observed (<xref ref-type="fig" rid="f7"><bold>Figure&#xa0;7B</bold></xref>). This result suggests that the <italic>kank1</italic> gene might act as an indispensable role in the male gonad differentiation.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p><bold>(A)</bold> The cDNA and deduced amino acid sequence of <italic>kank1</italic> gene. The <italic>Kank1</italic> KN N-terminal motif (KN) motif (green shadow) and ankyrin repeat domains from the C-terminal are marked. The sequences of NLS and NES motifs identified in <italic>Kank1</italic> are underlined by blue italics and red italics, respectively. <bold>(B)</bold> The FPKM of <italic>kank1</italic> gene in females and males at different stages (<italic>p</italic> &lt; 0.01). *<italic>p</italic> &lt; 0.05 and **<italic>p</italic> &lt; 0.01.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-897004-g007.tif"/>
</fig>
</sec>
<sec id="s3_6">
<title><italic>Kank1</italic> Enhanced <italic>Dmrt1</italic> Gene Expression</title>
<p>A previous study showed <italic>Dmrt1</italic> was different in the X and Y chromosome, respectively named as Dmrt1X and Dmrt1Y. <italic>Dmrt1</italic>, as a transcription factor, can bind to its own promoter and regulate the expression of itself (submitted, Sun et&#xa0;al.). We constructed the expression vector of <italic>Dmrt1</italic> and <italic>Kank1</italic>, and co-transfected them into the CHO cells. The result suggests that Dmrt1 expressed in cell nucleus and Kank1 expressed in karyoplasm (<xref ref-type="fig" rid="f8"><bold>Figure&#xa0;8</bold></xref>), indicating Kank1 was really a shuttling protein. With the dual-luciferase reporter assay, we detected the transcription level of <italic>dmrt1_Luc</italic> gene was higher when transfecting the pCS2-dmrt1-EGFP and pCS2-kank1-mCherry with pGL3-basic-<italic>dmrt1</italic>_promoter simultaneously than only transfecting the pCS2-dmrt1-EGFP with pGL3-basic-<italic>dmrt1</italic>_promoter in CHO cells and 293T cells (<xref ref-type="fig" rid="f9"><bold>Figures&#xa0;9A, B</bold></xref>). This result demonstrates that Kank1 together with Dmrt1 enhanced the expression of <italic>dmrt1</italic>, possibly through its interaction with Dmrt1 protein to act on the promoter of <italic>dmrt1</italic>. Previous work has shown that Kank1 negatively regulated actin polymerization and cell motility (<xref ref-type="bibr" rid="B22">Kakinuma et&#xa0;al., 2009</xref>). We speculated that Kank1 might take part in the sex determination through inhibiting the primordial germ cells migration at the cell development and increased the expression of sex-determining gene - <italic>dmrt1</italic>- in yellow drum.</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Co-transfection pCS2-dmrt1-EGFP and pCS2-<italic>kank1</italic>-mCherry into the CHO cells. <italic>Kank1</italic> expressed in cytoplasm (white arrows) and in cell nucleus (yellow arrows). Scale bars: 50 &#x3bc;m.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-897004-g008.tif"/>
</fig>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>The result of dual-luciferase reporter assay in CHO cells <bold>(A)</bold> and in 293T cells <bold>(B)</bold>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-897004-g009.tif"/>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<sec id="s4_1">
<title><italic>Dmrt1</italic> Impacted the Germ Cells Migration and Development</title>
<p>Gonad is constituted by somatic cells and germ cells. And sex determination includes somatic sex determination and germ cell sex determination (<xref ref-type="bibr" rid="B38">Nagahama et&#xa0;al., 2021</xref>). It has long been believed that gonadal somatic cells instruct germ cells to adopt their sexual fates, and somatic signals decide germ cells whether they reside in a male or female body. The sex-determining genes that have been reported mostly express in somatic cells and the mutation of these genes result in sex reversal, such as <italic>Sry</italic> (<xref ref-type="bibr" rid="B48">Sinclair et&#xa0;al., 1990</xref>), <italic>Dmy</italic> (<xref ref-type="bibr" rid="B35">Matsuda et&#xa0;al., 2002</xref>), and <italic>Amhy</italic> (<xref ref-type="bibr" rid="B17">Hattori et&#xa0;al., 2012</xref>). Sex reversal of genetic females (XX) could be induced by the transplantation of XY somatic cells in the medaka, <italic>Oryzias latipes</italic> (<xref ref-type="bibr" rid="B46">Shinomiya et&#xa0;al., 2002</xref>). Nishimura et&#xa0;al. found that <italic>foxl3</italic> was a germ cell-intrinsic factor involved in sperm-egg fate decision in medaka. XX medaka with disrupted <italic>foxl3</italic> developed functional sperm in the expanded germinal epithelium of a histologically functional ovary (<xref ref-type="bibr" rid="B40">Nishimura et&#xa0;al., 2015</xref>). A recent report showed that the sexual fate of tilapia germline was determined by the antagonistic interaction of <italic>dmrt1</italic> and <italic>foxl3</italic> (<xref ref-type="bibr" rid="B7">Dai et&#xa0;al., 2021</xref>). The conventional idea is challenged by these recent studies. These results also indicate that the crosstalk between germ cells and gonadal somatic cells is critical for sex differentiation of the gonads. To address the question, the relevant research in this study was carried out.</p>
<p>In this study, we confirmed the 36 dph was a sex determination critical stage in yellow drum through transcriptome analysis at the early stages. Subsequently, we analyzed the differential genes and the signaling pathways they participated in at 36 dph. We discovered that the signaling pathways in females and males were different at sex determination critical stage. In females, the cell cycle and Wnt signaling pathway were mainly enriched and the most biological process was about germ cell development and gamete generation. This result suggests the germ cells in the differentiation process in females. Given germ cells confront two major cell fate decisions as they move from an immature state into sexuality, one decision is entering into a germline-specific cell cycle (i.e., meiosis), and the other is the commitment to differentiate as spermatozoa or eggs (<xref ref-type="bibr" rid="B24">Kimble and Page, 2007</xref>), and the cell cycle entering into meiosis is considered as a hallmark of feminization of germ cells (<xref ref-type="bibr" rid="B23">Kikuchi et&#xa0;al., 2020</xref>). We suspected that the germ cells sex determination would progress toward to the females when it was in cell cycle and reproduction. <italic>Dmrt1</italic> has been cloned and was demonstrated as the most possible sex determination gene in yellow drum (Sun et al., submitted). In medaka, the <italic>dmrt1</italic> gene resulted in negative regulation of germ cells proliferation and mediated a mitotic arrest of germ cells (<xref ref-type="bibr" rid="B20">Herpin et&#xa0;al., 2007</xref>). In yellow drum, the <italic>dmrt1</italic> gene almost exclusively expressed in males, implying it was a barrier for proliferation and feminization of germ cells, and an intrigue for the gonad masculinization. In males, the main enrichment signaling pathway included TGF-beta signaling and Focal adhesion, the main biological process involved cell migration, cell motility, and tube morphogenesis. So, another possibility was the <italic>dmrt1</italic> gene may negatively regulate the germ cells migrated to the primordial gonadial ridge and caused two types of gonadal tissues to be observed in the development stage of 40 days post-hatch (dph), which were designated as tissue type I and type II (<xref ref-type="bibr" rid="B31">Lou et&#xa0;al., 2016</xref>). Unfortunately, we failed to investigate the numbers of germ cells at early stage using histological experiments in yellow drum. Future research would pay more attention to this question.</p>
</sec>
<sec id="s4_2">
<title>How <italic>Kank1</italic> Participated in the Sex Determination Process</title>
<p>We found the Kank1 protein contained a nuclear localization signal (NLS) and a nuclear export signal (NES), and expressed in karyoplasm in CHO cells. These results were consistent with the Kank protein in humans (<xref ref-type="bibr" rid="B51">Wang et&#xa0;al., 2006</xref>), and suggest that Kank1 of yellow drum was also a shuttling protein. Nuclei-cytoplasmic transportation of proteins plays an important role in the regulation of many cellular processes, including signal transduction, cell cycle progression and cell proliferation (<xref ref-type="bibr" rid="B12">Gama-Carvalho and Carmo-Fonseca, 2001</xref>). Furthermore, studies have demonstrated that Kank could bind to &#x3b2;-catenin and promote the nuclear localization of &#x3b2;-catenin, which results in the activation of &#x3b2;-catenin-mediated transcription (<xref ref-type="bibr" rid="B51">Wang et&#xa0;al., 2006</xref>). The &#x3b2;-catenin is an important component in the Wnt signaling pathway which is involved in various differentiation events during embryonic development (<xref ref-type="bibr" rid="B32">Lustig and Behrens, 2003</xref>). Evidence in mice and humans implied WNT4 and R-SPONDIN-1 (RSPO1) promoted the ovarian fate and blocked testis development, and activation of &#x3b2;-catenin was sufficient to block the testis pathway (<xref ref-type="bibr" rid="B34">Maatouk et&#xa0;al., 2008</xref>). In protandrous black porgy (<italic>Acanthopagrus schlegeli</italic>), <italic>wnt4</italic> has important roles in late ovarian growth and natural sex change, such as oogonia proliferation, structure of ovarian lamellae, and vitellogenic oocytes (<xref ref-type="bibr" rid="B52">Wu and Chang, 2009</xref>). A previous study reported that <italic>rspo1</italic> expressed more strongly in ovaries than in testes in zebrafish (<xref ref-type="bibr" rid="B56">Zhang et&#xa0;al., 2011</xref>). In Nile tilapia (<italic>Oreochromis niloticus</italic>), &#x3b2;-catenin1 and &#x3b2;-catenin2 played roles in ovarian differentiation and maintenance of female pathway (<xref ref-type="bibr" rid="B53">Wu et&#xa0;al., 2016</xref>). However, the roles of the RSPO1/Wnt/&#x3b2;-catenin signaling pathway in the sex determination in fish is still not clear. In teleost, the sequential hermaphroditism is not unusual (<xref ref-type="bibr" rid="B6">Colombo and Grandidr, 1996</xref>; <xref ref-type="bibr" rid="B18">Helfman et&#xa0;al., 1997</xref>), protogynous fishes develop into females first and become males later during fry stage, such as zebrafish (<xref ref-type="bibr" rid="B33">Maack and Segner, 2003</xref>), lager yellow croaker (<xref ref-type="bibr" rid="B55">You et&#xa0;al., 2012</xref>), and yellow drum (<xref ref-type="bibr" rid="B31">Lou et&#xa0;al., 2016</xref>). In the female-determination process of yellow drum, it is not clear whether <italic>Kank1</italic> could activate the &#x3b2;-catenin-mediated transcription and exert the same function as in mice and humans, given that <italic>kank1</italic> was not differentially expressed between genetic females and males before 36 dph.</p>
<p>The <italic>kank1</italic> gene was expressed significantly higher in males than females at sex-determination critical stages, indicating <italic>kank1</italic> was more favorable in male sex determination. With the protein network interaction analysis, we uncovered that <italic>Kank1</italic> took part in the germ cells migration process and interacted with <italic>Dmrt1</italic>. <italic>Kank1</italic> might act as a shuttling protein as in humans and play difunctional roles at the early gonadal development stages, i.e., not only participated in the germ cells motility, but also increased the expression of <italic>dmrt1</italic> in yellow drum. Although the histological location of <italic>Kank1</italic> has not been confirmed, we speculate it should at least express in germ cells based on the role of <italic>Kank1</italic> in the cell migration in yellow drum. <italic>Kank1</italic> enhanced the expression of <italic>dmrt1</italic> in yellow drum, and <italic>dmrt1</italic> is the master sex-determining gene and triggered the testis development. These results indicate <italic>kank1</italic> might act as an upstream factor of the <italic>dmrt1</italic> gene. Of note, the sex battle and antagonism between female and male are from beginning to end. So, the balance of these factors leading to either male or female development is important. Once the balance is destroyed, the sex reversal will happen.</p>
</sec>
</sec>
<sec id="s5">
<title>Conclusion</title>
<p>We confirmed the 36 dph was a sex determination critical stage in yellow drum through transcriptome analysis at the early development stages. We further found that Kank1 participated in the cell motility process and interacted with Dmrt1 in yellow drum. With the dual-luciferase reporter assay, we detected that <italic>Kank1</italic> increased the transcription of <italic>dmrt1_Luc</italic> gene in CHO cells and 293T cells. In addition, we observed Kank1 was not only expressed in the cytoplasm but also in the nucleus in CHO cells through fluorescence microscope. These results suggest that <italic>Kank1</italic> acts as a shuttling protein as in humans and might play a difunctional role at the early gonad development stage - participating in the germ cells motility and increasing the expression of <italic>dmrt1</italic> in yellow drum.</p>
</sec>
<sec id="s6" sec-type="data-availability">
<title>Data Availability Statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: NCBI (accession: PRJNA817837).</p>
</sec>
<sec id="s7" sec-type="ethics-statement">
<title>Ethics Statement</title>
<p>The animal study was reviewed and approved by the Animal Care and Use Committee of Jimei University.</p>
</sec>
<sec id="s8" sec-type="author-contributions">
<title>Author Contributions</title>
<p>SS, WL and ZW designed the experiments and wrote the paper. SS, JL, SZ, QH, WH, KY, and FH performed the research. SS and WL analyzed the data. All authors read and approved the final version of the manuscript.</p>
</sec>
<sec id="s9" sec-type="funding-information">
<title>Funding</title>
<p>This work was supported by the National Key Research and Development Program of China (grant number 2018YFD0900202); the National Natural Science Foundation of China (grant numbers 31872562, U1705231, 32072969).</p>
</sec>
<sec id="s10" sec-type="COI-statement">
<title>Conflict of Interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s11" sec-type="disclaimer">
<title>Publisher&#x2019;s Note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
</body>
<back>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Andrews</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Fastqc. A Quality Control Tool for High Throughput Sequence Data</article-title>.</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bao</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Tian</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Elaswad</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>Z.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>The Y Chromosome Sequence of the Channel Catfish Suggests Novel Sex Determination Mechanisms in Teleost Fish</article-title>. <source>BMC Biol.</source> <volume>17</volume>, <elocation-id>6</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12915-019-0627-7</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bowles</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Koopman</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Sex Determination in Mammalian Germ Cells: Extrinsic Versus Intrinsic Factors</article-title>. <source>Reprod. (Cambr. Engl.)</source> <volume>139</volume>, <fpage>943</fpage>&#x2013;<lpage>958</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1530/rep-10-0075</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Capel</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Vertebrate Sex Determination: Evolutionary Plasticity of a Fundamental Switch</article-title>. <source>Nat. Rev. Genet.</source> <volume>18</volume>, <fpage>675</fpage>&#x2013;<lpage>689</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nrg.2017.60</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Charlesworth</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Charlesworth</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Marais</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Steps in the Evolution of Heteromorphic Sex Chromosomes</article-title>. <source>Heredity</source> <volume>95</volume>, <fpage>118</fpage>&#x2013;<lpage>128</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/sj.hdy.6800697</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Colombo</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Grandidr</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>1996</year>). <article-title>Histological Study of the Development and Sex Differentiation of the Gonad in the European Eel</article-title>. <source>J. Fish Biol.</source> <volume>48</volume>, <fpage>493</fpage>&#x2013;<lpage>512</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1095-8649.1996.tb01443.x</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dai</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Qi</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>X.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Germline Sexual Fate Is Determined by the Antagonistic Action of Dmrt1 and Foxl3/Foxl2 in Tilapia</article-title>. <source>Development</source> <volume>148</volume>, <fpage>1</fpage>&#x2013;<lpage>14</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1242/dev.199380</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ding</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Goncharov</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Jin</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Chisholm</surname> <given-names>A. D.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>C. Elegans Ankyrin Repeat Protein Vab-19 Is a Component of Epidermal Attachment Structures and Is Essential for Epidermal Morphogenesis</article-title>. <source>Development</source> <volume>130</volume>, <fpage>5791</fpage>&#x2013;<lpage>5801</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1242/dev.00791</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dobin</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Davis</surname> <given-names>C. A.</given-names>
</name>
<name>
<surname>Schlesinger</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Drenkow</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Zaleski</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Jha</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2013</year>). <article-title>Star: Ultrafast Universal Rna-Seq Aligner</article-title>. <source>Bioinformatics</source> <volume>29</volume>, <fpage>15</fpage>&#x2013;<lpage>21</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/bioinformatics/bts635</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fan</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Tian</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Cheng</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Liang</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Z.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Aberrant Kank1 Expression Regulates Yap to Promote Apoptosis and Inhibit Proliferation in Oscc</article-title>. <source>J. Cell Physiol.</source> <volume>235</volume>, <fpage>1850</fpage>&#x2013;<lpage>1865</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/jcp.29102</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fujimoto</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Nishimura</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Goto-Kazeto</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Kawakami</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Yamaha</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Arai</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Sexual Dimorphism of Gonadal Structure and Gene Expression in Germ Cell-Deficient Loach, a Teleost Fish</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>107</volume>, <fpage>17211</fpage>&#x2013;<lpage>17216</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.1007032107</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gama-Carvalho</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Carmo-Fonseca</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>The Rules and Roles of Nucleocytoplasmic Shuttling Proteins</article-title>. <source>FEBS Lett.</source> <volume>498</volume>, <fpage>157</fpage>&#x2013;<lpage>163</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0014-5793(01)02487-5</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Golpour</surname> <given-names>A.</given-names>
</name>
<name>
<surname>P&#x161;eni&#x10d;ka</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Niksirat</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2016</year>a). <article-title>Ultrastructural Localization of Intracellular Calcium During Spermatogenesis of Sterlet (<italic>Acipenser Ruthenus</italic>)</article-title>. <source>Microsc. Microanal.</source> <volume>22</volume>, <fpage>1155</fpage>&#x2013;<lpage>1161</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1017/S1431927616011958</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Golpour</surname> <given-names>A.</given-names>
</name>
<name>
<surname>P&#x161;eni&#x10d;ka</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Niksirat</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2016</year>b). <article-title>Subcellular Localization of Calcium Deposits During Zebrafish (Danio Rerio) Oogenesis</article-title>. <source>Micron</source> <volume>80</volume>, <fpage>6</fpage>&#x2013;<lpage>13</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.micron.2015.09.004</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Golpour</surname> <given-names>A.</given-names>
</name>
<name>
<surname>P&#x161;eni&#x10d;ka</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Niksirat</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Subcellular Distribution of Calcium During Spermatogenesis of Zebrafish, <italic>Danio Rerio</italic>
</article-title>. <source>J. Morphol</source> <volume>278</volume>, <fpage>1149</fpage>&#x2013;<lpage>1159</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/jmor.20701</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Goto</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Saito</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Takeda</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Fujimoto</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Takagi</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Arai</surname> <given-names>K.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>Germ Cells Are Not the Primary Factor for Sexual Fate Determination in Goldfish</article-title>. <source>Dev. Biol.</source> <volume>370</volume>, <fpage>98</fpage>&#x2013;<lpage>109</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ydbio.2012.07.010</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hattori</surname> <given-names>R. S.</given-names>
</name>
<name>
<surname>Murai</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Oura</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Masuda</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Majhi</surname> <given-names>S. K.</given-names>
</name>
<name>
<surname>Sakamoto</surname> <given-names>T.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>A Y-Linked Anti-M&#xfc;llerian Hormone Duplication Takes Over a Critical Role in Sex Determination</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>109</volume>, <fpage>2955</fpage>&#x2013;<lpage>2959</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.1018392109</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Helfman</surname> <given-names>G. S.</given-names>
</name>
<name>
<surname>Collette</surname> <given-names>B. B.</given-names>
</name>
<name>
<surname>Facey</surname> <given-names>D. E.</given-names>
</name>
</person-group> (<year>1997</year>). <source>The Diversity of Fishes</source> <publisher-loc>(Boston, Mass.</publisher-loc>: <publisher-name>Blackwell Science)</publisher-name>.</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Herpin</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Schartl</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Molecular Mechanisms of Sex Determination and Evolution of the Y-Chromosome: Insights From the Medaka Fish (<italic>Oryzias Latipes</italic>)</article-title>. <source>Mol. Cell Endocrinol.</source> <volume>306</volume>, <fpage>51</fpage>&#x2013;<lpage>58</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.mce.2009.02.004</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Herpin</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Schindler</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Kraiss</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Hornung</surname> <given-names>U.</given-names>
</name>
<name>
<surname>Winkler</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Schartl</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2007</year>). <article-title>Inhibition of Primordial Germ Cell Proliferation by the Medaka Male Determining Gene Dmrt1 by</article-title>. <source>BMC Dev. Biol.</source> <volume>7</volume>, <elocation-id>99</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1471-213X-7-99</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kakinuma</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Roy</surname> <given-names>B. C.</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Kiyama</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Kank Regulates Rhoa-Dependent Formation of Actin Stress Fibers and Cell Migration <italic>via</italic> 14-3-3 in Pi3k-Akt Signaling</article-title>. <source>J. Cell Biol.</source> <volume>181</volume>, <fpage>537</fpage>&#x2013;<lpage>549</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1083/jcb.200707022</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kakinuma</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Roy</surname> <given-names>B. C.</given-names>
</name>
<name>
<surname>Kiyama</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Kank Proteins: Structure, Functions and Diseases</article-title>. <source>Cell Mol. Life Sci.</source> <volume>66</volume>, <fpage>2651</fpage>&#x2013;<lpage>2659</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00018-009-0038-y</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kikuchi</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Nishimura</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Ishishita</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Matsuda</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Tanaka</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Foxl3, a Sexual Switch in Germ Cells, Initiates Two Independent Molecular Pathways for Commitment to Oogenesis in Medaka</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>117</volume>, <fpage>12174</fpage>&#x2013;<lpage>12181</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.1918556117</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kimble</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Page</surname> <given-names>D. C.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>The Mysteries of Sexual Identity. The Germ Cell's Perspective</article-title>. <source>Science</source> <volume>316</volume>, <fpage>400</fpage>&#x2013;<lpage>401</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/science.1142109</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kocer</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Reichmann</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Best</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Adams</surname> <given-names>I. R.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Germ Cell Sex Determination in Mammals</article-title>. <source>Mol. Hum. Reprod.</source> <volume>15</volume>, <fpage>205</fpage>&#x2013;<lpage>213</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/molehr/gap008</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kurokawa</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Saito</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Nakamura</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Katoh-Fukui</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Ohta</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Baba</surname> <given-names>T.</given-names>
</name>
<etal/>
</person-group>. (<year>2007</year>). <article-title>Germ Cells Are Essential for Sexual Dimorphism in the Medaka Gonad</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>104</volume>, <fpage>16958</fpage>&#x2013;<lpage>16963</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.0609932104</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lesch</surname> <given-names>B. J.</given-names>
</name>
<name>
<surname>Page</surname> <given-names>D. C.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Genetics of Germ Cell Development</article-title>. <source>Nat. Rev. Genet.</source> <volume>13</volume>, <fpage>781</fpage>&#x2013;<lpage>794</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nrg3294</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lewis</surname> <given-names>Z. R.</given-names>
</name>
<name>
<surname>McClellan</surname> <given-names>M. C.</given-names>
</name>
<name>
<surname>Postlethwait</surname> <given-names>J. H.</given-names>
</name>
<name>
<surname>Cresko</surname> <given-names>W. A.</given-names>
</name>
<name>
<surname>Kaplan</surname> <given-names>R. H.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Female-Specific Increase in Primordial Germ Cells Marks Sex Differentiation in Threespine Stickleback (<italic>Gasterosteus Aculeatus</italic>)</article-title>. <source>J. Morphol.</source> <volume>269</volume>, <fpage>909</fpage>&#x2013;<lpage>921</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/jmor.10608</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Gui</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Diverse and Variable Sex Determination Mechanisms in Vertebrates</article-title>. <source>Sci. China Life Sci.</source> <volume>61</volume>, <fpage>1503</fpage>&#x2013;<lpage>1514</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11427-018-9415-7</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Mei</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Gui</surname> <given-names>J. F.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Distinct and Cooperative Roles of Amh and Dmrt1 in Self-Renewal and Differentiation of Male Germ Cells in Zebrafish</article-title>. <source>Genetics</source> <volume>207</volume>, <fpage>1007</fpage>&#x2013;<lpage>1022</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1534/genetics.117.300274</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lou</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Geng</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhan</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Mao</surname> <given-names>G</given-names>
</name>
</person-group>. (<year>2016</year>). <article-title>Histological Characterization of Gonadal Sex Differentiation in <italic>Nibea Albiflora</italic>
</article-title>. <source>Aquacult Res.</source> <volume>47</volume>, <fpage>632</fpage>&#x2013;<lpage>639</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/are.12523</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lustig</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Behrens</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>The Wnt Signaling Pathway and Its Role in Tumor Development</article-title>. <source>J. Cancer Res. Clin. Oncol.</source> <volume>129</volume>, <fpage>199</fpage>&#x2013;<lpage>221</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00432-003-0431-0</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Maack</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Segner</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Morphological Development of the Gonads in Zebrafish</article-title>. <source>J. Fish Biol.</source> <volume>62</volume>, <fpage>895</fpage>&#x2013;<lpage>906</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1046/j.1095-8649.2003.00074.x</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Maatouk</surname> <given-names>D. M.</given-names>
</name>
<name>
<surname>DiNapoli</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Alvers</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Parker</surname> <given-names>K. L.</given-names>
</name>
<name>
<surname>Taketo</surname> <given-names>M. M.</given-names>
</name>
<name>
<surname>Capel</surname> <given-names>B.</given-names>
</name>
<etal/>
</person-group>. (<year>2008</year>). <article-title>Stabilization of Beta-Catenin in Xy Gonads Causes Male-to-Female Sex-Reversal</article-title>. <source>Hum. Mol. Genet.</source> <volume>17</volume>, <fpage>2949</fpage>&#x2013;<lpage>2955</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/hmg/ddn193</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Matsuda</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Nagahama</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Shinomiya</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Sato</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Matsuda</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Kobayashi</surname> <given-names>T.</given-names>
</name>
<etal/>
</person-group>. (<year>2002</year>). <article-title>Dmy Is a Y-Specific Dm-Domain Gene Required for Male Development in the Medaka Fish</article-title>. <source>Nature</source> <volume>417</volume>, <fpage>559</fpage>&#x2013;<lpage>563</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nature751</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mhawech</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>14-3-3 Proteins&#x2013;an Update</article-title>. <source>Cell Res.</source> <volume>15</volume>, <fpage>228</fpage>&#x2013;<lpage>236</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/sj.cr.7290291</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Myosho</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Otake</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Masuyama</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Matsuda</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Kuroki</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Fujiyama</surname> <given-names>A.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>Tracing the Emergence of a Novel Sex-Determining Gene in Medaka, <italic>Oryzias Luzonensis</italic>
</article-title>. <source>Genetics</source> <volume>191</volume>, <fpage>163</fpage>&#x2013;<lpage>170</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1534/genetics.111.137497</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nagahama</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Chakraborty</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Paul-Prasanth</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Ohta</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Nakamura</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Sex Determination, Gonadal Sex Differentiation, and Plasticity in Vertebrate Species</article-title>. <source>Physiol. Rev.</source> <volume>101</volume>, <fpage>1237</fpage>&#x2013;<lpage>1308</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1152/physrev.00044.2019</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Niksirat</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Siino</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Steinbach</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Levander</surname> <given-names>F.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>High-Resolution Proteomic Profiling Shows Sexual Dimorphism in Zebrafish Heart-Associated Proteins</article-title>. <source>J. Proteome Res.</source> <volume>20</volume>, <fpage>4075</fpage>&#x2013;<lpage>4088</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/acs.jproteome.1c00387</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nishimura</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Sato</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Yamamoto</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Watakabe</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Ohkawa</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Suyama</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Sex Determination. Foxl3 Is a Germ Cell-Intrinsic Factor Involved in Sperm-Egg Fate Decision in Medaka</article-title>. <source>Science</source> <volume>349</volume>, <fpage>328</fpage>&#x2013;<lpage>331</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/science.aaa2657</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pertea</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Pertea</surname> <given-names>G. M.</given-names>
</name>
<name>
<surname>Antonescu</surname> <given-names>C. M.</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>T. C.</given-names>
</name>
<name>
<surname>Mendell</surname> <given-names>J. T.</given-names>
</name>
<name>
<surname>Salzberg</surname> <given-names>S. L</given-names>
</name>
</person-group>. (<year>2015</year>). <article-title>Stringtie Enables Improved Reconstruction of a Transcriptome From RNA-Seq Reads</article-title>. <source>Nat. Biotechnol.</source> <volume>33</volume>, <fpage>290</fpage>&#x2013;<lpage>295</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nbt.3122</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Richardson</surname> <given-names>B. E.</given-names>
</name>
<name>
<surname>Lehmann</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Mechanisms Guiding Primordial Germ Cell Migration: Strategies From Different Organisms</article-title>. <source>Nat. Rev. Mol. Cell Biol.</source> <volume>11</volume>, <fpage>37</fpage>&#x2013;<lpage>49</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nrm2815</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ridley</surname> <given-names>A. J.</given-names>
</name>
<name>
<surname>Schwartz</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Burridge</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Firtel</surname> <given-names>R. A.</given-names>
</name>
<name>
<surname>Ginsberg</surname> <given-names>M. H.</given-names>
</name>
<name>
<surname>Borisy</surname> <given-names>G.</given-names>
</name>
<etal/>
</person-group>. (<year>2003</year>). <article-title>Cell Migration: Integrating Signals From Front to Back</article-title>. <source>Science</source> <volume>302</volume>, <fpage>1704</fpage>&#x2013;<lpage>1709</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/science.1092053</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roy</surname> <given-names>B. C.</given-names>
</name>
<name>
<surname>Kakinuma</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Kiyama</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Kank Attenuates Actin Remodeling by Preventing Interaction Between Irsp53 and Rac1</article-title>. <source>J. Cell Biol.</source> <volume>184</volume>, <fpage>253</fpage>&#x2013;<lpage>267</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1083/jcb.200805147</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Saito</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Morinaga</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Aoki</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Nakamura</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Mitani</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Furutani-Seiki</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2007</year>). <article-title>Proliferation of Germ Cells During Gonadal Sex Differentiation in Medaka: Insights From Germ Cell-Depleted Mutant Zenzai</article-title>. <source>Dev. Biol.</source> <volume>310</volume>, <fpage>280</fpage>&#x2013;<lpage>290</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ydbio.2007.07.039</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shinomiya</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Shibata</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Sakaizumi</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Hamaguchi</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Sex Reversal of Genetic Females (Xx) Induced by the Transplantation of Xy Somatic Cells in the Medaka, <italic>Oryzias Latipes</italic>
</article-title>. <source>Int. J. Dev. Biol.</source> <volume>46</volume>, <fpage>711</fpage>&#x2013;<lpage>717</lpage>. doi: <pub-id pub-id-type="doi">10.1387/ijdb.12216983</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Siegfried</surname> <given-names>K. R.</given-names>
</name>
<name>
<surname>N&#xfc;sslein-Volhard</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Germ Line Control of Female Sex Determination in Zebrafish</article-title>. <source>Dev. Biol.</source> <volume>324</volume>, <fpage>277</fpage>&#x2013;<lpage>287</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ydbio.2008.09.025</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sinclair</surname> <given-names>A. H.</given-names>
</name>
<name>
<surname>Berta</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Palmer</surname> <given-names>M. S.</given-names>
</name>
<name>
<surname>Hawkins</surname> <given-names>J. R.</given-names>
</name>
<name>
<surname>Griffiths</surname> <given-names>B. L.</given-names>
</name>
<name>
<surname>Smith</surname> <given-names>M. J.</given-names>
</name>
<etal/>
</person-group>. (<year>1990</year>). <article-title>A Gene From the Human Sex-Determining Region Encodes a Protein With Homology to a Conserved DNA-Binding Motif</article-title>. <source>Nature</source> <volume>346</volume>, <fpage>240</fpage>&#x2013;<lpage>244</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/346240a0</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Xiao</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Han</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Cai</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>Genetic Sex Identification and the Potential Sex Determination System in the Yellow Drum (<italic>Nibea Albiflora</italic>)</article-title>. <source>Aquaculture</source> <volume>492</volume>, <fpage>253</fpage>&#x2013;<lpage>258</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.aquaculture.2018.03.042</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Takita</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>1974</year>). <article-title>Studies on the Early Life History of Nibea Albiflora (Richardson) in Ariake Sound</article-title>. <source>Bull. Faculty Fish Nagasaki Univ.</source> <volume>38</volume>, <fpage>1</fpage>&#x2013;<lpage>55</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/BF02674952</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Kakinuma</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Kiyama</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Nucleo-Cytoplasmic Shuttling of Human Kank Protein Accompanies Intracellular Translocation of Beta-Catenin</article-title>. <source>J. Cell Sci.</source> <volume>119</volume>, <fpage>4002</fpage>&#x2013;<lpage>4010</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1242/jcs.03169</pub-id>
</citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Wnt4 Is Associated With the Development of Ovarian Tissue in the Protandrous Black Porgy, <italic>Acanthopagrus Schlegeli</italic>
</article-title>. <source>Biol. Reprod.</source> <volume>81</volume>, <fpage>1073</fpage>&#x2013;<lpage>1082</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1095/biolreprod.109.077362</pub-id>
</citation>
</ref>
<ref id="B53">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Synergistic Role of &#x3b2;-Catenin1 and 2 in Ovarian Differentiation and Maintenance of Female Pathway in Nile Tilapia</article-title>. <source>Mol. Cell. Endocrinol.</source> <volume>427</volume>, <fpage>33</fpage>&#x2013;<lpage>44</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.mce.2016.03.002</pub-id>
</citation>
</ref>
<ref id="B54">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yano</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Guyomard</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Nicol</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Jouanno</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Quillet</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Klopp</surname> <given-names>C.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>An Immune-Related Gene Evolved Into the Master Sex-Determining Gene in Rainbow Trout, <italic>Oncorhynchus Mykiss</italic>
</article-title>. <source>Curr. Biol.</source> <volume>22</volume>, <fpage>1423</fpage>&#x2013;<lpage>1428</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cub.2012.05.045</pub-id>
</citation>
</ref>
<ref id="B55">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>You</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Cai</surname> <given-names>M. Y.</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Z.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Histological Observation on Gonadal Sex Differentiation in Large Yellow Croaker (<italic>Larimichthys Crocea</italic>)</article-title>. <source>J. Fish China</source> <volume>36</volume>, <fpage>1057</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3724/SP.J.1231.2012.27858</pub-id>
</citation>
</ref>
<ref id="B56">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>Q</given-names>
</name>
</person-group>. (<year>2011</year>). <article-title>Molecular Analysis Shows Differential Expression of R-Spondin1 in Zebrafish (<italic>Danio Rerio</italic>) Gonads</article-title>. <source>Mol. Biol. Rep.</source> <volume>38</volume>, <fpage>275</fpage>&#x2013;<lpage>282</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11033-010-0105-3</pub-id>
</citation>
</ref>
<ref id="B57">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Kakinuma</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Kiyama</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Kank Proteins: A New Family of Ankyrin-Repeat Domain-Containing Proteins</article-title>. <source>Biochim. Et Biophys. Acta (Bba) - Gen. Subj.</source> <volume>1780</volume>, <fpage>128</fpage>&#x2013;<lpage>133</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bbagen.2007.09.017</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>