<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Mar. Sci.</journal-id>
<journal-title>Frontiers in Marine Science</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Mar. Sci.</abbrev-journal-title>
<issn pub-type="epub">2296-7745</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fmars.2022.879388</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Marine Science</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Detection of Prokaryotes on the Astomatous Ciliated Protist <italic>Kentrophoros flavus</italic> (Ciliophora, Karyorelictea) Revealed A Consistently Associated <italic>Muribaculaceae</italic>-Like Bacterium</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Bi</surname>
<given-names>Luping</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1685116"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Xiaoxin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1701020"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zou</surname>
<given-names>Songbao</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1770763"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Ji</surname>
<given-names>Daode</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1143352"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Zhang</surname>
<given-names>Qianqian</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/858090"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>School of Ocean, Yantai University</institution>, <addr-line>Yantai</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Key Laboratory of Coastal Environmental Processes and Ecological Remediation, Yantai Institute of Coastal Zone Research, Chinese Academy of Sciences</institution>, <addr-line>Yantai</addr-line>, <country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Key Laboratory of Fish Health and Nutrition of Zhejiang Province, Zhejiang Institute of Freshwater Fisheries</institution>, <addr-line>Huzhou</addr-line>, <country>China</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>Muping Coastal Environment Research Station, Yantai Institute of Coastal Zone Research, Chinese Academy of Sciences</institution>, <addr-line>Yantai</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Alexey Potekhin, Saint Petersburg State University, Russia</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Valentina Serra, University of Pisa, Italy; Marcus Vinicius Xavier Senra, Universidade Federal do ABC, Brazil</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Daode Ji, <email xlink:href="mailto:daodeji@126.com">daodeji@126.com</email>; Qianqian Zhang, <email xlink:href="mailto:qqzhang@yic.ac.cn">qqzhang@yic.ac.cn</email>
</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Microbial Symbioses, a section of the journal Frontiers in Marine Science</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>06</day>
<month>06</month>
<year>2022</year>
</pub-date>
<pub-date pub-type="collection">
<year>2022</year>
</pub-date>
<volume>9</volume>
<elocation-id>879388</elocation-id>
<history>
<date date-type="received">
<day>19</day>
<month>02</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>03</day>
<month>05</month>
<year>2022</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2022 Bi, Zhang, Zou, Ji and Zhang</copyright-statement>
<copyright-year>2022</copyright-year>
<copyright-holder>Bi, Zhang, Zou, Ji and Zhang</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>The interactions between symbiotic bacterial consortia and their protist hosts in benthic environments have attracted increasing interest in recent years. In the present study, we investigated the diversity of potentially associated bacteria for an astomatous ciliate, <italic>Kentrophoros flavus</italic>, collected in the intertidal zone of Yantai, China. For the first time, the diversity of the associated bacteria in the species <italic>K. flavus</italic> was examined using 16S rRNA-based techniques (clone libraries and PacBio sequencing) and the fluorescence <italic>in situ</italic> hybridization (FISH) technique. The 16S rRNA-based sequencing revealed a higher diversity of associated bacteria in <italic>K. flavus</italic> than previously expected. In addition to a genus-typical thiotrophic symbiont, the &#x201c;<italic>Candidatus</italic> Kentron&#x201d; stain YE, we provide evidence showing the consistent existence of one <italic>Muribaculaceae</italic>-like bacterium that was secondarily abundant among the bacterial operational taxonomic units (OTUs). Fluorescence <italic>in situ</italic> hybridization (FISH) with three specific probes and double-label FISH experiments with &#x201c;<italic>Candidatus</italic> Kentron&#x201d; probes showed that the <italic>Muribaculaceae</italic>-like bacterium was abundant and merged with the &#x201c;<italic>Candidatus</italic> Kentron&#x201d; stain YE on the cell surface of the host. A phylogenetic analysis of the bacterial 16S rRNA gene showed that the bacterium was a distinct branch in <italic>Muribaculaceae</italic>, members of which are primarily reported from gut microbiome. The name &#x201c;<italic>Muribaculaceae</italic>-like bacterium associated with <italic>Kentrophoros flavus</italic>&#x201d; (MLAKF) is proposed for the new bacterium. The higher 16S rRNA diversity in <italic>K. flavus</italic> and the discovery of MLAKF on the cell surface both suggest a potential bacterial consortium that interacts with the host <italic>K. flavus</italic>.</p>
</abstract>
<kwd-group>
<kwd>
<italic>Kentrophoros</italic>
</kwd>
<kwd>symbiosis</kwd>
<kwd>bacterial diversity</kwd>
<kwd>ciliate</kwd>
<kwd>
<italic>Muribaculaceae</italic>
</kwd>
</kwd-group>
<contract-num rid="cn001">31672251, 31772413</contract-num>
<contract-num rid="cn002">No. 2019216</contract-num>
<contract-num rid="cn003">No. QYZDBSSW-DQC013-1</contract-num>
<contract-sponsor id="cn001">National Natural Science Foundation of China<named-content content-type="fundref-id">10.13039/501100001809</named-content>
</contract-sponsor>
<contract-sponsor id="cn002">Youth Innovation Promotion Association of the Chinese Academy of Sciences<named-content content-type="fundref-id">10.13039/501100004739</named-content>
</contract-sponsor>
<contract-sponsor id="cn003">Key Research Program of Frontier Science, Chinese Academy of Sciences<named-content content-type="fundref-id">10.13039/501100018527</named-content>
</contract-sponsor>
<counts>
<fig-count count="8"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="54"/>
<page-count count="13"/>
<word-count count="6488"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>Ciliates are widespread unicellular organisms in marine benthic environments (<xref ref-type="bibr" rid="B6">Choi et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B4">Cai et&#xa0;al., 2013</xref>) that include some extreme habitats (<xref ref-type="bibr" rid="B51">Wilbert and Song, 2005</xref>; <xref ref-type="bibr" rid="B23">Lei and Xu, 2008</xref>). One important mechanism that makes ciliates thrive in extreme environments (e.g., micro-aerobic/anoxic, sulfide-rich, high-nitrate) or grow on inaccessible diets in the sediment is harboring and interacting with symbiotic bacteria (<xref ref-type="bibr" rid="B29">Nowack and Melkonian, 2010</xref>). Recently, studies of the diversity of symbiotic bacteria associated with benthic ciliates have revealed novel bacterial species that possess specialized physical or biochemical traits (<xref ref-type="bibr" rid="B9">Embley et&#xa0;al., 1992</xref>; <xref ref-type="bibr" rid="B40">Rosati, 2002</xref>; <xref ref-type="bibr" rid="B1">Beinart et&#xa0;al., 2018</xref>; <xref ref-type="bibr" rid="B24">Lind et&#xa0;al., 2018</xref>; <xref ref-type="bibr" rid="B18">Graf et&#xa0;al., 2021</xref>). One well-known representative is the association of benthic ciliates with thiotrophic bacteria in which ectosymbionts account for approximately half the biomass of the symbiotic consortium in some species (<xref ref-type="bibr" rid="B11">Fenchel and Finlay, 1989</xref>). Ciliates associated with thiotrophic bacteria are known typically from two genera&#x2014;the periphyton <italic>Zoothamnium</italic> and the benthic <italic>Kentrophoros</italic>&#x2014;both of which are densely covered by ectosymbionts on the cell surface (<xref ref-type="bibr" rid="B38">Raikov, 1971</xref>; <xref ref-type="bibr" rid="B11">Fenchel and Finlay, 1989</xref>; <xref ref-type="bibr" rid="B8">Edgcomb et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B3">Bright et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B45">Seah et&#xa0;al., 2017</xref>). Evidence has shown that thiotrophic symbionts  can absorb and oxidize sulfide in sulfur-rich environments (<xref ref-type="bibr" rid="B11">Fenchel and Finlay, 1989</xref>; <xref ref-type="bibr" rid="B49">Volland et al., 2018</xref>; <xref ref-type="bibr" rid="B44">Seah et al., 2019</xref>). The symbionts  are phagocytized by the host as a food resource (<xref ref-type="bibr" rid="B12">Foissner, 1995</xref>; <xref ref-type="bibr" rid="B7">Dubilier et&#xa0;al., 2008</xref>; <xref ref-type="bibr" rid="B3">Bright et&#xa0;al., 2014</xref>) or directly release soluble organic molecules that are uptaken into the host cytoplasm (<xref ref-type="bibr" rid="B49">Volland et al., 2018</xref>). Mutually, the ciliate host may carry the ectosymbionts to a depth in sediments where the chemical gradients are not too steep and where the bacterial metabolisms are optimized (<xref ref-type="bibr" rid="B11">Fenchel and Finlay, 1989</xref>).</p>
<p>Some ciliates host more than one symbiotic (or associated) species that may form structural and functional consortia (<xref ref-type="bibr" rid="B8">Edgcomb et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B32">Park and Yu, 2018</xref>; <xref ref-type="bibr" rid="B22">Lanzoni et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B28">Mu&#xf1;oz-G&#xf3;mez et&#xa0;al., 2021</xref>). Functional consortia have been recovered in a geleiid karyorelictean ciliate that harbored two sulfate reducers, a methanogen, and possibly a Bacteroidetes and a Type I methanotroph (<xref ref-type="bibr" rid="B8">Edgcomb et&#xa0;al., 2011</xref>). A purple-green ciliate, <italic>Pseudoblepharisma tenue</italic>, was found simultaneously harboring green algae and anoxygenic photosynthesizers (e.g., purple bacteria) (<xref ref-type="bibr" rid="B28">Mu&#xf1;oz-G&#xf3;mez et&#xa0;al., 2021</xref>). <xref ref-type="bibr" rid="B2">Boscaro et&#xa0;al. (2019)</xref> found that up to six different symbionts could co-occur in the cytoplasm of a single <italic>Euplotes</italic> species. In ciliates associated with thiotrophic bacteria, much less attention has been paid to the diversity and composition of the ectosymbionts, although single thiotrophic bacterial species have been recognized in <italic>Zoothamnium</italic> (&#x201c;<italic>Candidatus</italic> Thiobios zoothamnicoli&#x201d;, <italic>Gammaproteobacteria</italic>) and <italic>Kentrophoros</italic> (&#x201c;<italic>Candidatus</italic> Kentron spp.&#x201d;, <italic>Gammaproteobacteria</italic>) (<xref ref-type="bibr" rid="B3">Bright et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B45">Seah et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B44">Seah et&#xa0;al., 2019</xref>).</p>
<p>Members of the genus <italic>Kentrophoros</italic> (Ciliophora and Karyorelictea) are microaerobic ciliates that are typically distributed in the chemocline between the oxidized and anaerobic sulfide&#x2013;reducing layers of marine sediments (<xref ref-type="bibr" rid="B10">Fenchel, 1969</xref>). They are typically characterized by a lack of the adoral zone for prey, but they are covered with dense rod-shaped chemolithotrophic bacteria on the cell surface (<xref ref-type="bibr" rid="B12">Foissner, 1995</xref>; <xref ref-type="bibr" rid="B15">Gao et&#xa0;al., 2010</xref>; <xref ref-type="bibr" rid="B52">Xu et&#xa0;al., 2011</xref>). It has been shown that this ciliate relies directly on engulfing symbionts (or adhering algae/particles) along the entire cell body as a food resource (<xref ref-type="bibr" rid="B11">Fenchel and Finlay, 1989</xref>; <xref ref-type="bibr" rid="B12">Foissner, 1995</xref>). Morphological observation and chemical measurement estimated that one <italic>Kentrophoros</italic> cell carries approximately 4500 bacteria that account for approximately half the biomass of the symbiont-ciliate consortium (<xref ref-type="bibr" rid="B11">Fenchel and Finlay, 1989</xref>). Earlier ultrastructural observations (<xref ref-type="bibr" rid="B11">Fenchel and Finlay, 1989</xref>; <xref ref-type="bibr" rid="B12">Foissner, 1995</xref>) and recent metagenomic methods (<xref ref-type="bibr" rid="B45">Seah et&#xa0;al., 2017</xref>) have both revealed sulfur-oxidizing bacteria among the symbionts. Using the meta-genome technique and 16S rDNA amplification, Seah et&#xa0;al. (<xref ref-type="bibr" rid="B45">2017</xref>; <xref ref-type="bibr" rid="B44">2019</xref>) recognized one genus from 13 <italic>Kentrophoros</italic> spp. and proposed the name &#x201c;<italic>Candidatus</italic> Kentron&#x201d; (hereafter, &#x201c;<italic>Ca</italic>. Kentron&#x201d;). Despite being known as the primary food source for <italic>Kentrophoros</italic>, a genomic study of &#x201c;<italic>Ca.</italic> Kentron&#x201d; revealed that the thiotrophic bacteria lack genes that encode canonical enzymes for autotrophic CO<sub>2</sub> fixation (<xref ref-type="bibr" rid="B44">Seah et&#xa0;al., 2019</xref>). This indicates that there must be extra energy and organic carbon sources for the &#x201c;Kentron-<italic>Kentrophoros</italic>&#x201d; system from the environment or microbial activities (<xref ref-type="bibr" rid="B44">Seah et&#xa0;al., 2019</xref>). Thus far, there have been no systematic studies investigating the bacterial diversity associated with the genus <italic>Kentrophoros</italic> (symbiotic and/or adhering). It is unclear if &#x201c;<italic>Ca</italic>. Kentron&#x201d; is the only genus among the ectosymbionts or whether there are other bacteria that interact with the &#x201c;Kentron-<italic>Kentrophoros</italic>&#x201d; system.</p>
<p>In recent decades, molecular approaches such as 16S rDNA cloning and sequencing and fluorescence <italic>in situ</italic> hybridization (FISH) have been increasingly used to detect and identify bacterial symbionts or associations with unicellular eukaryotes (<xref ref-type="bibr" rid="B8">Edgcomb et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B16">Gong et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B45">Seah et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B34">Plotnikov et&#xa0;al., 2019</xref>). Most recently, the newly developed PacBio platform was able to generate more than 5000 CCS 16S rDNA sequences from one sample (with &gt;0.99 accuracy for 16S rDNA fragments). This allows for a much deeper sequencing depth than is the case with rDNA clone libraries. These approaches make it possible to discover the potentially associated prokaryotes on <italic>Kentrophoros</italic> outside of &#x201c;<italic>Ca</italic>. Kentron&#x201d;.</p>
<p>In this study, we collected and described a <italic>Kentrophoros</italic> species, <italic>K. flavus</italic>, from the intertidal region near the eastern gate of Yantai University (hereafter, <italic>K. flavus</italic> YE). The bacterial diversity associated with <italic>K. flavus</italic> YE was examined using 16S rRNA-based approaches, including the clone library and PacBio sequencing. We detected a genus-typical thiotrophic symbiont and named it the &#x201c;<italic>Candidatus</italic> Kentron&#x201d; stain YE (hereafter, &#x201c;<italic>Ca</italic>. Kentron&#x201d; YE). In addition, an undescribed bacterium belonging to the molecular family <italic>Muribaculaceae</italic> was also consistently detected in the PacBio data. The name &#x201c;<italic>Muribaculaceae</italic>-like bacterium associated with <italic>Kentrophoros flavus</italic>&#x201d; (MLAKF) is proposed for the bacterium. Three specific probes were designed, and <italic>in situ</italic> FISH was performed to determine the location of MLAKF on the ciliate cells.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and Methods</title>
<sec id="s2_1">
<title>Sample Collection and Morphological Observations</title>
<p>
<italic>Kentrophoros flavus</italic> YE was collected on different dates from May 2020 to March 2022 from the intertidal zone near the eastern gate of Yantai University, China (37&#xb0;28&#x2032;50&#x2033;N, 121&#xb0;27&#x2032;41&#x2033;E). Samples were scraped at the chemocline in fine, well-sorted sands with a reduced, sulfide layer at an approximate 15&#xa0;cm beneath the sediment surface. Wet sands were transported to the laboratory and examined under a stereo microscope (Guiguang GL-6345BI, China). Living cells were observed using a bright field and differential interference contrast microscopy at 100-1000&#xd7; magnifications (Zeiss Axio Scope A1, Germany). Counts and measurements of the living cells were conducted at a magnification of 1000&#xd7;.</p>
</sec>
<sec id="s2_2">
<title>DNA Extraction, PCR Amplification, Clone Libraries, and PacBio Sequencing</title>
<p>Approximately 10 cells were isolated from the raw cultures using a micropipette and washed three times with <italic>in situ</italic> water filtered by a millipore filter of 0.2 &#xb5;m in pore diameter (Pall Laboratory, US) to remove the irrelevant bacteria in the environmental water. The ciliate cells were then starved for approximately 5&#xa0;h in the sterilized water, allowing the hosts to digest the potential bacterial food in the cytoplasm. Each individual was transferred into 1.5&#xa0;ml Eppendorf tubes with a small drop of water for DNA extraction. DNA was extracted using the REDExtract-N-Amp Tissue PCR Kit (Sigma, St. Louis, MO) according to <xref ref-type="bibr" rid="B17">Gong et&#xa0;al. (2016)</xref>.</p>
<p>The host&#x2019;s 18S rRNA gene was amplified <italic>via</italic> polymerase chain reaction (PCR) with the primers 82F (5&#x2032;-GAAACTGCGAATGGCTC-3&#x2032;) and 1492R (5&#x2032;-GGTTACCTTGTTACGACTT-3&#x2032;) according to <xref ref-type="bibr" rid="B50">Wang et&#xa0;al. (2019)</xref>. The PCR reaction solution (25 &#xb5;l) contained 2 &#xb5;l of 10 &#xb5;M primers, 1 &#xb5;l of template, 12.5 &#xb5;l of MegaFi&#x2122; Fidelity 2X PCR MasterMix with MegaFi&#x2122; Fidelity DNA Polymerase (ABM, Shanghai, China), and 9.5 &#xb5;l of nuclease-free H<sub>2</sub>O. The cycling parameters were as follows: pre-run of 3&#xa0;min at 95&#xb0;C, followed by 30 cycles of 30 s at 95&#xb0;C, 30 s at 56&#xb0;C, and 90 s at 72&#xb0;C, with a final extension of 10&#xa0;min at 72&#xb0;C. The associating bacteria&#x2019;s 16S rRNA gene was amplified <italic>via</italic> PCR with the primers 27F (5&#x2032;-AGAGTTTGATCMTGGCTCAG-3&#x2032;) and 1525R (5&#x2032;-AAGGAGGTGATCCAGCC-3&#x2032;). The PCR reaction solution (25 &#xb5;l) contained 2 &#xb5;l of 10 &#xb5;M primers, 1 &#xb5;l of template, 0.5 &#xb5;l of dNTP Mix (10 mM of each), 1.25 units of Vazyme Lamp<sup>&#xae;</sup> DNA Polymerase (Vazyme, Nanjing, China), 2.5 &#xb5;l 10X of Vazyme Lamp<sup>&#xae;</sup> buffer with MgCl<sub>2</sub>, and 18.75 &#xb5;l of nuclease-free H<sub>2</sub>O. The cycling parameters were as follows: pre-run of 5&#xa0;min at 94&#xb0;C, followed by 30 cycles of 90 s at 94&#xb0;C, 90 s at 53&#xb0;C, and 3&#xa0;min at 72&#xb0;C, with a final extension of 10&#xa0;min at 72&#xb0;C. The PCR products were purified using a TIANgel Midi Purification Kit (Tiangen Bio. Co., Shanghai, China) and then inserted into pCE2 TA/Blunt-Zero vectors (5&#xa0;min TA/Blunt-Zero Cloning Kit, Vazyme, Nanjing, China). The recombinant vectors were then transformed into competent cells Trans1-T1 (TransGen Biotech Co., Ltd., Beijing, China). The recombinants were screened using the blue/white selection. The white colonies were randomly selected and screened using PCR with the primers M13-20 and M13-26. Positive clones with the target inserts were sent for Sanger sequencing (Sangon Biotech Co., Ltd., Shanghai, China). A total of 132 clones were sent, and 46 sequences were successfully obtained, with an average length of 1500 bp.</p>
<p>For the other two ciliate individuals, the PacBio Sequel II platform was selected to complete the collection of the 16S rRNA full-length amplicons. The 16S rRNA gene was amplified using the same primers and PCR cycling parameters as those applied in the clone library construction. The PCR amplicons derived from two individuals were purified separately using the DNA Clean &amp; Concentrator&#x2122;-5 Kit (Zymo Research, Beijing, China), and each library was constructed according to the size of the amplified fragments (approximately 1500 bp). Sequencing was performed on a PacBio sequel II platform (Frasergen Co., Ltd., Wuhan, China), using a Hifi mode for small-insert (1.6kb) libraries, which allowed the insert being corrected by circular consensus sequences (CCS) for 30-40 times (with CCS&#x2265;3) and ensured an accuracy higher than 99.9%. More than 5000 raw CCS were generated from each sample.</p>
</sec>
<sec id="s2_3">
<title>Sequence Analysis for the Clone Library and the PacBio Data</title>
<p>Data derived from the clone libraries were examined manually to remove vector sections and low-qualified sequences using Bioedit (<xref ref-type="bibr" rid="B19">Hall et&#xa0;al., 2011</xref>). Data generated from PacBio sequencing were pretreated and qualified using the Pacific Biosciences&#x2019; SMRT Link v8.0 workflow (<uri xlink:href="https://www.pacb.com/support/software-downloads">https://www.pacb.com/support/software-downloads</uri>). Subreads were generated using the lima program integrated in SMRT Link inferring the barcode information of each sample. The subreads were converted to raw CCS using the CCS program with a strict threshold (minPasses&#x2265;3, minPredictedAccuracy&#x2265;0.99). Cutadapt V3.2 (<xref ref-type="bibr" rid="B25">Martin, 2011</xref>) was used to identify and trim the adapters from the raw CCS with a maximum error rate of 0.1. Chimeras and raw CCS shorter than 1300 bp were also filtered by Cutadapt V3.2.</p>
<p>The qualified clone sequences and clean CCS were pretreated following the methods of <xref ref-type="bibr" rid="B13">Fu et&#xa0;al. (2020)</xref>. Briefly, chimeras were further removed using the vsearch program integrated in QIIME v.1.8.0 (<xref ref-type="bibr" rid="B5">Caporaso et&#xa0;al., 2010</xref>), and the singletons were discarded using Mothur v.1.34.4 (<xref ref-type="bibr" rid="B42">Schloss et&#xa0;al., 2009</xref>). The resulting data were clustered according to operational taxonomic units (OTUs) at a sequence similarity of 97% using QIIME v.1.8.0 (<xref ref-type="bibr" rid="B5">Caporaso et&#xa0;al., 2010</xref>). The OTUs were blasted, aligned, and classified against the SILVA ribosomal RNA gene database (SILVA 128 database, accessed October 2021) (<xref ref-type="bibr" rid="B37">Quast et&#xa0;al., 2012</xref>). Analysis of the species composition and abundance was conducted to examine the major taxa of the associated bacteria using the Pacman package (<xref ref-type="bibr" rid="B33">Peng et&#xa0;al., 2021</xref>) appended in R (v3.6.2).</p>
</sec>
<sec id="s2_4">
<title>Phylogenetic Analysis for Ciliate and the Associated Bacteria</title>
<p>For the phylogenetic analyses of the 18S rRNA gene (ciliate host), 34 sequences from the ciliate class Karyorelictea and 11 sequences of the class Heterotrichea were downloaded from the GenBank database and were appended to the new 18S rRNA sequences. Members of class Heterotrichea were selected as outgroups. Two separate phylogenetic analyses of 16S rRNA were performed for the bacterial OTUs &#x201c;<italic>Ca.</italic> Kentron&#x201d; YE and MLAKF. For &#x201c;<italic>Ca.</italic> Kentron&#x201d; YE, the reference sequences were revised from the dataset of <xref ref-type="bibr" rid="B45">Seah et&#xa0;al. (2017)</xref>. A total of 42 16S rRNA sequences from the class <italic>Gammaproteobacteria</italic> were appended to the new sequences, and the classes <italic>Coxiellaceae</italic> and <italic>Ectothiorhodospiraceae</italic> were used as outgroups (<xref ref-type="bibr" rid="B45">Seah et&#xa0;al., 2017</xref>). For the OTU MLAKF, 44 sequences from the classes <italic>Muribaculaceae</italic>, <italic>Bacteroidaceae</italic>, <italic>Prevotellaceae</italic>, and <italic>Porphyromonadaceae</italic> of the phylum Bacteroidetes were appended. The classes <italic>Bacteroidaceae</italic>, <italic>Prevotellaceae</italic>, and <italic>Porphyromonadaceae</italic> were selected as outgroups (<xref ref-type="bibr" rid="B20">Lagkouvardos et&#xa0;al., 2019</xref>).</p>
<p>The assembled 16S and 18S rRNA datasets were first aligned using SINA v.1.2.11 integrated in the SILVA Web server (<uri xlink:href="https://www.arb-silva.de/aligner/">https://www.arb-silva.de/aligner/</uri>) with default parameters (<xref ref-type="bibr" rid="B36">Pruesse et&#xa0;al., 2012</xref>). The resulting alignments were refined manually to excise poorly aligned sites in SeaView v4.0 (<xref ref-type="bibr" rid="B14">Galtier et&#xa0;al., 1996</xref>). For the dataset of <italic>K. flavus</italic> YE, &#x201c;<italic>Ca</italic>. Kentron&#x201d; YE, and MLAKF, the final matrix used for the tree analysis comprised 1524, 1580, and 1505 nucleotide positions, respectively. The maximum likelihood (ML) and MrBayes v.3.2.2 (BI) algorithms were used to perform the phylogenetic tree analyses. In all three datasets, the GTR + I + &#x413; model was selected as the best model for both algorithms by jModelTest 2.1.7 (<xref ref-type="bibr" rid="B35">Posada, 2008</xref>) using the Akaike Information Criterion (AIC). The ML trees of the rRNA genes were constructed with RAxML V. 8 (<xref ref-type="bibr" rid="B46">Stamatakis, 2014</xref>) with 100 random taxon additions to generate the starting trees. Bootstrap support was inferred from 1000 pseudo replicate datasets. The Bayesian inference (BI) approach was implemented by MrBayes v.3.2.2 (<xref ref-type="bibr" rid="B39">Ronquist and Huelsenbeck, 2003</xref>). Markov chain Monte Carlo (MCMC) simulations were run for 5,000,000 generations (default temperature parameter and sampling frequency 0.01) with two parallel runs and each run with four simultaneous chains. The mean standard deviation of the split frequencies based on the last 75% of generations was 0.004 (&lt; 0.01) at the end of the analysis. The first 12,500 trees (corresponding to 25% of generations) were removed as burn-in. MEGA v.6 (<xref ref-type="bibr" rid="B47">Tamura et&#xa0;al., 2013</xref>) was used to visualize tree topologies and adjust the branches.</p>
</sec>
<sec id="s2_5">
<title>Fluorescence <italic>In Situ</italic> Hybridization (FISH)</title>
<p>Three 16S rRNA-targeted oligonucleotide probes targeting MLAKF were newly designed according to the method of <xref ref-type="bibr" rid="B16">Gong et&#xa0;al. (2014)</xref>, and they were named C01-612, C01-824, and C01-1125. The specificities of the probes were confirmed using the Test Probe 3.0 tool against the SILVA NR 99 database (<uri xlink:href="https://www.arb-silva.de/search/testprobe/">https://www.arb-silva.de/search/testprobe/</uri>). The non-sense probe NON338, complementary to C01-612/824/1125, was used as a negative control for the hybridization protocol. The specific probe chr4Ca for &#x201c;<italic>Ca.</italic> Kentron&#x201d; (<xref ref-type="bibr" rid="B45">Seah et&#xa0;al., 2017</xref>) was also employed in our FISH analysis to virtualize &#x201c;<italic>Ca.</italic> Kentron&#x201d; YE. The primary sequence and specificity of the four probes are shown in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Oligonucleotide probes used in FISH for the detection of the MLAKF bacteria and &#x201c;<italic>Candidatus</italic> Kentron&#x201d;.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Probe</th>
<th valign="top" align="center">Sequence (5&#x2032; - 3&#x2032;)</th>
<th valign="top" align="center">Specificity</th>
<th valign="top" align="center">Data source</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">C01-612</td>
<td valign="top" align="left">TTCGAGCCGTTGAAACTG</td>
<td valign="top" align="left">
<italic>Bacteroidetes</italic>, <italic>Muribaculaceae</italic>
</td>
<td valign="top" align="left">Present study</td>
</tr>
<tr>
<td valign="top" align="left">C01-824</td>
<td valign="top" align="left">AGAATGATCCCTGAGTGA</td>
<td valign="top" align="left">
<italic>Bacteroidetes</italic>, <italic>Muribaculaceae</italic>
</td>
<td valign="top" align="left">Present study</td>
</tr>
<tr>
<td valign="top" align="left">C01-1125</td>
<td valign="top" align="left">GTTGCTAACAGGTCAGGC</td>
<td valign="top" align="left">
<italic>Bacteroidetes</italic>, <italic>Muribaculaceae</italic>
</td>
<td valign="top" align="left">Present study</td>
</tr>
<tr>
<td valign="top" align="left">chr4Ca</td>
<td valign="top" align="left">CCGAGGATGTCAAAAGCAGG</td>
<td valign="top" align="left">
<italic>Gamma</italic>, <italic>Ca.</italic> Kentron</td>
<td valign="top" align="left">
<xref ref-type="bibr" rid="B45">Seah et&#xa0;al., 2017</xref>
</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Gamma indicates the bacterial class Gammaproteobacteria.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<p>The whole-cell hybridization procedure followed the protocol of <xref ref-type="bibr" rid="B30">Omar et&#xa0;al. (2017)</xref>. Starved ciliates were transferred on microscopic slides (Frontier FRC-05) and dried at room temperature after fixation using Bouin&#x2019;s solution (50%, final concentration). Prior to the FISH assay, the slides were washed three times in distilled water and then progressively dehydrated <italic>via</italic> ethanol gradients (30%, 50%, 80%, and 100%). The concentration of formamide for each probe was estimated in the mathFISH webserver (<uri xlink:href="http://mathfish.cee.wisc.edu/formamide.html">http://mathfish.cee.wisc.edu/formamide.html</uri>) (<xref ref-type="bibr" rid="B53">Y&#x131;lmaz and Noguera, 2007</xref>). The highest concentration (30%) among the three was applied to maximally remove unspecific hybridization (<xref ref-type="bibr" rid="B16">Gong et&#xa0;al., 2014</xref>). There was 36 &#x3bc;l of the hybridization buffer (20 mM Tris&#x2013;HCl at pH 8.0, 0.9 M NaCl, 0.01% SDS = sodium dodecyl sulfate, and 30% formamide) added to the slides together with 4 &#x3bc;l of the targeting fluorescent probes (5 ng/&#x3bc;l final concentration). &#x201c;Cy3&#x201d; fluorescence was applied to all MLAKF probes (C01-612/824/1125). For the double label experiment, the MLAKF and&#xa0;&#x201d;<italic>Ca</italic>.&#xa0;Kentron&#x201d; YE probes were labeled with &#x201c;Cy3&#x201d; and &#x201c;AF488&#x201d;, respectively. Considering the disparity in the bacterial abundance, the two probes were mixed in various ratios (3.5 &#x3bc;l  Cy3-C01-612/824:0.5 &#x3bc;l AF488-chrCa and 2 &#x3bc;l Cy3-C01-824: 2 &#x3bc;l AF488-chrCa) when applied in the experiment. The slides were incubated at 46&#xb0;C for 3&#xa0;h. After hybridization, the slides were dipped in a washing buffer (20 mM of Tris-HCl at pH 8.0, 450 mM of NaCl, 0.01% SDS) for 15&#xa0;min at 48&#xb0;C and then washed in chilled distilled water three times for 30 s. The specimens on the slides were covered with anti-fade mounting medium (Beyotime, China) and DAPI (50 ng/ml) for 5&#xa0;min in darkness prior to observations under an epifluorescence microscope (Olympus BX61, Japan) using a SPOT RT3 digital camera (SPOT Imaging Solutions, Sterling Heights, US) and mercury lamp accessories (Olympus U-RFL-T, Japan). Photomicrographs were colored using Image-pro plus 5.1.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>Morphological Description of the Host</title>
<p>The size of the host ciliate was 200-460 &#xd7; 16-36 &#x3bc;m <italic>in vivo</italic>, with a length:width ratio of 8-12:1 when fully extended (n=20; SD=71.5 and 7.8 for the length and width, respectively). The cells were highly flattened and had long ribbon shapes (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). The body was curved (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). The cells crawled along the bottom of the petri dish and attached to the substrate when stimulated. The ciliate had no cytostome. Nearly the entire dorsal surface of the cell was covered by rod-shaped bacteria that attached to the host erectly with one end (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1B&#x2013;E</bold>
</xref>). Refractile globules (approximately 1 &#x3bc;m in diameter) were found within nearly all the rod-shaped bacteria (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1C, D</bold>
</xref>). The ventral side of the ciliates showed no symbiotic bacteria (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1E</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Photomicrographs of <italic>Kentrophoros flavus</italic> YE from life. <bold>(A)</bold> Typical individual showing fold-over shape while gliding on the substrate; <bold>(B)</bold> showing the dense rod-shaped bacteria on the cell surface; <bold>(C)</bold> showing refractile globules within the rod-shaped bacteria; <bold>(D)</bold> details of the body margin showing rod-shaped bacteria (arrows); and <bold>(E)</bold> folded individual shows symbiotic bacteria on only one side (arrows). Scale bars = 100 &#x3bc;m <bold>(A)</bold>; 30 &#x3bc;m <bold>(B, E)</bold>; 5 &#x3bc;m <bold>(C, D)</bold>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-879388-g001.tif"/>
</fig>
</sec>
<sec id="s3_2">
<title>Phylogenetic Analyses of the Host</title>
<p>The 18S rRNA gene sequence of <italic>Kentrophoros flavus</italic> YE was deposited in the GenBank database with the accession number OM421748. The acquired 18S rRNA gene fragment was 1566 bp long and had a GC content of 48.98%. The BLAST search on NCBI showed that this 18S rRNA gene fragment had the highest identity (99.68%) with that of the <italic>K. flavus</italic> isolate QD (the accession number FJ467505) (<xref ref-type="bibr" rid="B15">Gao et&#xa0;al., 2010</xref>). The ML and BI trees based on the 18S rRNA gene showed identical topologies (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>) in which the new sequence of <italic>K. flavus</italic> YE clustered with two species, the <italic>K. flavus</italic> QD and one isolate of <italic>K. gracilis</italic>, with high support from the ML (97%) and BI (1.00).</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Maximum likelihood (ML) tree based on the 18S rRNA genes showing the positions of <italic>Kentrophoros flavus</italic> YE (in red) with a GTR + I + &#x413; model. The numbers on the nodes represent the bootstrap values of the ML and the posterior probability of the Bayesian inference (BI). The black dot on the node represents the bootstrap value &gt;95%. The species marked with blue asterisks have been reported with thiotrophic ectosymbionts. GenBank accession numbers are given following the species names. All branches are drawn to scale.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-879388-g002.tif"/>
</fig>
</sec>
<sec id="s3_3">
<title>Diversity of Bacteria Associated With <italic>Kentrophoros flavus</italic> YE, Revealed by Clone Library and PacBio Sequencing</title>
<p>A total of 46 clean 16S rRNA gene sequences were obtained from the clone library technique and were assigned to 17 OTUs (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>). Proteobacteria accounted for a sizable proportion of the assemblages (80.43%, 37 sequences). The most abundant OTU was affiliated with the genus &#x201c;<italic>Candidatus</italic> Kentron&#x201d; (41.30%, 19 sequences). The other OTUs comprised only a few sequences that were closely related to the genera <italic>Thalassolituus</italic> (10.87%, 5 sequences), <italic>Neisseria</italic> (8.7%, 4 sequences), <italic>Escherichia</italic> (4.35%, 2 sequences), <italic>Sphingobium</italic> (4.35%, 2 sequences), <italic>Streptococcus</italic> (4.35%, 2 sequences), and &#x201c;<italic>Candidatus</italic> Nitrososphaera&#x201d; (4.35%, 2 sequences).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Relative abundances of the bacterial major taxa in <italic>Kentrophoros flavus</italic> YE are suggested by the clone library data. Members of the genus, &#x201c;<italic>Candidatus</italic> Kentron&#x201d;, are shown as the most frequently occurring bacteria.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-879388-g003.tif"/>
</fig>
<p>A total of 6154 and 4729 clean CCS reads were generated from the PacBio sequencing data for the two ciliate individuals, the total of which was clustered to 121 OTUs (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>). Based on the total reads, the phylum Proteobacteria accounted for a considerable proportion of the assemblages (72.12%), followed by Bacteroidetes (10.63%) and Firmicutes (9.78%). The top three abundant bacterial orders were &#x201c;<italic>Ca.</italic> Kentron&#x201d; (53.89%), <italic>Bacteroidales</italic> (10.63%), and <italic>Pseudomonas</italic> (6.63%). The measurable OTUs (&gt;2% relative abundance) were affiliated with 7 genera: &#x201c;<italic>Ca.</italic> Kentron&#x201d; (53.89%), <italic>Muribaculaceae</italic>-like bacteria (the formerly S24&#x2013;7 group of <italic>Bacteroidales</italic>) (10.34%), <italic>Psychrobacter</italic> (5.53%), <italic>Cutibacterium</italic> (4.73%), <italic>Lactobacillus</italic> (3.74%), <italic>Staphylococcus</italic> (3.07%), and <italic>Thalassolituus</italic> (2.01%). Of the different ciliate individuals, the diversity of the most least abundant OTUs (&lt;10%) varied obviously, for example, <italic>Psychrobacter</italic> (5.53% vs. 0.01%), <italic>Cutibacterium</italic> (4.32% vs. 0.41%), <italic>Lactobacillus</italic> (2.26% vs. 1.48%), <italic>Staphylococcus</italic> (2.69% vs. 0.38%), and <italic>Thalassolituus</italic> (1.86% vs. 0.15%). Nevertheless, the OTUs affiliated with &#x201c;<italic>Ca.</italic> Kentron&#x201d; and <italic>Muribaculaceae</italic>-like bacteria consistently occurred with the highest proportions in both individuals (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>). Sequence of the former was nearly identical to the OTU affiliated with &#x201c;<italic>Ca.</italic> Kentron&#x201d; revealed in the Clone Library (differed by two bases). Accordingly, we named the two consistently occurring OTUs &#x201c;<italic>Ca.</italic> Kentron&#x201d; YE and &#x201c;<italic>Muribaculaceae</italic>-like bacteria associated with <italic>K. flavus</italic>&#x201d; (MLAKF). For the measurable OTUs in the PacBio data, the sequence length, GC content of the representative 16S rRNA, and the closely related sequences in the NCBI database gene fragments are provided in <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Relative abundances of the bacterial major taxa in <italic>Kentrophoros flavus</italic> YE, inferred by the PacBio data. Note that the genera, &#x201c;<italic>Candidatus</italic> Kentron&#x201d; and <italic>Muribaculaceae</italic>-like bacteria, are shown as the most frequently occurring taxa. A01 and C01 represent different individuals of <italic>Kentrophoros flavus</italic> YE.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-879388-g004.tif"/>
</fig>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Details of 16S rRNA gene fragments of &#x201c;<italic>Ca</italic>. Kentron&#x201d; YE and the measurable bacterial OTUs revealed by PacBio sequencing.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">OTU name</th>
<th valign="top" align="center">OTU abundance</th>
<th valign="top" align="center">Sequence length</th>
<th valign="top" align="center">GC content</th>
<th valign="top" align="center">Closely related sequences (Genbank accession number) and identity</th>
<th valign="top" align="center">Closely related known species (Genbank accession number) and identity</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">
<italic>Ca.</italic> Kentron YE OTU clone library</td>
<td valign="top" align="center">41.30%</td>
<td valign="top" align="center">1541</td>
<td valign="top" align="center">56.85%</td>
<td valign="top" align="left">
<italic>Ca.</italic> Kentron H (LT622015) 95.43%</td>
<td valign="top" align="left">
<italic>Ca.</italic> Kentron H (LT622015) 95.43%</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>Ca.</italic> Kentron YE OTU PacBio</td>
<td valign="top" align="center">53.89%</td>
<td valign="top" align="center">1510</td>
<td valign="top" align="center">56.62%</td>
<td valign="top" align="left">
<italic>Ca.</italic> Kentron H (LT622015) 95.26%</td>
<td valign="top" align="left">
<italic>Ca.</italic> Kentron H (LT622015) 95.26%</td>
</tr>
<tr>
<td valign="top" align="left">MLAKF</td>
<td valign="top" align="center">10.34%</td>
<td valign="top" align="center">1480</td>
<td valign="top" align="center">56.69%</td>
<td valign="top" align="left">Uncultured bacterium from environmental samples (EF406613) 98.58%</td>
<td valign="top" align="left">
<italic>Duncaniella</italic> sp. C9 (MK521457) 96.83%</td>
</tr>
<tr>
<td valign="top" align="left">OTU-<italic>Psychrobacter</italic>
</td>
<td valign="top" align="center">5.53%</td>
<td valign="top" align="center">1500</td>
<td valign="top" align="center">52.40%</td>
<td valign="top" align="left">Uncultured bacterium from environmental samples (KC502874) 99.87%</td>
<td valign="top" align="left">
<italic>Psychrobacter alimentarius</italic> (JX514419) 99.86%</td>
</tr>
<tr>
<td valign="top" align="left">OTU-<italic>Cutibacterium</italic>
</td>
<td valign="top" align="center">4.73%</td>
<td valign="top" align="center">1486</td>
<td valign="top" align="center">57.13%</td>
<td valign="top" align="left">Uncultured bacterium from environmental samples (MK372587) 99.93%</td>
<td valign="top" align="left">
<italic>Cutibacterium acnes</italic> (KF933802) 99.53%</td>
</tr>
<tr>
<td valign="top" align="left">OTU-<italic>Lactobacillus</italic>
</td>
<td valign="top" align="center">3.74%</td>
<td valign="top" align="center">1529</td>
<td valign="top" align="center">53.83%</td>
<td valign="top" align="left">Uncultured bacterium from environmental samples (FJ880299) 99.61%</td>
<td valign="top" align="left">
<italic>Limosilactobacillus reuteri</italic> (MN537548) 99.54%</td>
</tr>
<tr>
<td valign="top" align="left">OTU-<italic>Staphylococcus</italic>
</td>
<td valign="top" align="center">3.07%</td>
<td valign="top" align="center">1512</td>
<td valign="top" align="center">51.32%</td>
<td valign="top" align="left">
<italic>Staphylococcus hominis</italic> (MH665980) 99.73%</td>
<td valign="top" align="left">
<italic>Staphylococcus hominis</italic> (MH665980) 99.73%</td>
</tr>
<tr>
<td valign="top" align="left">OTU-<italic>Thalassolituus</italic>
</td>
<td valign="top" align="center">2.01%</td>
<td valign="top" align="center">1500</td>
<td valign="top" align="center">53.46%</td>
<td valign="top" align="left">Uncultured bacterium (FJ403082) 98.8%</td>
<td valign="top" align="left">
<italic>Thalassolituus oleivorans</italic> (KF170318) 97.78%</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>The 16S rRNA gene sequences of &#x201c;<italic>Ca.</italic> Kentron&#x201d; YE (derived from the Clone Library and the PacBio platform) and MLAKF were deposited in the GenBank database with accession numbers OM501125, OM501126, and OM468468. The read sequences derived from the PacBio sequencing were also deposited in GenBank, with the bioproject number PRJNA801354.</p>
</sec>
<sec id="s3_4">
<title>Phylogenetic Analyses of &#x201c;<italic>Ca.</italic> Kentron&#x201d; YE and the OTU MLAKF</title>
<p>Phylogenetic analyses based on the 16S rRNA genes were performed to assess the accurate affiliations of the OTU &#x201c;<italic>Ca.</italic> Kentron&#x201d; YE (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref>) and the OTU MLAKF (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>). In the phylogenetic trees, &#x201c;<italic>Ca.</italic> Kentron&#x201d; YE fell into the clade of the genus &#x201c;<italic>Ca.</italic> Kentron&#x201d;, belonging to the class <italic>Gammaproteobacteria</italic> (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref>). The BLAST search on the NCBI showed that this 16S rRNA gene fragment had the highest identity (95.43%) with that of &#x201c;<italic>Ca</italic>. Kentron&#x201d; H (accession number LT622015) (<xref ref-type="bibr" rid="B45">Seah et&#xa0;al., 2017</xref>). The OTU MLAKF fell into the family <italic>Muribaculaceae</italic> in phylum Bacteroidetes (100% ML/1.00 BI) (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>). Within <italic>Muribaculaceae</italic>, MLAKF appeared to be a distinct taxon, as a sister branch to a clade comprising <italic>Duncaniella</italic> species and several uncultured bacteria (98% ML/1.00 BI) (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>).</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Maximum likelihood (ML) tree based on the 16S rRNA genes showing the positions of &#x201c;<italic>Candidatus</italic> Kentron&#x201d; YE (in red) with a GTR + I + &#x413; model. The numbers on the nodes represent the bootstrap values of ML and the posterior probability of the Bayesian inference (BI). The black dot on the node represents the bootstrap value &gt; 95%. Genbank accession numbers are given following the species names. All branches are drawn to scale.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-879388-g005.tif"/>
</fig>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Maximum likelihood (ML) tree based on the 16S rRNA genes showing the positions of MLAKF (in red) with a GTR + I + &#x413; model. The numbers on the nodes represent the bootstrap values of the ML and the posterior probability of the Bayesian inference (BI). The black dot on the node represents the bootstrap value &gt; 95%. Genbank accession numbers are given following the species names. All branches are drawn to scale.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-879388-g006.tif"/>
</fig>
</sec>
<sec id="s3_5">
<title>Fluorescence <italic>In Situ</italic> Hybridization (FISH)</title>
<p>The newly designed probes C01-824 and C01-612 for OTU MLAKF have been shown <italic>in silico</italic> to be highly <italic>Muribaculaceae</italic> specific in the SILVA NR 99 database (accessed March 2022). C01-824 completely matched the family <italic>Muribaculaceae</italic> (126/126). C01-612 primarily matched the family <italic>Muribaculaceae</italic> (151/154), except for one sequence of the family <italic>Rikenellaceae</italic> (Bacteroidetes) and two sequences of <italic>Firmicutes</italic> (<italic>Bacteria</italic>). The third probe, C01-1125, was more MLAKF-specific but matched a smaller range of <italic>Muribaculaceae</italic> (62/72). It also matched 10 sequences of the family <italic>Prolixibacteraceae</italic> (Bacteroidetes) and one sequence of <italic>Thiomicrospiraceae</italic> (<italic>Gammaproteobacteria</italic>). All matched non-<italic>Muribaculaceae</italic> families above were not detected in our clone library (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>) and PacBio data (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>), implying their absence in the samples. Compared to the 16S rDNA of &#x201c;<italic>Ca</italic>. Kentron&#x201d; YE, the three probes C01-612, C01-824, and C01-1125 were mismatched by 6, 7, and 7 sites, respectively, excluding the possibility of nonspecific binding to &#x201c;<italic>Ca.</italic> Kentron&#x201d; YE.</p>
<p>The three probes were applied separately to a total of 10 cells of <italic>K. flavus</italic> (4 cells with C01-612, 3 with C01-824, and 3 with C01-1125). Strong positive signals were observed on all specimens, with rod-shaped structures distinguishable on several slides (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7C, G, K</bold>
</xref>; <xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8C, H, M</bold>
</xref>). The overlays of the DAPI and probe&#x2019;s signals showed that the MLAKF bacteria were primarily located on the surface of the ciliate cells (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7D, H, L</bold>
</xref>). To distinguish MLAKF and &#x201c;<italic>Ca.</italic> Kentron&#x201d; YE, double-label experiments were conducted on the same ciliate with specific probes labeled with different fluorophores (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8</bold>
</xref>). For two sets of probe combinations, namely C01-612 + chr4Ca and C01-824 + chr4Ca, the red fluorescence (Cy3) of MLAKF (<xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8C, H, M</bold>
</xref>), and the green ones (AF488) of &#x201c;<italic>Ca.</italic> Kentron&#x201d; YE (<xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8D, I, N</bold>
</xref>) were simultaneously observed, both appearing on the host&#x2019;s surface. Negative control was conducted by using the non-sense probe NON338 (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure S1</bold>
</xref>) in the FISH protocol, in which neither Cy3/AF488 fluorescence nor autofluorescence could be observed. Overlays of the signals on the same cell showed that the MLAKF and &#x201c;<italic>Ca.</italic> Kentron&#x201d; YE were mixed but were distinguishable from each other, with the former appearing more peripheral on the ciliate&#x2019;s cell surface (<xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8E, J, O</bold>
</xref>).</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Micrographs of <italic>K. flavus</italic> with MLAKF. <bold>(A, E, I)</bold> Microphotographs of the fixed cells in the bright field; <bold>(B, F, J)</bold> DAPI staining; <bold>(C, G, K</bold>), and fluorescence <italic>in situ</italic> hybridization (FISH) using Cy3-C01-612 <bold>(C)</bold>, Cy3-C01-824 <bold>(G)</bold>, and Cy3-C01-1125 probes <bold>(K)</bold>; <bold>(D, H, L)</bold> overlay of the DAPI and FISH. Scale bars = 50 &#x3bc;m <bold>(A&#x2013;L)</bold>. The result for C01-824 was derived from a double-label experiment with a probe solution of  3.5 &#x3bc;l of Cy3-C01-824 plus 0.5 &#x3bc;l of AF488-chrCa, while others were generated from a single-probe (4-&#x3bc;l probe solution) hybridization.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-879388-g007.tif"/>
</fig>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Double-label experiments on the same cell with both the Cy3-C01-612/824 and AF488-chr4Ca probes; <bold>(A, F, K)</bold> microphotographs of the fixed cells in the bright field; <bold>(B, G, L)</bold> DAPI staining; <bold>(C, H, M)</bold> species-specific probes Cy3-C01-824 <bold>(C, M)</bold> and Cy3-C01-612 <bold>(H)</bold>; <bold>(D, I, N)</bold> species-specific probe AF488-chr4Ca; and <bold>(E, J, O)</bold> overlays of Cy3 and AF488 images. Scale bars = 50 &#x3bc;m <bold>(A&#x2013;O)</bold>. For the cells in images <bold>A</bold> and <bold>F</bold>, the probe solutions of 3.5 &#x3bc;l of Cy3-C01-824/612 plus 0.5 &#x3bc;l of AF488-chrCa were applied, while for the one in <bold>K</bold>, 2 &#x3bc;l of Cy3-C01-824 plus 2 &#x3bc;l of AF488-chrCa were applied.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-879388-g008.tif"/>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<sec id="s4_1">
<title>Comparison of the <italic>K. flavus</italic> YE and &#x201c;<italic>Ca</italic>. Kentron&#x201d; YE with Similar Species</title>
<p>The newly obtained 18S rRNA gene sequence for <italic>Kentrophoros flavus</italic> YE was closely clustered with <italic>Kentrophoros gracilis</italic> and <italic>Kentrophoros flavus</italic> (97% ML and 1.00 BI in both, <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). In a comparison of the primary sequences, <italic>K. flavus</italic> YE differed from <italic>K. flavus</italic> and <italic>K. gracilis</italic> by 4 and 5 sites, respectively. <italic>In vivo</italic>, the Yantai populations matched the <italic>K. flavus</italic> population isolate in Qingdao (<xref ref-type="bibr" rid="B52">Xu et&#xa0;al., 2011</xref>) in terms of body shape and general appearance. In addition, the living cell characteristics of <italic>K. flavus</italic> YE were different from the original description of <italic>K. gracilis</italic> (<xref ref-type="bibr" rid="B52">Xu et&#xa0;al., 2011</xref>) in cell size (200&#x2013;460 &#xd7; 16&#x2013;36 &#x3bc;m vs. 250&#x2013;600 &#xd7; 30&#x2013;60 &#x3bc;m) and shape (<italic>K. gracilis</italic> was more elongated). The cells of <italic>K</italic>. <italic>flavus</italic> YE we observed were ciliated on the ventral side and contained ectosymbionts on the dorsal side (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1E</bold>
</xref>) corresponding to the &#x201c;open&#x201d; type among the four different body involution types recognized by <xref ref-type="bibr" rid="B45">Seah et&#xa0;al. (2017)</xref> for the genus <italic>Kentrophoros</italic>.</p>
<p>The OTU &#x201c;<italic>Ca.</italic> Kentron&#x201d; YE always displayed the highest proportion (41.3% in the clone library data and 53.89% in the PacBio data) among the <italic>K. flavus</italic>-associating bacteria (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3</bold>
</xref>, <xref ref-type="fig" rid="f4">
<bold>4</bold>
</xref>). This aligns with the previous study that used the meta-genomic technique to detect the genus &#x201c;<italic>Ca.</italic> Kentron&#x201d; in 13 <italic>Kentrophoros</italic> morphospecies (<xref ref-type="bibr" rid="B45">Seah et al., 2017</xref>). Compared with the most similar relative, &#x201c;<italic>Ca</italic>. Kentron&#x201d; H (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>), &#x201c;<italic>Ca</italic>. Kentron&#x201d; YE was different by 70 bases in the primary 16S rRNA sequence, indicating that &#x201c;<italic>Ca</italic>. Kentron&#x201d; YE may represent a new ectosymbiotic species of the genus &#x201c;<italic>Ca</italic>. Kentron&#x201d;.</p>
</sec>
<sec id="s4_2">
<title>Potential Roles of The Newly Detected MLAKF</title>
<p>As seen from the PacBio results (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>), the OTU MLAKF accounted for the second-largest number (10.34%, approximately 1125 reads) among the associated bacteria in two <italic>K. flavus</italic> individuals. On 10 host cells that were sampled on different dates, the FISH results with three specific probes all produced positive signals of MLAKF on the surface of <italic>K. flavus</italic> (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7C, G, K</bold>
</xref>; <xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8C, H, M</bold>
</xref>), suggesting that their presence on the ciliate was relatively stable.</p>
<p>The 16S rRNA gene sequence of MLAKF was 21 bases different from an uncultured bacterium with 98.58% identity (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>), and 47 bases were different from the most similar species <italic>Duncaniella</italic> sp. C9 with 96.83% identity (accession number: MK521457). Combined with its distinct position in the phylogenetic trees (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>), this suggests that MLAKF should represent a new bacterial species in the family <italic>Muribaculaceae</italic>. The family <italic>Muribaculaceae</italic> comprises mainly molecular taxa, which are known as prevalent and abundant bacterial components in the mammal gut microbiome (<xref ref-type="bibr" rid="B20">Lagkouvardos et&#xa0;al., 2019</xref>). Members of <italic>Muribaculaceae</italic> have been widely detected in the intestines of mice, humans, ruminants, and homeothermic animals (<xref ref-type="bibr" rid="B48">Van Valkenburgh, 1991</xref>; <xref ref-type="bibr" rid="B41">Salzman et&#xa0;al., 2002</xref>; <xref ref-type="bibr" rid="B21">Lagkouvardos et&#xa0;al., 2016</xref>; <xref ref-type="bibr" rid="B20">Lagkouvardos et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B27">Miyake et al., 2020</xref>), with only a few species abundant in the natural environment, including manure, wastewater treatment plants, and coral reefs (<xref ref-type="bibr" rid="B20">Lagkouvardos et&#xa0;al., 2019</xref>). Our study adds to this list but with another scenario. Muribaculacid bacteria are abundant on the surface of the ciliated protist <italic>K. flavus</italic> and merge with thiotrophic ectosymbionts. This is the first time a muribaculacid bacterium has been found to be consistently associated with unicellular eukaryotic organisms.</p>
<p>It is worth noting that MLAKF was consistently present in large numbers on the cell surface of the host (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>), emerging with or on an outlayer of the ectosymbiotic &#x201c;<italic>Ca</italic>. Kentron&#x201d; YE (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8</bold>
</xref>). The two symbionts and the ciliate host may have formed a three-partner consortium. First, MLAKF may offer extra organic carbon for the host-symbiont system. Genomic studies of &#x201c;<italic>Ca.</italic> Kentron&#x201d; have revealed that &#x201c;<italic>Ca.</italic> Kentron&#x201d; lacks genes encoding canonical enzymes for autotrophic CO<sub>2</sub> fixation, despite being a food source for <italic>Kentrophoros</italic> (<xref ref-type="bibr" rid="B44">Seah et&#xa0;al., 2019</xref>). It has been suggested that &#x201c;<italic>Ca.</italic> Kentron&#x201d; relies more on the uptake of exogenous organic substrates, heterotrophic carboxylation, and the recycling of host waste for growth (<xref ref-type="bibr" rid="B44">Seah et&#xa0;al., 2019</xref>). Extra energy and organic carbon sources should be required for the &#x201c;Kentron-<italic>Kentrophoros</italic>&#x201d; symbiote, and these should come from the environment or microbial activities (<xref ref-type="bibr" rid="B44">Seah et&#xa0;al., 2019</xref>). Coincidently, bacteria of <italic>Muribaculaceae</italic> have been predicted to play important roles in degrading dietary carbohydrates in the animal gut (<xref ref-type="bibr" rid="B20">Lagkouvardos et&#xa0;al., 2019</xref>). Genomic studies on a wide range of muribaculacid members have highlighted their prevalent versatility in degrading complex carbohydrates, benzoate resistance, and nitrogen utilization (&gt;90% prevalence) (<xref ref-type="bibr" rid="B31">Ormerod et&#xa0;al., 2016</xref>; <xref ref-type="bibr" rid="B20">Lagkouvardos et&#xa0;al., 2019</xref>). Therefore, it is possible that MLAKF on the ciliate cells may play similar roles, degrading a wide range of substrate in the sediment (this might also include host waste) for growth, whereby the bio-product may provide accessible organic carbon for &#x201c;<italic>Ca.</italic> Kentron&#x201d;. Simultaneously, MLAKF themselves may offer an extra food source for the ciliate to support the overall growth of the host-symbiont system.</p>
<p>Second, it is known that <italic>Kentrophoros</italic> likely shuttles between oxic and anoxic zones in marine sediment with the ectosymbionts (<xref ref-type="bibr" rid="B11">Fenchel and Finlay, 1989</xref>; <xref ref-type="bibr" rid="B44">Seah et&#xa0;al., 2019</xref>). Under anoxic conditions, thiotrophic bacteria would not completely oxidize sulfide to sulfate, leading to less efficient energy generation (<xref ref-type="bibr" rid="B44">Seah et&#xa0;al., 2019</xref>). MLAKF may contribute as a compensated food source under anoxic conditions. Members of <italic>Muribaculaceae</italic> have been revealed to be well equipped with anti-oxygen strategies to support potential microaerobic growth (<xref ref-type="bibr" rid="B31">Ormerod et&#xa0;al., 2016</xref>). Nevertheless, the nature of the relationship between the MLAKF bacterium, &#x201c;<italic>Ca</italic>. Kentron&#x201d; YE, and <italic>K. flavus</italic> remains to be resolved, and single-cell genome sequencing can be a powerful tool for revealing the interactions between ciliated protists and their bacterial symbionts (<xref ref-type="bibr" rid="B26">Martinez-Garcia et&#xa0;al., 2012</xref>).</p>
</sec>
<sec id="s4_3">
<title>Higher Bacterial Diversity Potentially Associated With <italic>K. flavus</italic>
</title>
<p>Aside from the thiotrophic bacteria &#x201c;<italic>Ca</italic>. Kentron&#x201d; YE, we detected a high diversity of associated bacteria using 16S rDNA-based approaches (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3</bold>
</xref> and <xref ref-type="fig" rid="f4">
<bold>4</bold>
</xref>; <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>). This result accords with a previous morphological study of the species <italic>K</italic>. <italic>latum</italic> that recorded ectosymbiotic spirochaetes and intracellular prokaryotic symbionts (<xref ref-type="bibr" rid="B38">Raikov, 1971</xref>). The existence of particles adhering to thiotrophic bacteria has also been observed (<xref ref-type="bibr" rid="B10">Fenchel, 1969</xref>; <xref ref-type="bibr" rid="B11">Fenchel and Finlay, 1989</xref>) (e.g., diatoms and other ingested particles within <italic>Kentrophoros</italic>), which may be another explanation for the high bacterial diversity being detected. Except for the overwhelming OTU &#x201c;<italic>Ca</italic>. Kentron&#x201d; YE, the revealed diversity of the associating bacteria in <italic>K. flavus</italic> was variable between the clone library and PacBio sequencing (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3</bold>
</xref>, <xref ref-type="fig" rid="f4">
<bold>4</bold>
</xref>). This might be attributable to the significant difference in sequencing depths between the two techniques (46 clones vs. 10,883 CCS).</p>
<p>In addition to the consistently associated MLAKF bacterium, the comprehensive sequencing by the PacBio platform also detected OTUs related to members in the genera <italic>Psychrobacter</italic>, <italic>Cutibacterium</italic>, <italic>Lactobacillus</italic>, <italic>Staphylococcus</italic>, and <italic>Thalassolituus</italic>, all with measurable abundance (2&#x2013;5.53%) (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>; <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>). Most of these 16S rDNA fragments are most similar to the known species in GenBank (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>), indicating that these might represent common taxa. Among these, members of <italic>Cutibacterium</italic> and <italic>Psychrobacter</italic> are obligate symbionts in human skin and the anogenital gland of captive pandas (<xref ref-type="bibr" rid="B43">Scholz and Kilian, 2016</xref>; <xref ref-type="bibr" rid="B54">Zhou et&#xa0;al., 2021</xref>), suggesting their symbiotic potential. However, the sequences might also derive from particles adhering to &#x201c;<italic>Ca</italic>. Kentron&#x201d;, as assumed by previous morphological studies (<xref ref-type="bibr" rid="B10">Fenchel, 1969</xref>). Because of the variable result among the different individuals and a lack of FISH analysis, we must refrain from predicting the stable existence or roles of these OTUs.</p>
</sec>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data Availability Statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: NCBI [accession: OM421748, OM501125, OM501126, OM468468, and PRJNA801354].</p>
</sec>
<sec id="s6" sec-type="author-contributions">
<title>Author Contributions</title>
<p>LB performed the microscopy observation, PCR experiment, data processing, and drafted the manuscript. LB, SZ, and XZ conducted the FISH and phylogenetic analysis. QZ and DJ designed the study and revised the manuscript. All authors contributed to the article and approved the submitted version.</p>
</sec>
<sec id="s7" sec-type="funding-information">
<title>Funding</title>
<p>This work was supported by the National Natural Science Foundation of China (project numbers: 31672251, 31772413, and 42176163), the Youth Innovation Promotion Association, CAS (No. 2019216), the Strategic Priority Research Program of the Chinese Academy of Sciences (No. XDA23050303), and the Key Research Program of Frontier Science, CAS (No. QYZDB-SSW-DQC013-1).</p>
</sec>
<sec id="s8" sec-type="COI-statement">
<title>Conflict of Interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s9" sec-type="disclaimer">
<title>Publisher&#x2019;s Note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
</body>
<back>
<sec id="s10" sec-type="supplementary-material">
<title>Supplementary Material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fmars.2022.879388/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fmars.2022.879388/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet_1.pdf" id="SM1" mimetype="application/pdf"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Beinart</surname> <given-names>R. A.</given-names>
</name>
<name>
<surname>Rotterov&#xe1;</surname> <given-names>J.</given-names>
</name>
<name>
<surname>&#x10c;epi&#x10d;ka</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Gast</surname> <given-names>R. J.</given-names>
</name>
<name>
<surname>Edgcomb</surname> <given-names>V. P.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>The Genome of an Endosymbiotic Methanogen is Very Similar to Those of its Free-Living Relatives</article-title>. <source>Environ. Microbiol.</source> <volume>20</volume> (<issue>7</issue>), <fpage>2538</fpage>&#x2013;<lpage>2551</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/1462-2920.14279</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Boscaro</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Husnik</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Vannini</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Keeling</surname> <given-names>P. J.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Symbionts of the Ciliate <italic>Euplotes</italic>: Diversity, Patterns and Potential as Models for Bacteria&#x2013;Eukaryote Endosymbioses</article-title>. <source>Proc. R. Soc. B: Biol. Sci.</source> <volume>286</volume> (<issue>1907</issue>), <fpage>20190693</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1098/rspb.2019.0693</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bright</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Espada-Hinojosa</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Lagkouvardos</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Volland</surname> <given-names>J. M.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>The Giant Ciliate <italic>Zoothamnium Niveum</italic> and its Thiotrophic Epibiont <italic>Candidatus</italic> Thiobios Zoothamnicoli: A Model System to Study Interspecies Cooperation</article-title>. <source>Front. Microbiol.</source> <volume>5</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmicb.2014.00145</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cai</surname> <given-names>L.-Z.</given-names>
</name>
<name>
<surname>Hwang</surname> <given-names>J.-S.</given-names>
</name>
<name>
<surname>Dahms</surname> <given-names>H.-U.</given-names>
</name>
<name>
<surname>Fu</surname> <given-names>S.-J.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>X.-W.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Does High Organic Matter Content Affect Polychaete Assemblages in a Shenzhen Bay Mudflat, China</article-title>? <source>J. Marine Sci. Technol.</source> <volume>21</volume> (<issue>7</issue>), <fpage>37</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.6119/jmst-013-1223-5</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Caporaso</surname> <given-names>J. G.</given-names>
</name>
<name>
<surname>Kuczynski</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Stombaugh</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Bittinger</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Bushman</surname> <given-names>F. D.</given-names>
</name>
<name>
<surname>Costello</surname> <given-names>E. K.</given-names>
</name>
<etal/>
</person-group>. (<year>2010</year>). <article-title>QIIME Allows Analysis of High-Throughput Community Sequencing Data</article-title>. <source>Nat. Methods</source> <volume>7</volume> (<issue>5</issue>), <fpage>335</fpage>&#x2013;<lpage>336</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nmeth.f.303</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Choi</surname> <given-names>K.-H.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>Y.-O.</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>J.-B.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>S.-Y.</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>M.-W.</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>P.-G.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>Thermal Impacts of a Coal Power Plant on the Plankton in an Open Coastal Water Environment</article-title>. <source>J. Marine Sci. Technol.</source> <volume>20</volume> (<issue>2</issue>), <elocation-id>9</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.51400/2709-6998.1837</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dubilier</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Bergin</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Lott</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Symbiotic Diversity in Marine Animals: The Art of Harnessing Chemosynthesis</article-title>. <source>Nat. Rev. Microbiol.</source> <volume>6</volume> (<issue>10</issue>), <fpage>725</fpage>&#x2013;<lpage>740</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nrmicro1992</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Edgcomb</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Leadbetter</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Bourland</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Beaudoin</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Bernhard</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Structured Multiple Endosymbiosis of Bacteria and Archaea in a Ciliate From Marine Sulfidic Sediments: A Survival Mechanism in Low Oxygen, Sulfidic Sediments</article-title>? <source>Front. Microbiol.</source> <volume>2</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmicb.2011.00055</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Embley</surname> <given-names>T. M.</given-names>
</name>
<name>
<surname>Finlay</surname> <given-names>B. J.</given-names>
</name>
<name>
<surname>Brown</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>1992</year>). <article-title>RNA Sequence Analysis Shows That the Symbionts in the Ciliate <italic>Metopus</italic> Contortus are Polymorphs of a Single Methanogen Species</article-title>. <source>FEMS Microbiol. Lett.</source> <volume>97</volume> (<issue>1-2</issue>), <fpage>57</fpage>&#x2013;<lpage>61</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1574-6968.1992.tb05439.x</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fenchel</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>1969</year>). <article-title>The Ecology of Marine Microbenthos IV. Structure and Function of the Benthic Ecosystem, its Chemical and Physical Factors and the Microfauna Commuities With Special Reference to the Ciliated Protozoa</article-title>. <source>Ophelia</source> <volume>6</volume> (<issue>1</issue>), <fpage>1</fpage>&#x2013;<lpage>182</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/00785326.1969.10409647</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fenchel</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Finlay</surname> <given-names>B. J.</given-names>
</name>
</person-group> (<year>1989</year>). <article-title>
<italic>Kentrophoros</italic>: A Mouthless Ciliate With a Symbiotic Kitchen Garden</article-title>. <source>Ophelia</source> <volume>30</volume> (<issue>2</issue>), <fpage>75</fpage>&#x2013;<lpage>93</lpage>.</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Foissner</surname> <given-names>W.</given-names>
</name>
</person-group> (<year>1995</year>). <article-title>
<italic>Kentrophoros</italic> (Ciliophora, Karyorelictea) has Oral Vestiges: A Reinvestigation of <italic>K. Fistulosus</italic> (Faur&#xc9;-Fremiet 1950) Using Protargol Impregnation</article-title>. <source>Archiv F&#xfc;r Protistenkunde</source> <volume>146</volume> (<issue>2</issue>), <fpage>165</fpage>&#x2013;<lpage>179</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0003-9365(11)80107-7</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zheng</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Ji</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Protist Interactions and Seasonal Dynamics in the Coast of Yantai, Northern Yellow Sea of China as Revealed by Metabarcoding</article-title>. <source>J. Ocean Univ. China</source> <volume>19</volume> (<issue>4</issue>), <fpage>961</fpage>&#x2013;<lpage>974</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11802-020-4461-x</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Galtier</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Gouy</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Gautier</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>1996</year>). <article-title>SEAVIEW and PHYLO_WIN: Two Graphic Tools for Sequence Alignment and Molecular Phylogeny</article-title>. <source>Bioinformatics</source> <volume>12</volume> (<issue>6</issue>), <fpage>543</fpage>&#x2013;<lpage>548</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/bioinformatics/12.6.543</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gao</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Str&#xfc;der-Kypke</surname> <given-names>M. C.</given-names>
</name>
<name>
<surname>Al-Rasheid</surname> <given-names>K. A. S.</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Song</surname> <given-names>W.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Molecular Phylogeny of Three Ambiguous Ciliate Genera: <italic>Kentrophoros</italic>, <italic>Trachelolophos</italic> and <italic>Trachelotractus</italic> (Alveolata, Ciliophora)</article-title>. <source>Zool Scripta</source> <volume>39</volume> (<issue>3</issue>), <fpage>305</fpage>&#x2013;<lpage>313</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1463-6409.2010.00416.x</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gong</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Qing</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Warren</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>
<italic>Candidatus</italic> Sonnebornia Yantaiensis a Member of Candidate Division OD1, as Intracellular Bacteria of the Ciliated Protist <italic>Paramecium Bursaria</italic> (Ciliophora, Oligohymenophorea)</article-title>. <source>Systematic Appl. Microbiol.</source> <volume>37</volume> (<issue>1</issue>), <fpage>35</fpage>&#x2013;<lpage>41</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.syapm.2013.08.007</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gong</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Qing</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Fu</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Su</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X.</given-names>
</name>
<etal/>
</person-group>. (<year>2016</year>). <article-title>Protist-Bacteria Associations: <italic>Gammaproteobacteria</italic> and <italic>Alphaproteobacteria</italic> Are Prevalent as Digestion-Resistant Bacteria in Ciliated Protozoa</article-title>. <source>Front. Microbiol.</source> <volume>7</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmicb.2016.00498</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Graf</surname> <given-names>J. S.</given-names>
</name>
<name>
<surname>Schorn</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Kitzinger</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Ahmerkamp</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Woehle</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Huettel</surname> <given-names>B.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Anaerobic Endosymbiont Generates Energy for Ciliate Host by Denitrification</article-title>. <source>Nature</source> <volume>591</volume> (<issue>7850</issue>), <fpage>445</fpage>&#x2013;<lpage>450</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41586-021-03297-6</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hall</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Biosciences</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Carlsbad</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>BioEdit: An Important Software for Molecular Biology</article-title>. <source>GERF Bull. Biosci.</source> <volume>2</volume> (<issue>1</issue>), <fpage>60</fpage>&#x2013;<lpage>61</lpage>.</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lagkouvardos</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Lesker</surname> <given-names>T. R.</given-names>
</name>
<name>
<surname>Hitch</surname> <given-names>T. C. A.</given-names>
</name>
<name>
<surname>G&#xe1;lvez</surname> <given-names>E. J. C.</given-names>
</name>
<name>
<surname>Smit</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Neuhaus</surname> <given-names>K.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Sequence and Cultivation Study of <italic>Muribaculaceae</italic> Reveals Novel Species, Host Preference, and Functional Potential of This Yet Undescribed Family</article-title>. <source>Microbiome</source> <volume>7</volume> (<issue>1</issue>), <fpage>28</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s40168-019-0637-2</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lagkouvardos</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Pukall</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Abt</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Foesel</surname> <given-names>B. U.</given-names>
</name>
<name>
<surname>Meier-Kolthoff</surname> <given-names>J. P.</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>N.</given-names>
</name>
<etal/>
</person-group>. (<year>2016</year>). <article-title>The Mouse Intestinal Bacterial Collection (miBC) Provides Host-Specific Insight Into Cultured Diversity and Functional Potential of the Gut Microbiota</article-title>. <source>Nat. Microbiol.</source> <volume>1</volume> (<issue>10</issue>), <fpage>16131</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nmicrobiol.2016.131</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lanzoni</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Plotnikov</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Khlopko</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Munz</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Petroni</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Potekhin</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>The Core Microbiome of Sessile Ciliate Stentor Coeruleus is Not Shaped by the Environment</article-title>. <source>Sci. Rep.</source> <volume>9</volume> (<issue>1</issue>), <fpage>11356</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41598-019-47701-8</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lei</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Research Progress in the Ecology of Benthic Ciliated Protozoa</article-title>. <source>Acta Hydrobiol Sin.</source> <volume>32</volume>, <fpage>155</fpage>&#x2013;<lpage>160</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3724/sp.j.0000.2008.70155</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lind</surname> <given-names>A. E.</given-names>
</name>
<name>
<surname>Lewis</surname> <given-names>W. H.</given-names>
</name>
<name>
<surname>Spang</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Guy</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Embley</surname> <given-names>T. M.</given-names>
</name>
<name>
<surname>Ettema</surname> <given-names>T. J. G.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Genomes of Two Archaeal Endosymbionts Show Convergent Adaptations to an Intracellular Lifestyle</article-title>. <source>ISME J.</source> <volume>12</volume> (<issue>11</issue>), <fpage>2655</fpage>&#x2013;<lpage>2667</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41396-018-0207-9</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Martin</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Cutadapt Removes Adapter Sequences From High-Throughput Sequencing Reads</article-title>. <source>EMBnet J.</source> <volume>17</volume> (<issue>1</issue>), <fpage>10</fpage>&#x2013;<lpage>12</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.14806/ej.17.1.200</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Martinez-Garcia</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Brazel</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Poulton</surname> <given-names>N. J.</given-names>
</name>
<name>
<surname>Swan</surname> <given-names>B. K.</given-names>
</name>
<name>
<surname>Gomez</surname> <given-names>M. L.</given-names>
</name>
<name>
<surname>Masland</surname> <given-names>D.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>Unveiling <italic>in Situ</italic> Interactions Between Marine Protists and Bacteria Through Single Cell Sequencing</article-title>. <source>ISME J.</source> <volume>6</volume> (<issue>3</issue>), <fpage>703</fpage>&#x2013;<lpage>707</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/ismej.2011.126</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Miyake</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Ding</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Soh</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Low</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Seedorf</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Cultivation and Description of <italic>Duncaniella Dubosii</italic> Sp. Nov., <italic>Duncaniella Freteri</italic> Sp. Nov. And Emended Description of the Species <italic>Duncaniella Muris</italic>
</article-title>. <source>Int. J. Syst. Evol. Microbiol.</source> <volume>70</volume> (<issue>5</issue>), <fpage>3105</fpage>&#x2013;<lpage>3110</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1099/ijsem.0.004137</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mu&#xf1;oz-G&#xf3;mez</surname> <given-names>S. A.</given-names>
</name>
<name>
<surname>Kreutz</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Hess</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>A Microbial Eukaryote With a Unique Combination of Purple Bacteria and Green Algae as Endosymbionts</article-title>. <source>Sci. Adv.</source> <volume>7</volume> (<issue>24</issue>), <elocation-id>eabg4102</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/sciadv.abg4102</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nowack</surname> <given-names>E. C.</given-names>
</name>
<name>
<surname>Melkonian</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Endosymbiotic Associations Within Protists. Philosophical Transactions of the Royal Society of London</article-title>. <source>Ser. B: Biol. Sci.</source> <volume>365</volume> (<issue>1541</issue>), <fpage>699</fpage>&#x2013;<lpage>712</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1098/rstb.2009.0188</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Omar</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Gong</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Morphology and Phylogeny of the Soil Ciliate <italic>Metopus</italic> Yantaiensis N. Sp. (Ciliophora, Metopida), With Identification of the Intracellular Bacteria</article-title>. <source>J. Eukaryotic Microbiol.</source> <volume>64</volume> (<issue>6</issue>), <fpage>792</fpage>&#x2013;<lpage>805</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/jeu.12411</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ormerod</surname> <given-names>K. L.</given-names>
</name>
<name>
<surname>Wood</surname> <given-names>D. L. A.</given-names>
</name>
<name>
<surname>Lachner</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Gellatly</surname> <given-names>S. L.</given-names>
</name>
<name>
<surname>Daly</surname> <given-names>J. N.</given-names>
</name>
<name>
<surname>Parsons</surname> <given-names>J. D.</given-names>
</name>
<etal/>
</person-group>. (<year>2016</year>). <article-title>Genomic Characterization of the Uncultured Bacteroidales Family S24-7 Inhabiting the Guts of Homeothermic Animals</article-title>. <source>Microbiome</source> <volume>4</volume> (<issue>1</issue>), <fpage>36</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s40168-016-0181-2</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Park</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>Z.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Do Ruminal Ciliates Select Their Preys and Prokaryotic Symbionts</article-title>? <source>Front. Microbiol.</source> <volume>9</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmicb.2018.01710</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Peng</surname> <given-names>Z. H.</given-names>
</name>
<name>
<surname>Jiao</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>G. H.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Research Methods of Microbial Biogeography</article-title>. <source>Bio-protocol</source>, <elocation-id>e2003930</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.21769/BioProtoc.2003930</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Plotnikov</surname> <given-names>A. O.</given-names>
</name>
<name>
<surname>Balkin</surname> <given-names>A. S.</given-names>
</name>
<name>
<surname>Gogoleva</surname> <given-names>N. E.</given-names>
</name>
<name>
<surname>Lanzoni</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Khlopko</surname> <given-names>Y. A.</given-names>
</name>
<name>
<surname>Cherkasov</surname> <given-names>S. V.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>High-Throughput Sequencing of the 16S rRNA Gene as a Survey to Analyze the Microbiomes of Free-Living Ciliates Paramecium</article-title>. <source>Microbial Ecol.</source> <volume>78</volume> (<issue>2</issue>), <fpage>286</fpage>&#x2013;<lpage>298</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00248-019-01321-x</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Posada</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Jmodeltest: Phylogenetic Model Averaging</article-title>. <source>Mol. Biol. Evol.</source> <volume>25</volume> (<issue>7</issue>), <fpage>1253</fpage>&#x2013;<lpage>1256</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/molbev/msn083</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pruesse</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Peplies</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Gl&#xf6;ckner</surname> <given-names>F. O.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>SINA: Accurate High-Throughput Multiple Sequence Alignment of Ribosomal RNA Genes</article-title>. <source>Bioinformatics</source> <volume>28</volume> (<issue>14</issue>), <fpage>1823</fpage>&#x2013;<lpage>1829</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/bioinformatics/bts252</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Quast</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Pruesse</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Yilmaz</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Gerken</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Schweer</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Yarza</surname> <given-names>P.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>The SILVA Ribosomal RNA Gene Database Project: Improved Data Processing and Web-Based Tools</article-title>. <source>Nucleic Acids Res.</source> <volume>41</volume> (<issue>1</issue>), <fpage>590</fpage>&#x2013;<lpage>596</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gks1219</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Raikov</surname> <given-names>I. B.</given-names>
</name>
</person-group> (<year>1971</year>). <article-title>Bact&#xe9;ries &#xc9;pizoiques Et Mode De Nutrition Du Cili&#xe9; Psammophile <italic>Kentrophoros Fistulosum</italic> Faur&#xe9;-Fremiet (&#xc9;tude Au Microscope &#xc9;lectronique)</article-title>. <source>Protistologica</source> <volume>7</volume> (<issue>3</issue>), <fpage>365</fpage>&#x2013;<lpage>378</lpage>.</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ronquist</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Huelsenbeck</surname> <given-names>J. P.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>MrBayes 3: Bayesian Phylogenetic Inference Under Mixed Models</article-title>. <source>Bioinformatics</source> <volume>19</volume> (<issue>12</issue>), <fpage>1572</fpage>&#x2013;<lpage>1574</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/bioinformatics/btg180</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Rosati</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>2002</year>). &#x201c;<article-title>Ectosymbiosis in Ciliated Protozoa</article-title>,&#x201d; in <source>Symbiosis: Mechanisms and Model Systems</source>. Ed. <person-group person-group-type="editor">
<name>
<surname>Seckbach</surname> <given-names>J.</given-names>
</name>
</person-group> (<publisher-loc>Dordrecht</publisher-loc>: <publisher-name>Springer Netherlands</publisher-name>), <fpage>475</fpage>&#x2013;<lpage>488</lpage>.</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Salzman</surname> <given-names>N. H.</given-names>
</name>
<name>
<surname>de Jong</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Paterson</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Harmsen</surname> <given-names>H. J. M.</given-names>
</name>
<name>
<surname>Welling</surname> <given-names>G. W.</given-names>
</name>
<name>
<surname>Bos</surname> <given-names>N. A.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Analysis of 16S Libraries of Mouse Gastrointestinal Microflora Reveals a Large New Group of Mouse Intestinal Bacteria</article-title>. <source>Microbiology</source> <volume>148</volume> (<issue>11</issue>), <fpage>3651</fpage>&#x2013;<lpage>3660</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1099/00221287-148-11-3651</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schloss</surname> <given-names>P. D.</given-names>
</name>
<name>
<surname>Westcott</surname> <given-names>S. L.</given-names>
</name>
<name>
<surname>Ryabin</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Hall</surname> <given-names>J. R.</given-names>
</name>
<name>
<surname>Hartmann</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Hollister</surname> <given-names>E. B.</given-names>
</name>
<etal/>
</person-group>. (<year>2009</year>). <article-title>Introducing Mothur: Open-Source, Platform-Independent, Community-Supported Software for Describing and Comparing Microbial Communities</article-title>. <source>Appl. Environ. Microbiol.</source> <volume>75</volume> (<issue>23</issue>), <fpage>7537</fpage>&#x2013;<lpage>7541</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/AEM.01541-09</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Scholz</surname> <given-names>C. F. P.</given-names>
</name>
<name>
<surname>Kilian</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>The Natural History of Cutaneous Propionibacteria, and Reclassification of Selected Species Within the Genus <italic>Propionibacterium</italic> to the Proposed Novel Genera <italic>Acidipropionibacterium</italic> Gen. Nov., <italic>Cutibacterium</italic> Gen. Nov. And <italic>Pseudopropionibacterium</italic> Gen. Nov</article-title>. <source>Int. J. Systematic Evol Microbiol.</source> <volume>66</volume> (<issue>11</issue>), <fpage>4422</fpage>&#x2013;<lpage>4432</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1099/ijsem.0.001367</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Seah</surname> <given-names>B. K. B.</given-names>
</name>
<name>
<surname>Antony</surname> <given-names>C. P.</given-names>
</name>
<name>
<surname>Huettel</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Zarzycki</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Schada von Borzyskowski</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Erb</surname> <given-names>T. J.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Sulfur-Oxidizing Symbionts Without Canonical Genes for Autotrophic CO<sub>2</sub> Fixation</article-title>. <source>mBio</source> <volume>10</volume> (<issue>3</issue>), <fpage>e01112</fpage>&#x2013;<lpage>e01119</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/mBio.01112-19</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Seah</surname> <given-names>B. K. B.</given-names>
</name>
<name>
<surname>Schwaha</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Volland</surname> <given-names>J.-M.</given-names>
</name>
<name>
<surname>Huettel</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Dubilier</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Gruber-Vodicka</surname> <given-names>H. R.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Specificity in Diversity: Single Origin of a Widespread Ciliate-Bacteria Symbiosis</article-title>. <source>Proc. R. Soc. B: Biol. Sci.</source> <volume>284</volume> (<issue>1858</issue>), <fpage>20170764</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1098/rspb.2017.0764</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stamatakis</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>RAxML Version 8: A Tool for Phylogenetic Analysis and Post-Analysis of Large Phylogenies</article-title>. <source>Bioinformatics</source> <volume>30</volume> (<issue>9</issue>), <fpage>1312</fpage>&#x2013;<lpage>1313</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/bioinformatics/btu033</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tamura</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Stecher</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Peterson</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Filipski</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0</article-title>. <source>Mol. Biol. Evol.</source> <volume>30</volume> (<issue>12</issue>), <fpage>2725</fpage>&#x2013;<lpage>2729</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/molbev/mst197</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Van Valkenburgh</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>1991</year>). <article-title>Iterative Evolution of Hypercarnivory in Canids (Mammalia: Carnivora): Evolutionary Interactions Among Sympatric Predators</article-title>. <source>Paleobiology</source> <volume>17</volume> (<issue>4</issue>), <fpage>340</fpage>&#x2013;<lpage>362</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1017/S0094837300010691</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Volland</surname> <given-names>J.-M.</given-names>
</name>
<name>
<surname>Schintlmeister</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Zambalos</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Reipert</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Mozeti&#x10d;</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Espada-Hinojosa</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>NanoSIMS and Tissue Autoradiography Reveal Symbiont Carbon Fixation and Organic Carbon Transfer To Giant Ciliate Host</article-title>. <source>ISME J.</source> <volume>12</volume>(<issue>3</issue>), <fpage>714</fpage>&#x2013;<lpage>727</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41396-018-0069-1</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Ji</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Yin</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Morphology and Phylogeny of Two <italic>Phialina</italic> Species (Ciliophora, Haptoria) From Northern China</article-title>. <source>Eur. J. Protistol</source> <volume>67</volume>, <fpage>46</fpage>&#x2013;<lpage>58</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ejop.2018.10.002</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wilbert</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Song</surname> <given-names>W.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>New Contributions to the Marine Benthic Ciliates From the Antarctic Area, Including Description of Seven New Species (Protozoa, Ciliophora)</article-title>. <source>J. Natural History</source> <volume>39</volume> (<issue>13</issue>), <fpage>935</fpage>&#x2013;<lpage>973</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/00222930400001509</pub-id>
</citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Warren</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Al-Rasheid</surname> <given-names>K. A. S.</given-names>
</name>
<name>
<surname>Al-Farraj</surname> <given-names>S. A.</given-names>
</name>
<name>
<surname>Song</surname> <given-names>W.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Morphological and Molecular Information of a New Species of <italic>Geleia</italic> (Ciliophora, Karyorelictea), With Redescriptions of Two <italic>Kentrophoros</italic> Species From China</article-title>. <source>Eur. J. Protistol</source> <volume>47</volume> (<issue>3</issue>), <fpage>172</fpage>&#x2013;<lpage>185</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ejop.2011.03.003</pub-id>
</citation>
</ref>
<ref id="B53">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Y&#x131;lmaz</surname> <given-names>L.&#x15e;.</given-names>
</name>
<name>
<surname>Noguera</surname> <given-names>D. R.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Development of Thermodynamic Models for Simulating Probe Dissociation Profiles in Fluorescence <italic>in Situ</italic> Hybridization</article-title>. <source>Biotechnol. Bioengineering</source> <volume>96</volume> (<issue>2</issue>), <fpage>349</fpage>&#x2013;<lpage>363</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/bit.21114</pub-id>
</citation>
</ref>
<ref id="B54">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Qi</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Swaisgood</surname> <given-names>R. R.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Jin</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>Q.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Symbiotic Bacteria Mediate Volatile Chemical Signal Synthesis in a Large Solitary Mammal Species</article-title>. <source>ISME J.</source> <volume>15</volume> (<issue>7</issue>), <fpage>2070</fpage>&#x2013;<lpage>2080</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41396-021-00905-1</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>