To mine the Ras gene from the M. rosenbergii genome, data from two transcriptomic libraries and the M. rosenbergii phased genome (Levy et al., 2019) – all of which were established in our laboratory – were used. One of the transcriptomic libraries includes various embryonic developmental stages (Abayed et al., 2019), and the other includes larvae, post larvae, and specific adult tissues (Sharabi et al., 2016). Homologs were mined from the two M. rosenbergii libraries by a tBLASTn search using the Ras amino acid sequence from Drosophila melanogaster (NP_476699.1; NCBI). mRNA sequences were aligned to the transcriptomic libraries, and putative protein sequences were compared using various NCBI BLAST algorithms (accessed during March and April 2021, https://blast.ncbi.nlm.nih.gov/Blast.cgi).

The genomic structure of MrRas was analyzed in silico by identifying introns and exons in the above transcriptomic and genomic libraries (Sharabi et al., 2016; Abayed et al., 2019). Phylogenetic analysis across a variety of species was performed using multiple alignments of Ras amino acid sequences from the following species: Mus musculus (NP_659124.2), Xenopus tropicalis (NP_001107338.1), Scylla paramamosain (ACY_66377.1), Gammarus pulex (EH_272032.1), 5 Dead Sea & Arava Science Center, Central Arava Branch, Israel. Homarus americanus (XP_042242987.1), Paralithodes camtschaticus (AAN_86143.1), M. rosenbergii (OP_654177), C. quadricarinatus (AEL_23042.1), Procambarus clarkii (AFV_09848.1), Daphnia magna (XP_032787339.1), Fenneropenaeus chinensis (AHA_93923.1), Marsupenaeus japonicus (AAK_14389.1), Penaeus monodon (QBA_57436.1), and Litopenaeus vannamei (XP_027229439.1). M. musculus and X. tropicalis were considered as out groups, while the remaining species were crustaceans. Sequences were obtained from the NCBI database, and the tree was generated using PhyML 3.0.

M. rosenbergii prawns were grown to maturity in artificial ponds at Ben-Gurion University of the Negev, Beersheba, Israel, as described previously (Levy et al., 2016). Thereafter, to ensure a constant supply of embryos for primary embryonic cell isolation, gravid females were obtained by housing four to six mature females with a blue claw male in 500-L tanks. The tanks were checked daily for the typical male reproductive guarding behavior to identify fertilized females, as previously described (Molcho et al., 2022).

Since the eggs are held on the abdomen of the female attached to the swimming legs, a disinfection procedure was carried out for surface sterilization of female prawns carrying developed eggs prior to cell isolation; the procedure involved submerging the animals in an aqueous solution of methylene blue (3 ppm) overnight as previously described (Molcho et al., 2022). Approximately 14 days following fertilization, embryos with visible eyes were removed with forceps, washed with a sterile saline solution (420 mOsmol) containing antibiotics and an antifungal reagent, namely, penicillin-streptomycin solution (1 mg/ml, Cat. No 03-031-1B, Biological Industries, Israel), tetracycline (25 µg/ml, Cat. No. T-9823, Merck, USA), and voriconazole (0.5 µg/ml, Cat. No. PZ0005, Merck, USA)—referred to here as saline PSTV. The separated eggs were further disinfected in saline PSTV with formalin (1% Cat. No. 252549, Sigma Aldrich, USA) for 1 min and an iodophor (1 ppm, Polydine, Dr. Fischer, Israel) for 3 min and then rinsed again in saline PSTV for 10 min. The eggs were homogenized in saline PSTV containing a protease and phosphatase inhibitor cocktail (Halt™ Protease Inhibitor, Cat. No. 87785, ThermoFischer Scientific, USA) under aseptic conditions. The homogenate, which consisted of dispersed cells, whole embryo tissue, and yolk protein, was passed through a 70-μm cell strainer to separate the egg envelopes and non-broken eggs from the dispersed cells. The filtrate was then pelleted by centrifugation at 850 g for 6 min at 18°C, suitable condition for isolation of prawn cells (Molcho et al., 2022). The residue remaining in the cell strainer was transferred to Eppendorf tubes, each containing 1 mg/ml collagenase type I and 1 mg/ml collagenase IV (Cat. No. C0130 and C5138 respectively, Sigma Aldrich, USA) and incubated for 30 min at room temperature. Afterwards it was centrifuged as above, and the pellet was washed with medium containing 10% fetal bovine serum (Cat. No. 04-127-1A, European grade, heat inactivated, South American origin FBS, Biological Industries, Israel) and combined with filtrated cell pellet. The total cell pellet was resuspended in 2 ml of saline PSVT, slowly poured into a percoll (Cat. No. 17-0891-01, GE Healthcare Bio-Sciences AB, Sweden) gradient adjusted with crustacean saline for osmolarity (100%-1.062 g/ml, 50%- 0.565 g/ml, 25%-0.282 g/ml and 12.5%-0.141 g/ml) and centrifuged again at 1000 g for 15 min at 18°C with reduced deceleration. The percoll gradient was used to separate the different embryonic cell types from the bulky yolk proteins (early embryonic nutrition). The yolk proteins appeared at 12.5% percoll while the cells migrated downwards the gradient and spread between 12.5% to 50% percoll (see Figure S1). All cell types were pooled and used for culture, transferred to a new 15 ml tube, centrifuged, and washed from percoll with upto 10 ml of saline PSVT. The cells obtained were reconstituted in 1 ml Optimem media with PSVT (Cat. No. 31985-047, Gibco, USA) The cells were visualized by trypan blue exclusion (Cat. No. 03-102-1B, Biological Industries, Israel) and counted with a hemocytometer. Cells were seeded at a concentration of 300,000 per well in a 96-well plate (Cat. No. 30096, SPL Life Sciences, South Korea) and cultured in DMEM: F12 (Cat. No. 01-170-1A, Biological Industries, Israel) supplemented with 10% FBS and PSVT (referred to below as the ‘growth medium’); the osmolarity of all commercial media used were adjusted to 420 mOsm with crustacean physiological saline (Frerichs, 1996). Culture plates were incubated at 28 °C with 5% CO_2.

The full open reading frame (ORF) sequence of MrRas was amplified from cDNA previously prepared in our laboratory. For the insertion of the point mutation in the MrRas gene, guanine was replaced by thymine in the primer design in order to induce the desired change in the amino acid sequence at the 12th position from glycine to valine. We used the following forward primer F: ATGACGGAGTACAAGCTGGTGGTGGTGGGAGCGGTAGGCGT (where T indicates the replacement of guanine with thymine to induce a point mutation in the resulting PCR product). The reverse primer was designed to amplify the full MrRas ORF, including the stop codon, R: CTACAATATAATACACGGTCTTTTGGAC. The PCR product (561 bp) was ligated into the pGEM^®-T Easy Vector Systems (Cat. No. A1360, Promega, USA) according to the manufacturer’s instructions. After cloning, mutated MrRas was sequenced using a MrRas reverse primer to validate the mutation. Mutated MrRas was cut from the pGEM^®-T Easy vector and ligated into pHAGE2 (Mostoslavsky et al., 2005) to replace DsRed. The result was a novel plasmid consisting of the mutated MrRas mRNA sequence and the ZsGreen sequence under the WSSV IE1 promoter (Li et al., 2009); hereafter referred to as the ‘mutated MrRas plasmid’. This generated lentiviral plasmid, encoding the Zs Green protein under WSSV IE1 promoter, enabled delivery of the mutated MrRas gene into the genome of the cultured M. rosenbergii cells. A control pHAGE2 lentiviral plasmid encoding for ZsGreen and DsRed under the WSSV promoter was also generated, as described before (Rotem-Dai et al., 2021).

Lentiviruses were produced in HEK293T cells cultured in DMEM (Cat. No. 01-055-1A, Biological Industries, Israel) supplemented with 10% FBS Biological Industries (Cat. No. 04-127-1A, European grade, heat inactivated, South American origin FBS, Biological Industries, Israel). Cells were grown to 90% confluence in 10-cm plates and then transfected with 10 µg of pHAGE2 vector and 3 µg of the packaging plasmids tat, rev, hgpm2 and vsvg, in a mass ratio of 1:1:1:2. The transfection was performed using jetPRIME^® transfection reagent (Cat. No. 101000046, Polyplus, France) according to the manufacturer’s instructions. DMEM supplemented with 10% FBS was added for the following two days of culture, and on the third day, the culture medium containing the secreted lentiviruses was collected, filtered through a 0.45-µm filter, and either stored at −80 °C or concentrated by ultracentrifugation at 17,000 RPM for 90 min at 4 °C. Lentivirus pellets were suspended in DMEM supplemented with 10% FBS, aliquoted, and stored at −80 °C.

Embryonic cells seeded at a concentration of 300,000 cells per well in a 96-well plate were transduced with either 20 µl of mutated lenti-MrRas or lenti WSSV IE1 as the positive control (PC). Non-transduced negative control cells were grown in the same volume of growth medium. Forty-eight hours following transduction, 0.1 ml of growth medium was added. Seventy-two hours following transduction, a Beckman Coulter^® Gallios™ flow cytometer (CytoFLEX S, USA) was used to measure the transduction rate of the lentivirus according to the expression of the reporter genes (DsRed or ZsGreen), followed by confocal microscopy (OLYMPUS FV10-268-098, Japan) analysis to detect the expression of fluorescent proteins. The presence of lentiviral sequences was also confirmed using PCR analysis.

To confirm the transduction of mutated lenti-MrRas into the genome of treated embryonic cells, genomic DNA (gDNA) was isolated by pelleting the cells in 20 µl 0.2 N NaOH and heating for 70°C for 20 min in a Thermocycler Life Eco (Falc) (Molcho et al., 2022), and RNA was extracted using EZ_RNA kit (Cat. No. 20-410-100, Biological Industries, Israel). RNA was converted into cDNA by following the protocol of the qScript cDNA synthesis kit (Cat. No. 95047-100, Quantabio, USA). PCR was performed using MrRas primers (MrRas F: ATGACGGAGTATAAGCTGGTG, and MrRas R: CTACAATATAATACACGGTCTTTTGGAC, with a melting temperature of 57°C) using gDNA or cDNA as templates. PCR products from cDNA samples taken from control and mutated lenti-MrRas transduced cells were further validated by Sanger sequencing (Ilse Katz Institute for Nanoscale Science and Technology, Ben-Gurion University).

Successful integration of mutated lenti-MrRas into the cell genome was validated by confocal microscopy showing the accumulation of ZsGreen reporter proteins localized inside the cytoplasm. Three days following transduction of M. rosenbergii primary embryonic cell cultures by the lentivirus, cells were transferred onto Fisherbrand™ SuperFrost Plus slides (Cat. No. J1800AMNZ, Fisher scientific, USA), fixed with 4% para-formaldehyde (Cat. No. 15710, ThermoFischer Scientific, USA) and stained with 4′,6-diamidino-2-phenylindole (DAPI) as a nucleic acid stain (Cat. No. 0100-20, DAPI Fluoromount-G^® mounting medium, Southern Biotech). The slides were observed under an Olympus FV1000 laser confocal scanning biological microscope (OLYMPUS FV10-268-098, Japan) for fluorescent signals (DsRed and ZsGreen), and the signals were compared to those of DAPI-stained non-transfected control cells. Uninfected control cells were used as a reference for auto fluorescent cell signaling.

For FACS analysis, cells were collected into tubes four days following transduction of M. rosenbergii embryonic primary cell cultures by lentiviruses, centrifuged at 850 g for 6 min and washed twice with saline. The cells were analyzed using a Beckman Coulter Gallios flow cytometer (CytoFLEX S, USA). The flow cytometry results were displayed using CyteExpert (CytExpert v2.5). Initially, the forward vs. side scatter gating of the cells was performed to separate the dead cells and debris from live cells by gating (Figure 6A). The ZsGreen protein was analyzed using two dimensional gates with forward scatter against FITC channel. This protocol enables the evaluation of the rate of transduction of mutated lenti-MrRas into the genome of embryonic cells.

Chi-square contingency analysis performed on proliferation rate data. Analysis performed using R software. p<0.01 considered statistically different.

Using the Ras oncogene sequence from D. melanogaster, we identified a contig showing 84% similarity. Aligning the two translated and aligned sequences showed a high similarity between the D. melanogaster and the identified M. rosenbergii sequence was updated in the NCBI database (Accession No. OP_654177, Figure 1A). The expression pattern of MrRas in the embryo development library showed very high expression from day 1 to 17 of embryonic development (Figure 1B).

According to the M. rosenbergii genome (Levy et al., 2019), the MrRas gene spans 15,308 bp and includes 5 introns and 6 exons (Supplementary Figure 2). The longest MrRas intron spans 8,032 bp, and the shortest, 196 bp. The longest and shortest exons span 180 bp and 51 bp, respectively. The main ORF spans 736 bp with the start codon, ATG, in the first exon at its 150^th bp and the stop codon, TAG, in the last exon at its 15,278^th bp (Supplementary Figure 2).

A phylogenetic tree based on the Ras amino acid sequences of 14 species (including 12 crustacean species) shows that MrRas bears the closest similarity to Paralithodes camtschaticus (the red king crab) (Figure 2). The phylogenetic analysis shows that Ras is highly conserved among vertebrates and crustaceans, and based on the outgroups, we can predict that Ras from different phyla has a common evolutionary origin (Figure 2).

The constructed plasmid suitable for the M. rosenbergii cellular system the EF1α promoter of Homo sapiens was replaced by the WSSV IE1 promoter thereby producing a plasmid of 8259 bp (Figure 3A), which served as a positive control. For the mutated Ras gene, DsRed from the control plasmid was replaced by the sequence of mutated MrRas (561 bp), producing a plasmid of 8146 bp (Figure 3B). The plasmids were each packaged into a lentivirus for transduction into the host genome of the M. rosenbergii embryonic primary cell culture.

To confirm transduction of the mutated lenti-MrRas into the genome of the transduced embryonic cells, RNA was extracted from both the control and treated cells 72 h after transduction. PCR amplifications were conducted with cDNA obtained from 1 μg RNA from each sample; the expression of the native MrRas, marked as control, and the mutated lenti-MrRas are shown in Figure 4A. Cells transduced with the mutated lenti-MrRas showed a prominent band in the gel compared to the untreated control, while the expression of MrActin (positive control) was similar in both control and treated cells. The control and mutated lenti MrRas were sequenced from the PCR product corresponding to the presented gel. were further confirmed by sequencing of the PCR products; the analysis, conducted in three repetitions, is presented in Figure 4B. In the PCR of the embryonic cells expressing mutated MrRas, the sequence shows T (thymine) instead of G (guanine, as is present in the untreated control cells expressing native MrRas). The putative deduced amino acid of each of three nucleotide codons is presented below the nucleotide alignments besides the mutated codon (Figure 4B).

Full integration and constant expression of the mutated lenti-MrRas occurred three days post transduction as shown by (Rotem-Dai et al., 2021). In the present study, the expression of the reporter genes was validated using confocal microscopy. In the untreated control cells (Figures 5A-C) only staining with the DAPI nuclear counter stain could be observed (Figure 5A). The primary cell cultures transduced with the positive control, lenti WSSV IE1, expressed both reporter genes, DsRed and ZsGreen, as may be seen by the presence of both colors in the vicinity of the nuclei and cytoplasm (Figures 5D-F). The mutated lenti-MrRas transduced cells expressed only the ZsGreen fluorescent protein, as expected, since the mutated MrRas gene replaced the DsRed in the plasmid (Figure 5G–I). The presence of the reporter gene proteins in the cells three days post transduction indicated that successful transduction has occurred. Expression of mutated lenti-MrRas suggests successful integration and expression of mutated MrRas into the embryonic cell genome (Uchida et al., 2016).

Transfection efficiency was evaluated by flow cytometry (Figure 6) Forward vs. side scatter of the cells was performed to separate the dead cells and debris from live cells by gating (Figure 6A). The untreated cells demonstrated a 9.1% signal-positive population considered as auto-fluorescence and was thus taken as a background value (Figure 6B). According to the analysis of the reporter gene ZsGreen, the control plasmid WSSV IE 1 lentivirus showed 52% transduction (Figure 6C), as can be seen in the elevated FITC-axis in the two-dimensional FACS analysis. This finding indicates high transduction efficiency of the lentiviral vector, resulting in lentiviral reporter protein expression in M. rosenbergii embryonic primary cells. In cells transduced with mutated lenti-MrRas, the transduction rate (32%) was higher than that of the background value but lower than that of the positive control (Figure 6D). A specific subpopulation comprising 2.17% of the total events was equally transduced by both lentiviruses (Figure 7A, right-hand corner) and showed higher positive signals for FITC, whereas the untreated control cells were 14% positive for FITC (Figure 7B). The subpopulation cells treated with the positive control plasmid WSSV IE1 were 98% positive for FITC (Figure 7C), and those treated with mutated lenti-MrRas were 94% positive for FITC (Figure 7D). When the results for the control and mutated lenti-MrRas were overlaid to show the frameshift, it was evident that mutated lenti-MrRas showed a higher level of positive FITC signals compared to the control, which was due to autofluorescence. Figure 7E shows the frameshift towards the right in cells transduced with mutated lenti-MrRas, implying success in transduction.

Cell transduced with mutated lenti-MrRas embryonic cells, and their respective controls were cultured for prolonged periods, i.e., up to 18 days. The culture represents the entire cellular population within the embryo. In the present culture conditions, only a few types of cells proliferate while others become quiescent. Higher proliferation rate is attributed to specific cell types within the culture and not the entire culture. This might reflect the time needed for the culture to fill the plates. Following seeding, the cells proliferated and filled the 96-well plates after 9 days in culture; thereafter, they were passaged into new plates and allowed to grow for another 9 days, at which stage they were designated either ‘control passage’ or ‘Ras passage’. The morphology of seeded embryonic primary cell cultures on the day of seeding is presented in Figure 8A (left); the morphologies and cell densities of the control culture and the mutated-lenti-MrRas-treated culture at the end of the experiment on day 18 are shown in the middle and right panels, respectively, of Figure 8A. The insertion of mutated lenti-MrRas into the genome of the cultured cells was detected only in the genomic DNA samples of the transduced cells, while the housekeeping gene MrActin was detected in both transduced and non-transduced control samples, confirming its presence in the cells also after a passage (Figure 8B). The control cultures reached 700% of their seeding density by the end of the experiment (Figure 8C). The novel mutated lenti-MrRas plasmid enhanced the natural proliferation index of the embryonic primary cell cultures in comparison to the control cultures (Chi-square test for association value 38,591.193, df=1, p<0.001): The transfected cells reached almost 1200% of their seeding density by the end of experiment 1, i.e., approximately double that of the control (Figure 8C). A replicate experiment showed the same trend, with increment in the density of the treated cultured was approximately 1.7-fold higher than that of the control (Figure 8C, Chi-square test for association value 30,456.877, df=1, p<0.001). Importantly, we did succeed in enhancing the proliferation potential of the embryonic primary cell cultures by shortening the doubling time of the culture by 22.5% in both experiments (detailed calculation is presented in the supplemental materials). However, none of our cultures reached a steady immortalized state.