<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Mar. Sci.</journal-id>
<journal-title>Frontiers in Marine Science</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Mar. Sci.</abbrev-journal-title>
<issn pub-type="epub">2296-7745</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fmars.2022.1080516</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Marine Science</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Cadmium-induced toxicity in <italic>Meretrix meretrix</italic> ovary is characterized by oxidative damage with changes in cell morphology and apoptosis-related factors</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Bai</surname>
<given-names>Binbin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2068846"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Yang</surname>
<given-names>Yuqing</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wei</surname>
<given-names>Jinyan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zheng</surname>
<given-names>Qi</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Mengci</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Chang</surname>
<given-names>Alan Kueichieh</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Ying</surname>
<given-names>Xueping</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/813040"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>College of Life and Environmental Sciences, Wenzhou University</institution>, <addr-line>Wenzhou, Zhejiang</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>National and Local Joint Engineering Research Center of Ecological Treatment Technology for Urban Water Pollution, Wenzhou University</institution>, <addr-line>Wenzhou, Zhejiang</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Li Zhang, South China Sea Institute of Oceanology, Chinese Academy of Sciences (CAS), China</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Jinling Cao, Shanxi Agricultural University, China; Xinguo Zhao, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences (CAFS), China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Alan Kueichieh Chang, <email xlink:href="mailto:akcchang@163.com">akcchang@163.com</email>; Xueping Ying, <email xlink:href="mailto:xpying2008@wzu.edu.cn">xpying2008@wzu.edu.cn</email>
</p>
</fn>
<fn fn-type="equal" id="fn003">
<p>&#x2020;These authors have contributed equally to this work</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Marine Pollution, a section of the journal Frontiers in Marine Science</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>01</day>
<month>12</month>
<year>2022</year>
</pub-date>
<pub-date pub-type="collection">
<year>2022</year>
</pub-date>
<volume>9</volume>
<elocation-id>1080516</elocation-id>
<history>
<date date-type="received">
<day>26</day>
<month>10</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>16</day>
<month>11</month>
<year>2022</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2022 Bai, Yang, Wei, Zheng, Wang, Chang and Ying</copyright-statement>
<copyright-year>2022</copyright-year>
<copyright-holder>Bai, Yang, Wei, Zheng, Wang, Chang and Ying</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>Cadmium (Cd) is one of the most common pollutants in the environment. It can cause irreversible tissue damage and apoptosis in invertebrates. This study investigated the relationship between Cd exposure and oxidative damage and apoptosis in the ovarian cell of the clam <italic>Meretrix meretrix</italic>. The clams were exposed to different concentrations of Cd<sup>2+</sup> (0, 1.5, 3, 6 and 12 mg L<sup>&#x2212;1</sup>) for 5 days, and the accumulated level of Cd<sup>2+</sup> in the ovarian tissue, and the degree of oxidative damage, changes in morphology and the response of apoptosis-related factors in the ovarian cell were determined. The bioaccumulation of Cd<sup>2+</sup> and the levels of reactive oxygen species (ROS), malondialdehyde (MDA), protein carbonylation (PCO), and DNA-protein crosslinking (DPC) in the ovary were found to increase significantly when the clams were exposed to increasing concentrations of Cd<sup>2+</sup>. The structure of the ovarian tissue was severely damaged, and the ovarian cells displayed an irregular arrangement. The results of AO/EB staining and flow cytometry showed that the apoptotic rate of the ovarian cells increased with increasing Cd<sup>2+</sup> concentrations. The activities of caspase-3, -8, -9, and the mRNA levels of <italic>p53</italic>, <italic>Bax</italic> and <italic>Caspase-3</italic> in the ovary were also significantly increased. Furthermore, the level of <italic>p53</italic> mRNA was positively correlated with the levels of MDA, PCO, DPC and ROS, but negatively correlated with the levels of total antioxidant capacity (T-AOC) and <italic>Bcl-2</italic> mRNA. Taken together, these results indicated that Cd<sup>2+</sup> exposure would result in oxidative damage and apoptosis for the ovarian cells, suggesting that Cd<sup>2+</sup> toxicity could negatively affect the reproductive capacity of <italic>M. meretrix</italic>, thus threatening the reproductive development of the shellfish.</p>
</abstract>
<kwd-group>
<kwd>
<italic>Meretrix meretrix</italic>
</kwd>
<kwd>cadmium</kwd>
<kwd>ovary</kwd>
<kwd>oxidative damage</kwd>
<kwd>apoptosis-related factors</kwd>
</kwd-group>
<counts>
<fig-count count="7"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="55"/>
<page-count count="14"/>
<word-count count="7883"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>With the rapid development of industry and agriculture, the environment of coastal water has been seriously polluted. In particular, heavy metal pollution has seriously affected the growth and development of marine organisms, with the potential of causing death to the organisms. Previous research has shown that heavy metals are highly toxic to aquatic animals, with Cd, Zn, Pb and Cu toxicity being a major cause of death (<xref ref-type="bibr" rid="B17">Garriz et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B10">Chen et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B54">Zhan et&#xa0;al., 2021</xref>). Cadmium (Cd) that enters the tissue of aquatic animals, such as <italic>Penaeus vannamei</italic> (<xref ref-type="bibr" rid="B30">Nunez-Nogueira et&#xa0;al., 2012</xref>), <italic>Danio rerio</italic> (<xref ref-type="bibr" rid="B47">Wu et&#xa0;al., 2012</xref>), <italic>Eriocheir sinensis</italic> (<xref ref-type="bibr" rid="B26">Lin et&#xa0;al., 2017</xref>) and <italic>Crassostrea gigas</italic> (<xref ref-type="bibr" rid="B5">Cao et&#xa0;al., 2018</xref>), can cause a series of toxicological reactions that lead to irreversible biological damage. It also acts as a peroxidation inducer that promotes the production of a high level of reactive oxygen species (ROS) (<xref ref-type="bibr" rid="B42">Wang et&#xa0;al., 2021</xref>). When the amount of ROS exceeds the capacity of the organism to clear it, it will result in membrane lipid peroxidation, protein carbonylation (PCO), and DNA-protein crosslinking (DPC) (<xref ref-type="bibr" rid="B22">Jena, 2012</xref>; <xref ref-type="bibr" rid="B14">Fedorova et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B53">Zhang et&#xa0;al., 2016</xref>). Malondialdehyde (MDA), a lipid peroxide, can be used as a marker to assess the degree of lipid peroxidation in the body (<xref ref-type="bibr" rid="B40">Tirani and Haghjou, 2019</xref>). PCO can lead to protein degradation and the carbonylation of a specific protein will affect the downstream cellular events mediated by that protein, whereas DPC can interrupt nearly all DNA metabolic processes. Thus, increases in MDA, PCO and DPC levels will lead to oxidative damage and apoptosis (<xref ref-type="bibr" rid="B49">Xie et&#xa0;al., 2007</xref>; <xref ref-type="bibr" rid="B36">Sevcikova et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B3">Boudet et&#xa0;al., 2015</xref>).</p>
<p>In the process of evolution, organisms have evolved effective antioxidant systems, which can scavenge ROS and its metabolites. The role of total antioxidant capacity (T-AOC) in the defense system is to maintain the dynamic balance of ROS in the internal environment by removing excess ROS to keep the organism in a relatively stable redox state. Therefore, T-AOC is an index that comprehensively reflects the ability of tissues to resist the damage inflicted by ROS (<xref ref-type="bibr" rid="B35">Sarban et&#xa0;al., 2005</xref>; <xref ref-type="bibr" rid="B7">Cekic et&#xa0;al., 2013</xref>). Metallothionein (MT) is a low molecular weight metal-binding protein rich in cysteine. MT can bind with heavy metals, effectively scavenging the heavy metals to adjust the concentration of heavy metal ions in the cells, reduce the toxic effects of heavy metals on the body and protect organelles from heavy metal-inflicted damage. Thus, MT has a strong ability to detoxify heavy metals by acting as an antioxidant (<xref ref-type="bibr" rid="B45">Wu et&#xa0;al., 2006</xref>; <xref ref-type="bibr" rid="B18">Gu et&#xa0;al., 2019</xref>). MT synthesis is induced by metal contaminants (e.g., Ag, Cd, Cu, and Hg) in many species (e.g., annelids, molluscs, crustaceans, and fish), suggesting the potential use of MT concentration as an indicator of metal exposure in organisms (<xref ref-type="bibr" rid="B2">Amiard et&#xa0;al., 2006</xref>). In addition, MT has been shown to play an important role in the apoptosis pathway, where it can inhibit apoptosis by inhibiting the release of mitochondrial cytochrome c and the activation of caspase-3 (<xref ref-type="bibr" rid="B43">Wang et&#xa0;al., 2001</xref>).</p>
<p>P53 and caspase (Cysteine-requiring Aspartate Protease) are two important factors in cell apoptosis (<xref ref-type="bibr" rid="B43">Wang et&#xa0;al., 2001</xref>; <xref ref-type="bibr" rid="B44">Wang et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B31">Ostrakhovitch et&#xa0;al., 2016</xref>). p53 is one of the most common pro-apoptotic proteins. It can arrest cell proliferation at the G1 phase and is a key factor for cell apoptosis and cell arrest (<xref ref-type="bibr" rid="B4">Brady and Attardi, 2010</xref>; <xref ref-type="bibr" rid="B31">Ostrakhovitch et&#xa0;al., 2016</xref>). P53 induces apoptosis through the expression of pro-apoptotic proteins (e.g., Bax) and inhibits the expression of anti-apoptotic proteins (e.g., Bcl-2) (<xref ref-type="bibr" rid="B4">Brady and Attardi, 2010</xref>). Caspase is a member of the protease family that plays a key role in apoptosis. Caspase-3 is an executioner caspase that triggers apoptosis through down-regulating or even inactivating enzymes involved in DNA repairs (<xref ref-type="bibr" rid="B43">Wang et&#xa0;al., 2001</xref>; <xref ref-type="bibr" rid="B44">Wang et&#xa0;al., 2011</xref>). Caspase-8 and caspase-9 are initiator caspases, and both can activate caspase-3. Caspase-8 activates caspase-3 <italic>via</italic> the extrinsic pathway while caspase-9 does it through the intrinsic pathway (<xref ref-type="bibr" rid="B24">Kumar, 2007</xref>; <xref ref-type="bibr" rid="B23">Kim et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B41">Tummers and Green, 2017</xref>). Despite the overwhelming amount of research on apoptosis, the roles of these apoptotic factors in the apoptotic pathway of bivalves induced by cadmium are not clear.</p>
<p>Bivalves are one of the important groups of marine animals in the aquatic ecosystem, and <italic>M. meretrix</italic> (Bivalvia, Veneridae) is one of the economically important bivalves in China. Its benthic lifestyle makes it susceptible to the accumulation of toxic metals in the aquatic environment, and therefore, it is considered an indicator of toxic metal pollution in the aquatic environment (<xref ref-type="bibr" rid="B1">Alyahya et&#xa0;al., 2011</xref>). Cadmium is one of the important heavy metals found as a pollutant in the sea. Cadmium can affect the formation and development of aquatic animal germ cells, causing oxidative damage and apoptosis in ovarian cells (<xref ref-type="bibr" rid="B9">Chen et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B12">Das et&#xa0;al., 2013</xref>; <xref ref-type="bibr" rid="B34">Revathi et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B50">Xu et&#xa0;al., 2016</xref>). Bivalves release mature germ cells into the aquatic environment for fertilization, and this can make the released germ cells more sensitive to the heavy metals in the water. Therefore, it is very important to study and evaluate the extent of damage inflicted by Cd toxicity in the reproductive tissue of the bivalves exposed to this metal. Cadmium may reduce the fecundity of aquatic organisms, thus adversely affecting the structure of the aquatic ecosystem and the integrity of shellfish farming. Although the concentration of cadmium in the aquatic environment is not high, the exposure time to cadmium is very long, and such long exposure could lead to increased accumulation of cadmium in the aquatic organisms with time (<xref ref-type="bibr" rid="B10">Chen et&#xa0;al., 2020</xref>). Exploring the relationship between Cd and apoptosis of shellfish not only can enrich the research of environmental toxicology but can also enable us to better understand the mechanism of cellular toxicology in shellfish. At the same time, it also has significance in the sustainable development of aquaculture and the protection of economically viable marine animal resources. In this study, the toxicity of Cd in <italic>M. meretrix</italic> ovary was evaluated to gain more insight into the toxicological mechanism of cadmium in ovarian cell apoptosis.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Animals and treatments</title>
<p>
<italic>Meretrix meretrix</italic> individuals (shell length, 46.52 &#xb1; 0.28&#xa0;mm; shell width, 23.51 &#xb1; 0.22&#xa0;mm; shell height, 37.73 &#xb1; 0.21&#xa0;mm; weight, 27.25 &#xb1; 0.22&#xa0;g) were purchased in July 2020 from Lingkun aquafarm, Wenzhou, Zhejiang, China. The seawater of the aquafarm where the clams were raised had a Cd<sup>2+</sup> concentration of 0.54 &#x3bc;g L<sup>-1</sup>, which is within the Chinese standard for first-class seawater quality. The clams were randomly assigned to five groups and each group was exposed to a different Cd<sup>2+</sup> concentration (0, 1.5, 3, 6, or 12 mg L<sup>&#x2212;1</sup>). These concentrations of Cd<sup>2+</sup> correspond to 1/10, 1/5, 1/2.5, and 1/1.25 of the LC<sub>50</sub> (15.01 mg L<sup>&#x2212;1</sup>) previously determined from a 4-day Cd<sup>2+</sup> exposure (<xref ref-type="bibr" rid="B48">Xia et&#xa0;al., 2016</xref>). Each group consisted of 120 clams that were kept in three separate aquariums, with 40 clams per aquarium. The clams were exposed to the Cd<sup>2+</sup> solutions without food for 5 days at 22 &#xb1; 1&#xb0;C and pH 8.0.&#xa0;A 5-day exposure was used instead of a 4-day exposure to maximize the effect of the Cd exposure, and at the same time without killing the clams, since prolonged exposure to 12 mg L<sup>-1</sup> Cd<sup>2+</sup> has been found to result in inactivity and even death for the clams. The aquaculture water in each aquarium was replaced daily with fresh water (prepared from double distilled water and artificial seawater salt) containing the same Cd<sup>2+</sup> concentration. At the end of the exposure period, all clams were dissected, and the ovaries were quickly removed from the female clams and processed according to the following experiments. All animal experimental procedures used complied with the Wenzhou University Animal Care and Use Committee&#x2019;s (WU-ACUC) guidelines, and this experiment was approved by the WU-ACUC.</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Determination of Cd in the ovary of the clam</title>
<p>To determine the Cd<sup>2+</sup> content of the ovary, two female clams were randomly selected from each aquarium (sample size = 6/treatment) to harvest their ovaries. The concentration of Cd<sup>2+</sup> in the ovary was measured following the experimental methods of <xref ref-type="bibr" rid="B26">Lin et&#xa0;al. (2017)</xref>.</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Detection of oxidative damage indicators</title>
<p>Two clams were randomly taken from each aquarium (sample size = 6/treatment) and their ovaries were extracted and then homogenized in 9 vol of 0.9% ice-cold physiological saline using a high throughput tissue grinder (SCIENTZ-48, China) kept on ice. The homogenate was then centrifuged at 12000 &#xd7; <italic>g</italic> and 4&#xb0;C for 5&#xa0;min and the supernatant was retained, yielding an ovary extract. The levels of MDA, PCO, DPC, ROS and T-AOC in the ovary extract were then measured as described below.</p>
<sec id="s2_3_1">
<label>2.3.1</label>
<title>MDA assay</title>
<p>MDA content was measured with an MDA assay kit (Nanjing Jiancheng Biological Engineering Institute) according to the manufacturer&#x2019;s instructions. MDA released from the degradation of lipid peroxide can react with thiobarbituric acid (TBA) under high temperatures and an acidic environment to produce a reddish-brown product, trimethadione (3, 5, 5-Trimethyloxazolidine-2, 4 - dione), which has a maximum absorption at 532 nm. MDA level was expressed in nmol per mg protein (nmol mg<sup>&#x2212;1</sup>).</p>
</sec>
<sec id="s2_3_2">
<label>2.3.2</label>
<title>PCO content assay</title>
<p>The content of PCO in the ovary was measured using DNPH (2, 4-dinitrophenylhydrazine) as described by <xref ref-type="bibr" rid="B49">Xie et&#xa0;al. (2007)</xref>. The carbonyl group on the protein would react with DNPH to form a red precipitate, 2, 4-dinitrophenylhydrazone, which is soluble in guanidine hydrochloride and has a characteristic absorption peak at 370 nm. The PCO content was calculated according to the absorbance at 370 nm and expressed as nmol per mg protein (nmol mg<sup>&#x2212;1</sup>).</p>
</sec>
<sec id="s2_3_3">
<label>2.3.3</label>
<title>DPC assay</title>
<p>DPC was determined by the SDS precipitation method according to <xref ref-type="bibr" rid="B49">Xie et&#xa0;al. (2007)</xref>. Briefly, cells were lysed with 2% SDS and the proteins (including free proteins and protein-DNA complexes) from the cell lysate were precipitated by centrifugation. The protein precipitate was then digested with proteinase K to collect the DNA in the protein-DNA complex (bind-DNA). The absorbance values of free-DNA and protein-bound DNA were measured using Hoechst 33258 fluorescent dye. The result was expressed as the percentage (DPC coefficient) of bound DNA to total DNA (free-DNA plus bind DNA).</p>
</sec>
<sec id="s2_3_4">
<label>2.3.4</label>
<title>ROS assay</title>
<p>ROS production was measured with a ROS Assay Kit (Beyotime Institute of Biotechnology, Shanghai, China), which measured the level of DCFH-DA (2, 7- Dichlorodihydrofluorescein diacetate), an indicator of oxidative stress. After entering the cell, DCFH-DA is rapidly oxidized to generate a strong fluorescent product, DCF (2&#x2019;, 7&#x2019;- dichlorofluorescein), which can then be detected by fluorescence using an excitation wavelength of 488 nm and an emission wavelength of 525 nm.</p>
</sec>
<sec id="s2_3_5">
<label>2.3.5</label>
<title>T-AOC assay</title>
<p>T-AOC level was measured using the ABTS method with 2, 2&#x2019;-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) as performed with a T-AOC assay kit (Nanjing Jiancheng Biological Engineering Institute, Nanjing, China). The assay is based on the oxidation of ABTS to ABTS<sup>+</sup> (green) by oxidants present in the ovary homogenate. However, when an antioxidant is present, the production of ABTS<sup>+</sup> is inhibited, leading to a decrease in absorbance at 734 nm. T-AOC level was expressed in mmol per g protein (mmol g<sup>-1</sup>).</p>
</sec>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Histological evaluation</title>
<p>The morphological changes of the ovary after Cd<sup>2+</sup> treatment were observed by Hematoxylin-eosin (H&amp;E) staining. One clam was randomly taken from each aquarium (sample size = 3/treatment) and its ovary was extracted and immobilized in 4% (v/v) paraformaldehyde for 24&#xa0;h, followed by dehydration in different concentrations of ethanol (75%, 85%, 90%, 95% and 100%). The dehydrated samples were embedded in melted paraffin and sectioned with a microtome (YD-315, China) to yield 7-&#x3bc;m thick slices. The slices were then deparaffinized, dehydrated, stained with hematoxylin and eosin, and finally sealed with neutral balsam and observed with a light microscope (Olympus BX51, Japan).</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Detection of apoptosis</title>
<sec id="s2_5_1">
<label>2.5.1</label>
<title>Acridine orange/ethidium bromide staining</title>
<p>The degree of damage to the ovary induced by Cd<sup>2+</sup> was examined by AO/EB staining carried out according to the method described by <xref ref-type="bibr" rid="B48">Xia et&#xa0;al. (2016)</xref>. Two clams were randomly taken from each aquarium (sample size = 6/treatment) and their ovaries were extracted. About 80 mg of the ovarian tissue was made into a cell suspension in 1% precooled PBS (pH = 7.2). An aliquot (25 &#x3bc;L) of the cell suspension was mixed with 1 &#x3bc;L AO/EB solution (100 &#x3bc;g mL<sup>&#x2212;1</sup> of AO in PBS; 100 &#x3bc;g mL<sup>&#x2212;1</sup> of EB in PBS) and incubated for 5&#xa0;min and then examined under a fluorescence microscope (Nikon Ti-s, Japan).</p>
</sec>
<sec id="s2_5_2">
<label>2.5.2</label>
<title>Annexin V-FITC/PI staining by flow cytometry</title>
<p>Ovaries were extracted from two clams randomly taken from each aquarium (sample size = 6/treatment). The ovaries were washed with 15 &#x2030; seawater to obtain an ovarian cell suspension with a final concentration of 1&#xd7;10<sup>6</sup> cells mL<sup>&#x2212;1</sup>. An aliquot (100 uL) of the cell suspension was taken from each preparation and mixed with 900 &#x3bc;L seawater. After that, 1 mL of the diluted cell suspension was divided into four centrifuge tubes (250 &#x3bc;L each tube) and centrifuged at 2500 &#xd7; <italic>g</italic> and 4&#xb0;C for 5&#xa0;min. The supernatant from each tube was removed and the precipitate was mixed with 100 &#x3bc;L buffer. The first tube was kept as a blank (no addition of dye). In the second tube was added 5 &#x3bc;L Annexin V-FITC whereas in the third tube was added 5 &#x3bc;L PI. In the fourth tube was added 5 &#x3bc;L Annexin V-FITC and 5 &#x3bc;L PI. After the addition of the dyes, the samples were gently swirled to mix and then incubated for 15&#xa0;min at room temperature in the dark, followed by the addition of 400 &#x3bc;L 1&#xd7; Binding Buffer and gentle mixing. The cells were then immediately analyzed by flow cytometry (BD FACSCantoII, San Jose, USA). The results were expressed as Annexin V-FITC/PI dot plots. For each sample, a total of 10,000 cells were counted for statistical analysis.</p>
</sec>
<sec id="s2_5_3">
<label>2.5.3</label>
<title>Caspase activity assay</title>
<p>Caspase-3, caspase-8 and caspase-9 activity levels in the ovary were measured using commercial kits (Beyotime, Shanghai, China) according to the manufacturer&#x2019;s instructions. Briefly, two clams from each aquarium (sample size = 6/treatment) were randomly collected and the ovary of each clam was then extracted. After that, 10 mg of the ovary was mixed with 100 &#x3bc;L lysis buffer provided in the kit and homogenized using a pre-cooled high throughput tissue grinder (SCIENTZ-48, China). The homogenate was then centrifuged at 16,000 &#xd7; <italic>g</italic> and 4&#xb0;C for 12&#xa0;min, and the supernatant was subjected to caspase-3, -8 and -9 assays using the corresponding assay kits.</p>
</sec>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Analysis of p53, MT, Bax, Bcl-2 and Caspase-3 mRNA</title>
<p>Total RNA was extracted from the ovaries extracted from two clams randomly taken from each aquarium (sample size = 6/treatment). The RNA was extracted using a UNIQ-10 column Trizol Total RNA Extraction Kit (Shanghai Sangon, China) according to the manufacturer&#x2019;s protocol. The quality of the RNA was evaluated by agarose gel electrophoresis, while its content was determined by UV spectrophotometry. The extracted RNA was reverse transcribed into cDNA using PrimeScript RT Reagent Kit (TaKaRa) according to the manufacturer&#x2019;s instructions, and 1 &#x3bc;g of RNA was used as a template in a 20 &#x3bc;L reaction. RT-PCR was performed on a Roche LC480 PCR instrument (Switzerland) using a TB Green PCR kit (TaKaRa, Dalian, Liaoning, China) with <italic>&#x3b2;-actin</italic> as the housekeeping gene. The qPCR primers for <italic>p53</italic>, <italic>MT</italic>, <italic>Bax</italic>, <italic>Bcl-2</italic>, <italic>caspase-3</italic> and <italic>&#x3b2;-actin</italic> genes are listed in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>. The PCR conditions were as follows: an initial step at 95&#xb0;C for 5&#xa0;min followed by 40 cycles of 15 s at 95&#xb0;C, 15 s at 58&#xb0;C, and 20 s at 72&#xb0;C. The relative expression level was calculated by using the 2 <sup>- &#x394; &#x394; Ct</sup> method (<xref ref-type="bibr" rid="B27">Livak and Schmittgen, 2001</xref>; <xref ref-type="bibr" rid="B20">Huang et&#xa0;al., 2020</xref>).</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Primers used for qRT-PCR.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Primer name</th>
<th valign="top" align="center">Sequence (5&#x2019; to 3&#x2019;)</th>
<th valign="top" align="center">Tm value</th>
<th valign="top" align="center">Product length</th>
<th valign="top" align="center">Genbank No.</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">p53-F</td>
<td valign="top" align="center">GTTCCCACTGTACCATCGAATA</td>
<td valign="top" align="center">53&#xb0;C</td>
<td valign="top" rowspan="2" align="center">100 bp</td>
<td valign="top" rowspan="2" align="left">MK270123.1</td>
</tr>
<tr>
<td valign="top" align="left">p53-R</td>
<td valign="top" align="center">ACGTCCAGGTGGTTGATTT</td>
<td valign="top" align="center">57&#xb0;C</td>
</tr>
<tr>
<td valign="top" align="left">MT-F</td>
<td valign="top" align="center">CGAGGACTGTTCATCAACCACTG</td>
<td valign="top" align="center">59&#xb0;C</td>
<td valign="top" rowspan="2" align="center">91 bp</td>
<td valign="top" rowspan="2" align="left">GU233466.1</td>
</tr>
<tr>
<td valign="top" align="left">MT-R</td>
<td valign="top" align="center">GCAAACAACTTTACACCCTGGAC</td>
<td valign="top" align="center">59&#xb0;C</td>
</tr>
<tr>
<td valign="top" align="left">Bax-F</td>
<td valign="top" align="center">TTGCCAACGATTTCTTCCG</td>
<td valign="top" align="center">53&#xb0;C</td>
<td valign="top" rowspan="2" align="center">203 bp</td>
<td valign="top" rowspan="2" align="left">ON040963</td>
</tr>
<tr>
<td valign="top" align="left">Bax-R</td>
<td valign="top" align="center">CATTTCCCAGCCACCTCTC</td>
<td valign="top" align="center">59&#xb0;C</td>
</tr>
<tr>
<td valign="top" align="left">Bcl-2-F</td>
<td valign="top" align="center">AGACAATGGTGGCTGGGATG</td>
<td valign="top" align="center">59&#xb0;C</td>
<td valign="top" rowspan="2" align="center">122 bp</td>
<td valign="top" rowspan="2" align="left">ON040964</td>
</tr>
<tr>
<td valign="top" align="left">Bcl-2-R</td>
<td valign="top" align="center">CGGCAGCTAATGCTCCAAGA</td>
<td valign="top" align="center">56&#xb0;C</td>
</tr>
<tr>
<td valign="top" align="left">caspase-3-F</td>
<td valign="top" align="center">GAAGCCAGCAAGTGCACAAAC</td>
<td valign="top" align="center">59&#xb0;C</td>
<td valign="top" rowspan="2" align="center">117 bp</td>
<td valign="top" rowspan="2" align="left">ON040965</td>
</tr>
<tr>
<td valign="top" align="left">caspase-3-R</td>
<td valign="top" align="center">GCAAGCATGTACCCTCGTTG</td>
<td valign="top" align="center">59&#xb0;C</td>
</tr>
<tr>
<td valign="top" align="left">&#x3b2;-actin-F</td>
<td valign="top" align="center">TTGTCTGGTGGTTCAACTATG</td>
<td valign="top" align="center">55&#xb0;C</td>
<td valign="top" rowspan="2" align="center">175 bp</td>
<td valign="top" rowspan="2" align="left">JN084197.1</td>
</tr>
<tr>
<td valign="top" align="left">&#x3b2;-actin-R</td>
<td valign="top" align="center">TCCACATCTGCTGGAAGGTG</td>
<td valign="top" align="center">59&#xb0;C</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Statistical analysis</title>
<p>Statistical analysis of the data was performed with the SPSS Statistical Package (Version 23.0, Chicago, USA) and Origin Statistical Package (Version 9.2, Northampton, USA). All data were expressed as means &#xb1; standard errors (mean &#xb1; S.E.). Significance differences between the control group and treatment groups were determined using a one-way ANOVA. In addition, correlation analysis was performed with Pearson Correlation Coefficient using SPSS 23.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Cd bio-accumulation in <italic>M. meretrix</italic> ovary</title>
<p>The Cd<sup>2+</sup> level for the control group was 0.338 &#xb1; 0.009 mg kg<sup>&#x2212;1</sup> wet tissue whereas the Cd<sup>2+</sup> levels for the groups treated with 1.5, 3, 6, 12 mg L<sup>&#x2212;1</sup> Cd<sup>2+</sup> were 1.696 &#xb1; 0.010, 2.443 &#xb1; 0.012, 3.350 &#xb1; 0.012, and 4.637 &#xb1; 0.061 kg<sup>&#x2212;1</sup> wet tissue, respectively. All Cd<sup>2+</sup>-treated groups exhibited a significant (<italic>P</italic>&lt;0.05) increase in accumulated Cd<sup>2+</sup> in the ovary compared with the control, with the group treated with 12 mg L<sup>&#x2212;1</sup> Cd<sup>2+</sup> displaying the maximum Cd<sup>2+</sup> level. The accumulated Cd<sup>2+</sup> level in the ovary of the clams clearly showed a dose-response relationship with respect to the concentration of Cd<sup>2+</sup> in the water that the clams were exposed to.</p>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Detection of oxidative damage indexes</title>
<sec id="s3_2_1">
<label>3.2.1</label>
<title>Effects of Cd on MDA, PCO and DPC contents</title>
<p>The levels of MDA, PCO and DPC in the ovary increased when <italic>M. meretrix</italic> was exposed to rising Cd<sup>2+</sup> concentrations (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1A&#x2013;C</bold>
</xref>). The MDA level in the control group was not significantly (<italic>P</italic> &gt; 0.05) different from those of the groups treated with lower Cd<sup>2+</sup> concentrations (1.5 and 3 mg L<sup>&#x2212;1</sup>) but was significantly (<italic>P</italic> &lt; 0.05) lower than those of the groups treated with higher Cd<sup>2+</sup> concentrations (6 and 12 mg L<sup>&#x2212;1</sup>) (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). The PCO level in the control group was not significantly different (<italic>P</italic> &gt; 0.05) from the group treated with 1.5 mg L<sup>&#x2212;1</sup> Cd<sup>2+</sup>, but it was significantly (<italic>P</italic> &lt; 0.05) lower than those of the groups treated with 3, 6 and 12 mg L<sup>&#x2212;1</sup> Cd<sup>2+</sup> (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>). However, the DPC level of the control group was significantly (<italic>P</italic> &lt; 0.05) lower than that of each Cd<sup>2+</sup>-treated group (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1C</bold>
</xref>). Overall, Cd<sup>2+</sup> seemed to induce the production of MDA, PCO and DPC as part of its toxic effect.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Effects of Cd on MDA, DPC, PCO, ROS and T-AOC in <italic>M. meretrix</italic> ovary. <bold>(A)</bold> MDA level; <bold>(B)</bold> PCO level; <bold>(C)</bold> DPC level; <bold>(D)</bold> ROS (white bars) and T-AOC (black bars) contents. Different letters indicate significant (<italic>P</italic> &lt; 0.05) differences among groups as revealed by Tukey&#x2019;s post-hoc multiple comparison tests; Data are expressed as means &#xb1; SE (n = 6).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-1080516-g001.tif"/>
</fig>
</sec>
<sec id="s3_2_2">
<label>3.2.2</label>
<title>Effects of Cd<sup>2+</sup> on ROS and T-AOC contents</title>
<p>The content of ROS in the ovary of Cd<sup>2+</sup>-treated <italic>M. merertrix</italic> increased with increasing Cd<sup>2+</sup> concentrations, but a significant (<italic>P</italic> &lt; 0.05) increase over the control group was observed only for the groups treated with 6 and 12 mg L<sup>&#x2212;1</sup> Cd<sup>2+</sup> (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1D</bold>
</xref>, white bars). T-AOC content in the ovary showed a slight but significant increase over the control group for the group treated with the lowest Cd<sup>2+</sup> concentration (1.5 mg L<sup>&#x2212;1</sup>) but then decreased to a level significantly lower than that of the control group with further increases in Cd<sup>2+</sup> concentration (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1D</bold>
</xref>, black bars). These results indicated that Cd<sup>2+</sup> led to ROS accumulation in the ovary, resulting in oxidative damage, and exposure to a high Cd<sup>2+</sup> concentration may overwhelm the intracellular antioxidant capacity of the ovarian cells.</p>
</sec>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Morphological changes of ovarian tissue after Cd<sup>2+</sup> treatment</title>
<p>The effect of Cd<sup>2+</sup> on the tissue structure of <italic>M. meretrix</italic> ovary was observed by light microscopy. In the control group, the gonadal structure was complete, the ovarian cells had a normal shape and were tightly arranged, and the number of follicular epithelial cells was higher compared with those of the Cd<sup>2+</sup>-treated groups (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>). In the Cd<sup>2+</sup>-treated groups, the number of follicular cells gradually decreased with increasing Cd<sup>2+</sup> concentrations (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2B, C, E, G</bold>
</xref>) and ovarian cells had a loose and more irregular arrangement (yellow arrows in <xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2B, C, E, G</bold>
</xref>) compared with the control group. Cadmium treatment caused the loss of gonadal tissue structure (rectangles in <xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2B, C, E, G</bold>
</xref>), with some ovarian cells being deformed in the group treated with 12 mg L<sup>-1</sup> Cd<sup>2+</sup> (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2G&#x2013;I</bold>
</xref>). In addition, chromatin condensation, a typical apoptotic feature, was observed in the nucleus of ovarian cells of the higher Cd<sup>2+</sup> treated groups (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2D, F, H, I</bold>
</xref>, red arrows). The size of the nucleus in the ovarian cells of the group treated with 12 mg L<sup>-1</sup> Cd<sup>2+</sup> was clearly smaller compared with the ovarian cells of 3 and 6 mg L<sup>-1</sup> Cd<sup>2+</sup>-treated groups (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2D, F, H, I</bold>
</xref>).</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Histological sections of the ovary from <italic>M. meretrix</italic> that were subjected to Cd<sup>2+</sup> and no Cd<sup>2+</sup> treatments. Control group <bold>(A)</bold>; Groups treated with 1.5 mg L<sup>&#x2212;1</sup> Cd<sup>2+</sup> <bold>(B)</bold>, 3 mg L<sup>&#x2212;1</sup> Cd<sup>2+</sup> <bold>(C, D)</bold>, 6.0 mg L<sup>&#x2212;1</sup> Cd<sup>2+</sup> <bold>(E, F)</bold>, and 12 mg L<sup>&#x2212;1</sup> Cd<sup>2+</sup> <bold>(G&#x2013;I)</bold>. Yellow arrows indicate the irregularly distributed ovarian cells. Red arrows indicate nuclear chromatin condensation. Rectangles indicate the loss of gonadal tissue structure.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-1080516-g002.tif"/>
</fig>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>Detection of apoptosis</title>
<sec id="s3_4_1">
<label>3.4.1</label>
<title>AO/EB staining</title>
<p>After AO/EB staining, four types of fluorescence cells were detected by fluorescence microscopy: green (normal live cells), yellow (early-stage apoptotic cells), orange (late-stage apoptotic cells), and red (dead cells) fluorescence cells (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3A&#x2013;E</bold>
</xref>). The cells in the control group were normal live cells (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>), indicating no obvious apoptotic ovarian cells. As for the Cd<sup>2+</sup> -treated groups, the number of early-stage and late-stage apoptotic cells increased significantly with increasing concentrations of Cd<sup>2+</sup>, with the highest Cd<sup>2+</sup> concentration resulting in the greatest number of orange-red fluorescence cells, indicating they were most severely damaged (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3B&#x2013;E</bold>
</xref>).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Detection of apoptotic <italic>M. meretrix</italic> ovarian cells by fluorescence microscopy following exposure to Cd<sup>2+</sup>. <bold>(A)</bold> control group; <bold>(B)</bold> 1.5 mg L<sup>&#x2212;1</sup>; <bold>(C)</bold> 3 mg L<sup>&#x2212;1</sup>; <bold>(D)</bold> 6.0 mg L<sup>&#x2212;1</sup>; <bold>(E)</bold> 12 mg L<sup>&#x2212;1</sup> Cd<sup>2+</sup> concentration. <bold>(F)</bold> The plot shows the rate of apoptosis in <italic>M. meretrix</italic> ovarian cells as determined from the microscopy data. Significant (<italic>P</italic> &lt; 0.05) differences among groups are indicated by different letters above the bars in the plot.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-1080516-g003.tif"/>
</fig>
<p>The apoptotic rate of the ovarian cells was calculated according to the following formula: apoptosis rate = [(early-stage apoptotic cells + late-stage apoptotic cells)/total cells]&#xd7;100%. The apoptotic rate for the control group was just 3.5%, while the apoptotic rate for the Cd<sup>2+</sup>-treated groups increased significantly with increases in Cd<sup>2+</sup> concentration, reaching 75.2% for the group treated with 12 mg&#xb7;L<sup>-1</sup> Cd<sup>2+</sup> (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3F</bold>
</xref>). These results indicated that the rate of ovarian cell apoptosis was positively correlated with the Cd<sup>2+</sup> concentration that the clams were exposed to.</p>
</sec>
<sec id="s3_4_2">
<label>3.4.2</label>
<title>Flow cytometry detection</title>
<p>The ovarian cells of <italic>M. meretrix</italic> were detected by flow cytometry after Annexin V-FITC/PI staining. The cells were distributed in four regions: Q1 (mechanically damaged cells), Q2 (late-stage apoptotic cells), Q3 (early-stage apoptotic cells), Q4 (normal cells) (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4A&#x2013;E</bold>
</xref>). Compared with the control group, the number of normal cells in the Cd<sup>2+</sup>-treated groups decreased significantly, while the number of late-stage apoptotic cells and early-stage apoptotic cells gradually increased with increasing Cd<sup>2+</sup> concentrations. This suggested that the apoptotic rate increased gradually with increases in Cd<sup>2+</sup> concentration. The apoptotic rate of the ovarian cells for each group was calculated according to the data in the corresponding flow cytometry chart. A comparison of the apoptotic rates among the different groups revealed a significant increase for each Cd<sup>2+</sup>-treated group relative to the control group (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4F</bold>
</xref>).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Detection of apoptosis in <italic>M. meretrix</italic> ovarian cells by flow cytometry. <bold>(A)</bold> control group; <bold>(B)</bold> 1.5 mg L<sup>&#x2212;1</sup>; <bold>(C)</bold> 3 mg L<sup>&#x2212;1</sup>; <bold>(D)</bold> 6.0 mg L<sup>&#x2212;1</sup>; and <bold>(E)</bold> 12 mg L<sup>&#x2212;1</sup> Cd<sup>2+</sup> concentration. <bold>(F)</bold> The plot shows the rate of apoptosis in <italic>M. meretrix</italic> ovarian cells as determined from the flow cytometry data. Significant (<italic>P</italic> &lt; 0.05) differences among groups are indicated by different letters above the bars in the plot.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-1080516-g004.tif"/>
</fig>
</sec>
<sec id="s3_4_3">
<label>3.4.3</label>
<title>Effects of Cd on caspase-3, -8, -9 activities</title>
<p>Caspase-3, -8, -9 activity levels in the ovary of <italic>M. meretrix</italic> treated with Cd<sup>2+</sup> increased gradually with increasing Cd<sup>2+</sup> concentrations (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A&#x2013;C</bold>
</xref>). For caspase-3, there was no significant difference in activity between the control group and the groups treated with 1.5 mg L<sup>&#x2212;1</sup> and 3 mg L<sup>&#x2212;1</sup> Cd<sup>2+</sup>, but the group treated with 6 mg L<sup>&#x2212;1</sup> and 12 mg L<sup>&#x2212;1</sup> Cd<sup>2+</sup> exhibited a significantly (<italic>P</italic> &lt; 0.05) higher activity than the control group (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>). For caspase-8, all Cd<sup>2+</sup>-treated groups exhibited a significantly higher activity compared with the control group, but no significant difference was observed among the different Cd<sup>2+</sup>-treated groups (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>). As for caspase-9, there was a significant (<italic>P</italic> &lt; 0.05) difference in the activity between the control group and each Cd<sup>2+</sup>-treated group (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>). Taken together, the data suggested that Cd<sup>2+</sup> could enhance caspase activity, with different types of caspases having different cadmium sensitivities.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Effects of Cd on the activities of caspase-3, caspase-8 and caspase-9 in <italic>M. meretrix</italic> ovary. <bold>(A)</bold> Caspase-3; <bold>(B)</bold> caspase-8; <bold>(C)</bold> caspase-9. Different letters indicate significant (<italic>P</italic> &lt; 0.05) differences among groups as revealed by Tukey&#x2019;s post-hoc multiple comparison tests; Data are expressed as means &#xb1; SE (n = 6).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-1080516-g005.tif"/>
</fig>
</sec>
</sec>
<sec id="s3_5">
<label>3.5</label>
<title>Effect of Cd on the mRNA expression levels of p53, MT, Bax, Bcl-2 and Caspase-3</title>
<p>The clams treated with Cd<sup>2+</sup> showed a significantly higher level of <italic>MT</italic> mRNA than the control clams, but the initial increase was followed by a substantial decrease at the highest Cd<sup>2+</sup> concentration (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>, white bars). The maximum level was found in the group treated with 3 mg L<sup>&#x2212;1</sup> Cd<sup>2+</sup>, and it was significantly (<italic>P</italic> &lt; 0.05) different from the control group and the groups treated with 1.5 and 12 mg L<sup>&#x2212;1</sup> Cd<sup>2+</sup>. The level of <italic>p53</italic> mRNA increased with increasing Cd<sup>2+</sup> concentrations (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>, black bars), but a significant increase over the control group was only detected for the groups treated with Cd<sup>2+</sup> higher than 1.5 mg L<sup>&#x2212;1</sup>. Cadmium, therefore, appeared to induce the expression of p53 and MT in the ovary of <italic>M. meretrix</italic>, with a more obvious concentration effect seen in the case of p53 expression.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Effects of Cd on apoptotic markers in <italic>M. meretrix</italic> ovary. <bold>(A)</bold> <italic>p53</italic> (white bars) and <italic>MT</italic> mRNA (black bars); <bold>(B)</bold> <italic>Bax</italic> (white bars) and <italic>Bcl-2</italic> mRNA (black bars); <bold>(C)</bold> <italic>Caspase-3</italic> mRNA. Different letters indicate significant (<italic>P</italic> &lt; 0.05) differences among groups as revealed by Tukey&#x2019;s post-hoc multiple comparison tests; Data are expressed as means &#xb1; SE (n = 6).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-1080516-g006.tif"/>
</fig>
<p>The level of <italic>Bax</italic> mRNA increased in a concentration-dependent manner after Cd<sup>2+</sup> treatment (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref> white bars), with the groups treated with 3, 6 and 12 mg L<sup>-1</sup> Cd<sup>2+</sup> all exhibited significantly (<italic>P</italic> &lt; 0.05) higher levels than the control group, while there was no significant (<italic>P</italic> &gt; 0.05) difference between the control group and the group treated with the lowest Cd<sup>2+</sup> concentration. As for the level of <italic>Bcl-2</italic> mRNA, it increased for the group treated with 1.5 mg L<sup>&#x2212;1</sup> Cd<sup>2+</sup> but then decreased with increasing Cd<sup>2+</sup> concentrations relative to the control group (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref> black bars), and the difference in <italic>Bcl-2</italic> mRNA level between the control and each of the Cd<sup>2+</sup>-treated group was significant (<italic>P</italic>&lt;0.05). The level of <italic>Caspase-3</italic> mRNA increased with increasing Cd<sup>2+</sup> concentrations and all Cd<sup>2+</sup>-treated groups exhibited significantly (<italic>P</italic> &lt; 0.05) higher levels than the control group (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>). This indicated an obvious degree of apoptosis in ovarian cells linked to the concentration effect of Cd<sup>2+</sup>. Overall, the results did suggest that Cd<sup>2+</sup> could activate the p53-mediated apoptosis pathway in ovarian cells, although the changes in these apoptosis-associated markers did not seem to have a consistent response to Cd<sup>2+</sup> concentration.</p>
</sec>
<sec id="s3_6">
<label>3.6</label>
<title>Correlation analysis of <italic>p53</italic> mRNA with oxidative damage indexes and apoptosis-related factors</title>
<p>The <italic>p53</italic> mRNA level of the ovary was positively correlated with ROS, MDA, PCO, DPC and <italic>MT, Bax</italic> mRNA levels and negatively correlated with T-AOC and <italic>Bcl-2</italic> mRNA levels (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>). This indicated that oxidative damage and p53 apoptosis pathway were mutually stimulating in the ovarian cells of Cd<sup>2+</sup> treated <italic>M. meretrix</italic>, such that when the p53 apoptosis pathway was activated, the function of the intracellular antioxidant system may be inhibited.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Correlation analysis of <italic>p53</italic> mRNA expression with the oxidative damage-related and apoptosis-related markers. Oxidative damaged-related markers: <bold>(A)</bold> ROS; <bold>(B)</bold> T-AOC; <bold>(C)</bold> MDA; <bold>(D)</bold> PCO; <bold>(E)</bold> DPC; <bold>(F)</bold> MT. Apoptosis-related factors: <bold>(G)</bold> Bax; <bold>(H)</bold> Bcl-2; <bold>(I)</bold> Caspase-3. PC, Pearson correlation coefficient.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-09-1080516-g007.tif"/>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<sec id="s4_1">
<label>4.1</label>
<title>Toxic effects of cadmium on ovary</title>
<p>Aquatic environment is the final acceptor of various cadmium pollutions and cadmium can remain and become enriched in aquatic organisms in tissues such as the gonads, gills, foot and visceral mass for a long time through the food chain (<xref ref-type="bibr" rid="B34">Revathi et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B30">Nunez-Nogueira et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B10">Chen et&#xa0;al., 2020</xref>). If cadmium is accumulated in the gonads, it can result in serious reproductive toxicity (<xref ref-type="bibr" rid="B15">Fleege et&#xa0;al., 2003</xref>). Long-term exposure to cadmium can inhibit ovulation and affect the development of the embryo and larva of fish (<xref ref-type="bibr" rid="B38">Szczerbik et&#xa0;al., 2006</xref>; <xref ref-type="bibr" rid="B47">Wu et&#xa0;al., 2012</xref>). Therefore, it is of great significance to study the effect of cadmium on the ovary to better understand the relationship between aquatic ecological pollution and aquatic organisms. In this study, Cd<sup>2+</sup> was found to accumulate in <italic>M. meretrix</italic> ovary in a concentration-dependent manner. This finding is consistent with that of <xref ref-type="bibr" rid="B9">Chen et&#xa0;al. (2019)</xref> who found that exposure to Cd<sup>2+</sup> led to a significant accumulation of Cd<sup>2+</sup> in the ovary of <italic>E. sinensis</italic> in a concentration-dependent manner. <xref ref-type="bibr" rid="B50">Xu et&#xa0;al. (2016)</xref> also found the accumulation of cadmium in the ovary of the crab <italic>Sinopotamon henanense</italic> is time-dependent. Cd<sup>2+</sup> toxicity has been comprehensively explored in many <italic>in vitro</italic> and <italic>in vivo</italic> studies, and various molecular and cellular mechanisms have been proposed to explain the toxicity of this metal. Among these mechanisms, oxidative stress is considered to play an important role (<xref ref-type="bibr" rid="B29">Matovic et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B33">Ren et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B10">Chen et&#xa0;al., 2020</xref>). The enrichment of cadmium to a certain level within an aquatic animal will lead to the production of a large amount of ROS (<xref ref-type="bibr" rid="B16">Gao et&#xa0;al., 2021</xref>; <xref ref-type="bibr" rid="B42">Wang et&#xa0;al., 2021</xref>). The increased extent of lipid peroxidation we observed in <italic>M. meretrix</italic> ovary manifested itself as increased ROS, MDA, DPC and PCO levels and decreased T-AOC and <italic>MT</italic> mRNA levels (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref> &amp; <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>). Exposure to cadmium, therefore, led to the production of an excessive amount of ROS which subsequently induced lipid peroxidation in the ovary. The excess ROS can also cause the cross-linking of proteins, nucleic acids and other macromolecules, making them unable to carry out their normal functions in the ovarian cells, thereby adding further stress to the survival of the ovarian cells. The appearance of MDA, the final product of lipid peroxidation, could lead to the denaturation of the cell membrane (<xref ref-type="bibr" rid="B16">Gao et&#xa0;al., 2021</xref>). PCO is an irreversible protein modification that occurs under the action of oxidation, and such change in protein structure will result in the loss of the protein function (<xref ref-type="bibr" rid="B14">Fedorova et&#xa0;al., 2014</xref>). Other well-known forms of cellular damage induced by toxic agents are protein crosslinking and DNA fragmentation, commonly measured by the DPC assay (<xref ref-type="bibr" rid="B22">Jena, 2012</xref>; <xref ref-type="bibr" rid="B8">Cheng et&#xa0;al., 2021</xref>). In the case of <italic>M. meretrix</italic> ovary, DPC level was found to increase significantly in the group exposed to the lowest Cd<sup>2+</sup> concentration (1.5 mg L<sup>&#x2212;1</sup>), however, the levels of MDA and PCO in this group were not significantly different from those of the control group (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1A&#x2013;C</bold>
</xref>). This suggested that within the <italic>M. meretrix</italic> ovarian cells, DNA might be more sensitive to cadmium compared with lipids and proteins.</p>
<p>Excessive production of ROS can likely trigger an antioxidant defense response, which can subsequently work to purge the system of these free radicals. Experimentally, the purging of free radicals is measured in terms of T-AOC. The rising level of T-AOC in <italic>M. meretrix</italic> ovary following Cd<sup>2+</sup> exposure further demonstrated the ability of Cd<sup>2+</sup> to promote the production of ROS in the cells. The rise in T-AOC was accompanied by a rising level of <italic>MT</italic> mRNA. Both T-AOC level and MT expression were stimulated by Cd<sup>2+</sup>, but their increases appeared to drop at the higher ends of Cd<sup>2+</sup> concentration (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1D</bold>
</xref>, <xref ref-type="fig" rid="f6">
<bold>6A</bold>
</xref>), suggesting that the antioxidant capacity of the ovary might have been overwhelmed or might have reached a maximum level. Similar findings have been reported for <italic>E. sinensis</italic> following exposure to Cd<sup>2+</sup>, where the activities of antioxidant enzymes such as SOD, CAT and GPx were found to increase at lower Cd<sup>2+</sup> concentrations but decreased at higher Cd<sup>2+</sup> concentrations (<xref ref-type="bibr" rid="B9">Chen et&#xa0;al., 2019</xref>). This suggested that there could be a threshold to which the antioxidant capacity of the cells can deal with the rise in oxidative stress induced by an external agent, and the likelihood of the cells surviving the onslaught of oxidative stress is pretty much dependent on the upper threshold of the anti-oxidative response intrinsic to that organism.</p>
<p>The accumulation of free radicals caused by cadmium can inhibit the development of the ovary through affecting the normal morphology of the membrane system and cells (<xref ref-type="bibr" rid="B50">Xu et&#xa0;al., 2016</xref>). The accumulation of Cd<sup>2+</sup> in <italic>M. meretrix</italic> ovary was also manifested as a severely damaged cellular structure revealed by microscopic examination (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). The normal survival of ovarian cells depends on the transport of substances from other tissues to these cells. Cadmium may enter the ovarian cells through the routes of material transport and accumulate in the cells, gradually increasing the survival pressure for the ovarian cells. Some ovarian cells were able to withstand the oxidative damage caused by cadmium and became deformed, and the distance between different ovarian cells became larger (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). <xref ref-type="bibr" rid="B34">Revathi et&#xa0;al. (2011)</xref> found that in cadmium-treated <italic>Macrobrachium rosenbergii</italic>, the ovary has both immature oocytes and hypertrophied primary oocytes with more vacuoles. When the fish <italic>Oreochromis niloticus</italic> was exposed to Cd<sup>2+</sup> for 30 days, a seemingly increase in the number of primary follicles and secondary follicles was noticed in all Cd<sup>2+</sup>-exposed female fish relative to the control, and after Cd<sup>2+</sup> exposure for 60 days, deformed follicles were observed in the ovaries (<xref ref-type="bibr" rid="B28">Luo et&#xa0;al., 2015</xref>). Cadmium-treated rats have been shown to exhibit irregular morphology, vacuolated primary follicles and reduced luteal volume (<xref ref-type="bibr" rid="B11">da Costa et&#xa0;al., 2021</xref>). The number of primordial follicles and primary follicles in these rats was significantly lower than that in the control rats. Cadmium-induced destruction of ovarian tissue appears to be definite, universal and irreversible.</p>
<p>
<xref ref-type="bibr" rid="B32">Patel et&#xa0;al. (2021)</xref> found that cadmium has a great toxic effect on the reproductive system, and this may consequently have a negative impact on the fertilization process, embryonic development and embryo survival rate. Cadmium can cause thinning of the ovarian cortical area, damage or loss of oocytes as well as reducing the growth and maturation of the follicles or turning them into vacuoles, thereby reducing the ovulation and fertilization ability in mammals (<xref ref-type="bibr" rid="B39">Thompson &amp; Bannigan, 2008</xref>; <xref ref-type="bibr" rid="B21">Ikeh-Tawari et&#xa0;al., 2013</xref>). <xref ref-type="bibr" rid="B46">Wu et&#xa0;al. (2013)</xref> observed a 60% decrease in the mating rate for female zebrafish after exposure to 8.9&#x2013;35.6 &#xb5;M Cd<sup>2+</sup> for 72&#xa0;h. Likewise, cadmium exposure was found to result in a lower number of normal ovarian cells (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2D&#x2013;I</bold>
</xref>), suggesting that cadmium may reduce ovulation in <italic>M. meretrix</italic>. The quality of the ovarian cells determines the success rate of fertilization and the normal development of the embryo. In addition, cadmium-induced DNA damage may affect the integrity of the genetic material carried by the ovarian cells, leaving a potential threat to embryonic development. Our previous study has found that cadmium exposure can disrupt the membranous structure of <italic>M. meretrix</italic> testis and significantly reduce sperm survival (<xref ref-type="bibr" rid="B16">Gao et&#xa0;al., 2021</xref>). In addition, the levels of Cd enrichment, ROS, MDA, DPC and PCO in the testis are also lower than those found in the ovary, although the number of normal sperm is significantly reduced in <italic>M. meretrix</italic> individuals exposed to increasing Cd<sup>2+</sup> concentrations as in the case of the ovary observed in this study (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1</bold>
</xref>&#x2013;<xref ref-type="fig" rid="f4">
<bold>4</bold>
</xref>). This indicated that the ovary might have suffered a more serious degree of oxidative damage than the testis, consistent with <xref ref-type="bibr" rid="B28">Luo et&#xa0;al. (2015)</xref> who found that female tilapia is more sensitive to Cd than male tilapia. However, the number of ovarian cells in <italic>M. meretrix</italic> was much lower than that of sperm, and since the nutrients needed for embryonic development are mainly stored in the ovary, this could mean that the detrimental effects of reduced ovarian cell count and structural damage on <italic>M. meretrix</italic> reproduction may be greater than the adverse effects of reduced sperm count. In <italic>M. meretrix</italic>, fertilization of the ova takes place outside the body. This means that cadmium not only can affect the formation and survival of the sperms and eggs by entering the body tissues of <italic>M. meretrix</italic>, but it can also interfere with the fertilization process by directly affecting the sperms and eggs that were successfully released into seawater. Therefore, the damage to ovarian cells caused by cadmium could directly affect the fecundity and seedling rate of <italic>M. meretrix</italic>. Our result provided support for the notion that Cd might pose a significant threat to the reproduction of clams through its damaging impact on ovarian cells. Apart from the biological impact that cadmium can inflict on aquatic animals, cadmium exposure can also adversely affect the economics of shellfish aquaculture (<xref ref-type="bibr" rid="B10">Chen et&#xa0;al., 2020</xref>) by decreasing the reproductive potential of the animals, and hence their production output. However, further research is required to examine the effect of Cd on the reproduction potential of <italic>M. meretrix</italic> cultured in cadmium-polluted water.</p>
</sec>
<sec id="s4_2">
<label>4.2</label>
<title>Responses of the apoptosis pathway after Cd exposure</title>
<p>Apoptosis, a genetically controlled self-destructive process under stress, plays a crucial role in maintaining tissue homeostasis by ridding the system of abnormal or damaging cells (<xref ref-type="bibr" rid="B13">Elmore, 2007</xref>; <xref ref-type="bibr" rid="B51">Xu and Yang, 2018</xref>). A large number of studies in recent years have shown that cadmium can induce apoptosis in many tissues and cells, which include rat osteoblasts (<xref ref-type="bibr" rid="B55">Zheng et&#xa0;al., 2020</xref>), duck ovaries (<xref ref-type="bibr" rid="B6">Cao et&#xa0;al., 2016</xref>), carp neutrophils (<xref ref-type="bibr" rid="B37">Sun et&#xa0;al., 2020</xref>), crab hepatopancreas (<xref ref-type="bibr" rid="B8">Cheng et&#xa0;al., 2021</xref>) and ovary (<xref ref-type="bibr" rid="B9">Chen et&#xa0;al., 2019</xref>), clam gill (<xref ref-type="bibr" rid="B42">Wang et&#xa0;al., 2021</xref>) and hepatopancreas (<xref ref-type="bibr" rid="B48">Xia et&#xa0;al., 2016</xref>), demonstrating that apoptosis is one of the important consequences of cadmium toxicity. The study of cadmium-induced apoptosis has, therefore, become a hot topic to unravel the toxicity of cadmium at the molecular level. According to the AO/EB and flow cytometry data, the number of apoptotic <italic>M. meretrix</italic> ovarian cells increased with an increase in Cd<sup>2+</sup> exposure concentration, with the number of apoptotic cells accounting for more than half of the total cells number at the highest Cd<sup>2+</sup> concentration used (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3</bold>
</xref> &amp; <xref ref-type="fig" rid="f4">
<bold>4</bold>
</xref>). This suggested the existence of a concentration-dependent relationship between the extent of apoptosis and the accumulation of cadmium, consistent with our previous study (<xref ref-type="bibr" rid="B16">Gao et&#xa0;al., 2021</xref>), where we showed that increasing the Cd<sup>2+</sup> concentration to which <italic>M. meretrix</italic> is exposed can lead to a significant increase in the number of apoptotic sperm cells. Apoptosis induced by heavy metals is a very complex process, involving a series of pro-apoptotic genes and proteins, including the Src-family tyrosinase kinase, Bax, Fas and p53, and anti-apoptotic genes and related proteins such as Bcl-2 and Myc (<xref ref-type="bibr" rid="B25">Kurochkin et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B22">Jena, 2012</xref>). We have previously shown that in <italic>M. meretrix</italic> testis, Cd<sup>2+</sup>-induced apoptosis can up-regulate the levels of ROS and caspase-3, -9 activities, while decreasing the levels of &#x394;&#x3c8;m and CCO activity, activating caspase signaling and triggering apoptosis, with p53 playing a vital role in the Cd<sup>2+</sup>-induced apoptosis (<xref ref-type="bibr" rid="B16">Gao et&#xa0;al., 2021</xref>). Furthermore, Cd<sup>2+</sup> was also found to induce apoptosis in clam gill <italic>via</italic> the mitochondrial caspase-dependent pathway (<xref ref-type="bibr" rid="B42">Wang et&#xa0;al., 2021</xref>). In vertebrates, many genes or proteins, such as the caspase family, p53, Bax and Bcl-2, are considered to be key factors in both pathways (<xref ref-type="bibr" rid="B19">Huang et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B37">Sun et&#xa0;al., 2020</xref>). Caspase activation plays a central role in the execution of apoptosis. Caspase-8 and Caspase-9 are key proteins of the extrinsic (<xref ref-type="bibr" rid="B19">Huang et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B37">Sun et&#xa0;al., 2020</xref>) and intrinsic (<xref ref-type="bibr" rid="B33">Ren et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B8">Cheng et&#xa0;al., 2021</xref>) pathways of apoptosis, respectively. However, apoptosis ultimately relies on caspase-3 to regulate endonucleases to promote DNA cleavage (<xref ref-type="bibr" rid="B24">Kumar, 2007</xref>). The activation of caspase-3, -8 and -9 in <italic>M. meretrix</italic> ovary demonstrated that both the intrinsic and extrinsic pathways were involved in the apoptosis (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref>). However, caspase-8 activity in the ovary appeared to be insensitive to Cd<sup>2+</sup> concentration (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>). This suggested that the extrinsic pathway of apoptosis in the ovarian cells may have reached saturation. Instead, caspase-9 activity appeared to correlate with Cd<sup>2+</sup> concentration (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>). It could also suggest that within a certain Cd<sup>2+</sup> concentration range (1.5&#x2013;12 mg L<sup>&#x2212;1</sup>), the extrinsic pathway of apoptosis was not significantly correlated with Cd<sup>2+</sup> concentration, while the intrinsic pathway of apoptosis was positively correlated with Cd<sup>2+</sup> concentration. Thus, under the Cd<sup>2+</sup> concentrations used in this study, the intrinsic apoptotic pathway seemed to be the main route by which <italic>M. meretrix</italic> ovarian cells would undergo apoptosis.</p>
<p>Among the intrinsic apoptosis pathways, the mitochondrial pathway is the most classic apoptosis pathway. The Bcl-2 family controls the permeability of the mitochondrial membrane and is the main regulator of the mitochondrial apoptosis pathway, while p53 plays a key role in the regulation of the Bcl-2 family of proteins (<xref ref-type="bibr" rid="B31">Ostrakhovitch et&#xa0;al., 2016</xref>; <xref ref-type="bibr" rid="B52">Yamada and Yoshida, 2019</xref>). The expression of these apoptosis-related genes (<italic>caspase-3, p53, Bcl-2</italic> and <italic>Bax</italic>) was found to be regulated by Cd<sup>2+</sup> (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>). For example, after Cd<sup>2+</sup> treatment, the level of Bcl-2 expression was decreased under higher Cd<sup>2+</sup> concentrations (3-12 mg L<sup>&#x2212;1</sup>) while the levels of caspase-3, Bax and p53 expressions increased in a concentration-dependent manner. These results implied that elevation of ROS level could directly lead to DNA damage, and at the same time, it may also activate the mitochondrial-related apoptosis signaling pathway, such as by activating the expression of p53, triggering the expression of Bax. The activation of caspase-3 may be due to the direct effect of Cd<sup>2+</sup> on Bax protein, which can subsequently induce mitochondrial membrane permeability with the consequent release of cytochrome c into the cytoplasm. Furthermore, the data also implied that Cd may deplete the level of mitochondrial Bcl-2 protein, and increase both the levels of caspase-3 activity and mRNA in <italic>M. meretrix</italic> ovary, probably partly because of an increase in the amount of ROS. The positive correlations observed between p53 and each of the oxidative damage indexes and apoptosis-related factors (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>) indicated the important role of p53 in mediating Cd<sup>2+</sup>-induced apoptosis in <italic>M. meretrix</italic> ovarian cells.</p>
</sec>
</sec>
<sec id="s5" sec-type="conclusions">
<label>5</label>
<title>Conclusion</title>
<p>In summary, this study demonstrated that cadmium exposure could lead to Cd<sup>2+</sup> accumulation in <italic>M. meretrix</italic> ovary, which ultimately translated into increased oxidative damage as evidenced by the elevated MDA, DPC and PCO levels and the reduced T-AOC level. At higher Cd<sup>2+</sup> concentrations, the capacities of MT and T-AOC were unable to deal with the rising level of ROS to neutralize the Cd<sup>2+</sup> toxicity. In addition to the mounting level of oxidative stress, Cd<sup>2+</sup> also induced apoptosis in <italic>M. meretrix</italic> ovarian cells through both the intrinsic and extrinsic pathways, which involved the induction of <italic>p53</italic> and other apoptosis-related genes. The toxicity sustained by <italic>M. meretrix</italic> ovarian cells implied that clams raised in water polluted by Cd<sup>2+</sup> might lead to a loss of fecundity, adversely affecting fertilization and embryo development, which could eventually translate into an economic loss.</p>
</sec>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding authors.</p>
</sec>
<sec id="s7" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The research article ensures objectivity and transparency in research and secures that accepted principles of ethical and professional conduct have been followed. This original research article does not contain any studies with human participants performed by any of the authors.</p>
</sec>
<sec id="s8" sec-type="author-contributions">
<title>Author contributions</title>
<p>BB and YY were responsible for the experimental design, carrying out the experiments, data processing, and article writing. JW, QZ and MW performed the sample collection, sample processing and extraction. AC and XY provided experimental guidance and supervision. All authors contributed to the article and approved the submitted version.</p>
</sec>
<sec id="s9" sec-type="funding-information">
<title>Funding</title>
<p>This study was supported by the National Natural Science Foundation of China under Grant number 32071514 (to XY), the Nature Science Foundation of Zhejiang Province (CN) under Grant number LY18C030005 (to XY), the Innovation Program of Wenzhou University under Grant number JWXC2021104 (to YY) and the Student Innovation Training Project of Zhejiang province under Grant number 2021R (to JW).</p>
</sec>
<sec id="s10" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s11" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
</body>
<back>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alyahya</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Elgendy</surname> <given-names>A. H.</given-names>
</name>
<name>
<surname>Farraj</surname> <given-names>S. A.</given-names>
</name>
<name>
<surname>Elhedeny</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Evaluation of heavy metal pollution in the arabian gulf using the clam meretrix meretrix linnaeus 1758</article-title>. <source>Water Air Soil Pollut.</source> <volume>214</volume>, <fpage>499</fpage>&#x2013;<lpage>507</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11270-010-0441-x</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Amiard</surname> <given-names>J. C.</given-names>
</name>
<name>
<surname>Amiard-Triquet</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Barka</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Pellerin</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Rainbow</surname> <given-names>P. S.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Metallothioneins in aquatic invertebrates: Their role in metal detoxification and their use as biomarkers</article-title>. <source>Aquat. Toxicol.</source> <volume>76</volume>, <fpage>160</fpage>&#x2013;<lpage>202</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.aquatox.2005.08.015</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Boudet</surname> <given-names>L. N. C.</given-names>
</name>
<name>
<surname>Polizzi</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Romero</surname> <given-names>M. S.</given-names>
</name>
<name>
<surname>Robles</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Marcovecchio</surname> <given-names>J. E.</given-names>
</name>
<name>
<surname>Gerpe</surname> <given-names>M. S.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Histopathological and biochemical evidence of hepatopancreatic toxicity caused by cadmium in white shrimp, <italic>Palaemonetes argentinus.</italic> ecotoxicol</article-title>. <source>Environ. Saf.</source> <volume>113</volume>, <fpage>231</fpage>&#x2013;<lpage>240</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ecoenv.2014.11.019</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brady</surname> <given-names>C. A.</given-names>
</name>
<name>
<surname>Attardi</surname> <given-names>L. D.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>p53 at a glance</article-title>. <source>J. Cell Sci.</source> <volume>123</volume>, <fpage>2527</fpage>&#x2013;<lpage>2532</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1242/jcs.064501</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cao</surname> <given-names>R. W.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Y. L.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Q. Q.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>D. L.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>H.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>The impact of ocean acidification and cadmium on the immune responses of pacific oyster, <italic>Crassostrea gigas</italic>
</article-title>. <source>Fish Shellfish Immunol.</source> <volume>81</volume>, <fpage>456</fpage>&#x2013;<lpage>462</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fsi.2018.07.055</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cao</surname> <given-names>H. B.</given-names>
</name>
<name>
<surname>Xia</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>M. M.</given-names>
</name>
<name>
<surname>Liao</surname> <given-names>Y. L.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>G. L.</given-names>
</name>
<etal/>
</person-group>. (<year>2016</year>). <article-title>Changes of antioxidant function and the mRNA expression levels of apoptosis genes in duck ovaries caused by molybdenum or/and cadmium</article-title>. <source>Biol. Trace Elem. Res.</source> <volume>171</volume>, <fpage>410</fpage>&#x2013;<lpage>418</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s12011-015-0514-1</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cekic</surname> <given-names>S. D.</given-names>
</name>
<name>
<surname>Cetinkaya</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Avan</surname> <given-names>A. N.</given-names>
</name>
<name>
<surname>Apak</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Correlation of total antioxidant capacity with reactive oxygen species (ROS) consumption measured by oxidative conversion</article-title>. <source>J. Agric. Food Chem.</source> <volume>61</volume>, <fpage>5260</fpage>&#x2013;<lpage>5270</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/jf3051297</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cheng</surname> <given-names>C. H.</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>H. L.</given-names>
</name>
<name>
<surname>Deng</surname> <given-names>Y. Q.</given-names>
</name>
<name>
<surname>Feng</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Jie</surname> <given-names>Y. K.</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>Z. X.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Oxidative stress, cell cycle arrest, DNA damage and apoptosis in the mud crab (<italic>Scylla paramamosain</italic>) induced by cadmium exposure</article-title>. <source>Chemosphere</source> <volume>263</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.chemosphere.2020.128277</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>R. Q.</given-names>
</name>
<name>
<surname>Ye</surname> <given-names>F. Y.</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>J. H.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>J. Y.</given-names>
</name>
<name>
<surname>Cai</surname> <given-names>J. J.</given-names>
</name>
<name>
<surname>Ying</surname> <given-names>X. P.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Effects of cadmium and mercury on oxidative stress indexes in the ovary of <italic>Eriocheir sinensis</italic>
</article-title>. <source>Acta Hydrobiologica Sin.</source> <volume>43</volume>, <fpage>554</fpage>&#x2013;<lpage>562</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.7541/2019.067</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>M. X.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>J. Y.</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>J. H.</given-names>
</name>
<name>
<surname>Tang</surname> <given-names>H. C.</given-names>
</name>
<name>
<surname>Shan</surname> <given-names>Y. F.</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>A. K.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Changes in oxidative stress biomarkers in <italic>Sinonovacula constricta</italic> in response to toxic metal accumulation during growth in an aquaculture farm</article-title>. <source>Chemosphere</source> <volume>248</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.chemosphere.2020.125974</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>da Costa</surname> <given-names>C. S.</given-names>
</name>
<name>
<surname>Oliveira</surname> <given-names>T. F.</given-names>
</name>
<name>
<surname>Freitas-Lima</surname> <given-names>L. C.</given-names>
</name>
<name>
<surname>Padilha</surname> <given-names>A. S.</given-names>
</name>
<name>
<surname>Krause</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Carneiro</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Subacute cadmium exposure disrupts the hypothalamic-pituitary-gonadal axis, leading to polycystic ovarian syndrome and premature ovarian failure features in female rats</article-title>. <source>Environ. Pollut.</source> <volume>269</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.envpol.2020.116154</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Das</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Mukherjee</surname> <given-names>D.</given-names>
</name>
</person-group>. (<year>2013</year>). <article-title>Effect of cadmium chloride on secretion of 17 beta-estradiol by the ovarian follicles of common carp, Cyprinus carpio</article-title>. <source>Gen. Comp. Endocr.</source> <volume>181</volume>, <page-range>107&#x2013;114</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ygcen.2012.10.010</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Elmore</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Apoptosis: A review of programmed cell death</article-title>. <source>Toxicol. Pathol.</source> <volume>35</volume>, <fpage>495</fpage>&#x2013;<lpage>516</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/01926230701320337</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fedorova</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Bollineni</surname> <given-names>R. C.</given-names>
</name>
<name>
<surname>Hoffmann</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Protein carbonylation as a major hallmark of oxidative damage: update of analytical strategies</article-title>. <source>Mass Spectrom. Rev.</source> <volume>33</volume>, <fpage>79</fpage>&#x2013;<lpage>97</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/mas.21381</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fleeger</surname> <given-names>J. W.</given-names>
</name>
<name>
<surname>Carman</surname> <given-names>K. R.</given-names>
</name>
<name>
<surname>Nisbet</surname> <given-names>R. M.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Indirect effects of contaminants in aquatic ecosystems</article-title>. <source>Sci. Total Environ.</source> <volume>317</volume>, <fpage>207</fpage>&#x2013;<lpage>233</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/s0048-9697(03)00141-4</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gao</surname> <given-names>Y. L.</given-names>
</name>
<name>
<surname>Hong</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>Y. K.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>M. X.</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>A. K.</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>L.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Assessment spermatogenic cell apoptosis and the transcript levels of metallothionein and p53 in <italic>Meretrix meretrix</italic> induced by cadmium. ecotoxicol</article-title>. <source>Environ. Saf.</source> <volume>217</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ecoenv.2021.112230</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Garriz</surname> <given-names>A.</given-names>
</name>
<name>
<surname>del Fresno</surname> <given-names>P. S.</given-names>
</name>
<name>
<surname>Carriquiriborde</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Miranda</surname> <given-names>L. A.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Effects of heavy metals identified in chascomus shallow lake on the endocrine-reproductive axis of pejerrey fish (<italic>Odontesthes bonariensis</italic>)</article-title>. <source>Gen. Comp. Endocr.</source> <volume>273</volume>, <fpage>152</fpage>&#x2013;<lpage>162</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ygcen.2018.06.013</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gu</surname> <given-names>B. N.</given-names>
</name>
<name>
<surname>Liang</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>T. Z.</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>Z. J.</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>H. D.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Metallothionein, hemocyte status and superoxide dismutase/aspartate aminotransferase activity are sensitive biomarkers of cadmium stress in <italic>Onchidium reevesii.</italic> aquat</article-title>. <source>Toxicol</source> <volume>215</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.aquatox.2019.105284</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname> <given-names>M. Y.</given-names>
</name>
<name>
<surname>Su</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>L. M.</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>L. L.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Z. W.</given-names>
</name>
<name>
<surname>Duan</surname> <given-names>R. Y.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Effect of exogenous TGF-beta 1 on the cadmium-induced nephrotoxicity by inhibiting apoptosis of proximal tubular cells through PI3K-AKT-mTOR signaling pathway</article-title>. <source>Chem. Biol. Interact.</source> <volume>269</volume>, <fpage>25</fpage>&#x2013;<lpage>32</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cbi.2017.03.010</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Tang</surname> <given-names>H. C.</given-names>
</name>
<name>
<surname>Jin</surname> <given-names>J. Y.</given-names>
</name>
<name>
<surname>Fan</surname> <given-names>M. B.</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>A. K.</given-names>
</name>
<name>
<surname>Ying</surname> <given-names>X. P.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Effects of waterborne cadmium exposure on its internal distribution in <italic>Meretrix meretrix</italic> and detoxification by metallothionein and antioxidant enzymes</article-title>. <source>Front. Mar. Sci.</source> <volume>7</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmars.2020.00502</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ikeh-Tawari</surname> <given-names>E. P.</given-names>
</name>
<name>
<surname>Anetor</surname> <given-names>J. I.</given-names>
</name>
<name>
<surname>Charles-Davies</surname> <given-names>M. A.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Cadmium level in pregnancy, influence on neonatal birth weight and possible amelioration by some essential trace elements</article-title>. <source>Toxicol. Int.</source> <volume>20</volume>, <fpage>108</fpage>&#x2013;<lpage>112</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.4103/0971-6580.111558</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jena</surname> <given-names>N. R.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>DNA Damage by reactive species: Mechanisms, mutation and repair</article-title>. <source>J. Biosci.</source> <volume>37</volume>, <fpage>503</fpage>&#x2013;<lpage>517</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s12038-012-9218-2</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Srivastava</surname> <given-names>S. K.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>S. H.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Caspase-9 as a therapeutic target for treating cancer</article-title>. <source>Expert Opin. Ther. Tar.</source> <volume>19</volume>, <fpage>113</fpage>&#x2013;<lpage>127</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1517/14728222.2014.961425</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kumar</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Caspase function in programmed cell death</article-title>. <source>Cell Death Differ.</source> <volume>14</volume>, <fpage>32</fpage>&#x2013;<lpage>43</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/sj.cdd.4402060</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kurochkin</surname> <given-names>I. O.</given-names>
</name>
<name>
<surname>Etzkorn</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Buchwalter</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Leamy</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Sokolova</surname> <given-names>I. M.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Top-down control analysis of the cadmium effects on molluscan mitochondria and the mechanisms of cadmium-induced mitochondrial dysfunction</article-title>. <source>Am. J. Physiol. Regul. Integr. Comp. Physiol.</source> <volume>300</volume>, <fpage>R21</fpage>&#x2013;<lpage>R31</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1152/ajpregu.00279.2010</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>J. J.</given-names>
</name>
<name>
<surname>Dahms</surname> <given-names>H. U.</given-names>
</name>
<name>
<surname>Zhen</surname> <given-names>J. J.</given-names>
</name>
<name>
<surname>Ying</surname> <given-names>X. P.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Cell damage and apoptosis in the hepatopancreas of <italic>Eriocheir sinensis</italic> induced by cadmium</article-title>. <source>Aquat. Toxicol.</source> <volume>190</volume>, <fpage>190</fpage>&#x2013;<lpage>198</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.aquatox.2017.07.008</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Livak</surname> <given-names>K. J.</given-names>
</name>
<name>
<surname>Schmittgen</surname> <given-names>T. D.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-delta delta c) method</article-title>. <source>Methods</source> <volume>25</volume>, <fpage>402</fpage>&#x2013;<lpage>408</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1006/meth.2001.1262</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luo</surname> <given-names>Y. J.</given-names>
</name>
<name>
<surname>Shan</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Zhong</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>W. Z.</given-names>
</name>
<name>
<surname>Cao</surname> <given-names>J. L.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Subchronic effects of cadmium on the gonads, expressions of steroid hormones and sex-related genes in tilapia <italic>Oreochromis niloticus</italic>
</article-title>. <source>Ecotoxicology</source> <volume>24</volume>, <fpage>2213</fpage>&#x2013;<lpage>2223</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10646-015-1542-5</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Matovic</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Buha</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Dukic-Cosic</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Bulat</surname> <given-names>Z.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Insight into the oxidative stress induced by lead and/or cadmium in blood, liver and kidneys</article-title>. <source>Food Chem. Toxicol.</source> <volume>78</volume>, <fpage>130</fpage>&#x2013;<lpage>140</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/jict.2015.02.011</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nunez-Nogueira</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Fernandez-Bringas</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Ordiano-Flores</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Gomez-Ponce</surname> <given-names>A.</given-names>
</name>
<name>
<surname>de Leon-Hill</surname> <given-names>C. P.</given-names>
</name>
<name>
<surname>Gonzalez-Farias</surname> <given-names>F.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Accumulation and regulation effects from the metal mixture of zn, Pb, and cd in the tropical shrimp <italic>Penaeus vannamei.</italic> biol</article-title>. <source>Trace Elem. Res.</source> <volume>150</volume>, <fpage>208</fpage>&#x2013;<lpage>213</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s12011-012-9500-z</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ostrakhovitch</surname> <given-names>E. A.</given-names>
</name>
<name>
<surname>Song</surname> <given-names>Y. P.</given-names>
</name>
<name>
<surname>Cherian</surname> <given-names>M. G.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Basal and copper-induced expression of metallothionein isoform 1,2 and 3 genes in epithelial cancer cells: The role of tumor suppressor p53</article-title>. <source>J. Trace Elem. Med. Biol.</source> <volume>35</volume>, <fpage>18</fpage>&#x2013;<lpage>29</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jtemb.2016.01.008</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Patel</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Chauhan</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Shahane</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Rai</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Ali Khan</surname> <given-names>M. Z.</given-names>
</name>
<name>
<surname>Mishra</surname> <given-names>U.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). &#x201c;<article-title>Contamination and health impact of heavy metals</article-title>,&#x201d; in <source>Water pollution and remediation: Heavy metals</source>. Eds. <person-group person-group-type="editor">
<name>
<surname>Inamuddin</surname>
</name>
<name>
<surname>Ahamed</surname> <given-names>M. I.</given-names>
</name>
<name>
<surname>Lichtfouse</surname> <given-names>E.</given-names>
</name>
</person-group> (<publisher-loc>Cham</publisher-loc>: <publisher-name>Springer International Publishing</publisher-name>), <fpage>259</fpage>&#x2013;<lpage>280</lpage>.</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ren</surname> <given-names>X. Y.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Bioaccumulation and physiological responses in juvenile <italic>Marsupenaeus japonicus</italic> exposed to cadmium</article-title>. <source>Aquat. Toxicol.</source> <volume>214</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.aquatox.2019.105255</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Revathi</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Vasanthi</surname> <given-names>L. A.</given-names>
</name>
<name>
<surname>Munuswamy</surname> <given-names>N.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Effect of cadmium on the ovarian development in the freshwater prawn <italic>Macrobrachium rosenbergii</italic> (De man)</article-title>. <source>Ecotoxicol. Environ. Saf.</source> <volume>74</volume>, <fpage>623</fpage>&#x2013;<lpage>629</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ecoenv.2010.08.027</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sarban</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Kocyigit</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Yazar</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Isikan</surname> <given-names>U. E.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Plasma total antioxidant capacity, lipid peroxidation, and erythrocyte antioxidant enzyme activities in patients with rheumatoid arthritis and osteoarthritis</article-title>. <source>Clin. Biochem.</source> <volume>38</volume>, <fpage>981</fpage>&#x2013;<lpage>986</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.clinbiochem.2005.08.003</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sevcikova</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Modra</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Slaninova</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Svobodova</surname> <given-names>Z.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Metals as a cause of oxidative stress in fish: A review</article-title>. <source>Vet. Med-Czech</source> <volume>56</volume>, <fpage>537</fpage>&#x2013;<lpage>546</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.17221/4272-vetmed</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname> <given-names>J. X.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>S. C.</given-names>
</name>
<name>
<surname>Cao</surname> <given-names>Y. R.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>S. T.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Cadmium exposure induces apoptosis, inflammation and immunosuppression through CYPs activation and antioxidant dysfunction in common carp neutrophils</article-title>. <source>Fish Shellfish Immunol.</source> <volume>99</volume>, <fpage>284</fpage>&#x2013;<lpage>290</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fsi.2020.02.015</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Szczerbik</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Mikolajczyk</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Sokolowska-Mikolajczyk</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Socha</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Chyb</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Epler</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Influence of long-term exposure to dietary cadmium on growth, maturation and reproduction of goldfish (subspecies: Prussian carp <italic>Carassius auratus gibelio</italic> b.)</article-title>. <source>Aquat. Toxicol.</source> <volume>77</volume>, <fpage>126</fpage>&#x2013;<lpage>135</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.aquatox.2005.11.005</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Thompson</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Bannigan</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Cadmium: Toxic effects on the reproductive system and the embryo</article-title>. <source>Reprod. Toxicol.</source> <volume>25</volume>, <fpage>304</fpage>&#x2013;<lpage>315</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.reprotox.2008.02.001</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tirani</surname> <given-names>M. M.</given-names>
</name>
<name>
<surname>Haghjou</surname> <given-names>M. M.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Reactive oxygen species (ROS), total antioxidant capacity (AOC) and malondialdehyde (MDA) make a triangle in evaluation of zinc stress extension</article-title>. <source>J. Anim. Plant Sci-Pak.</source> <volume>29</volume>, <fpage>1100</fpage>&#x2013;<lpage>1111</lpage>.</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tummers</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Green</surname> <given-names>D. R.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Caspase-8: regulating life and death</article-title>. <source>Immunol. Rev.</source> <volume>277</volume>, <fpage>76</fpage>&#x2013;<lpage>89</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/imr.12541</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>J. H.</given-names>
</name>
<name>
<surname>Deng</surname> <given-names>W. F.</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Bai</surname> <given-names>B. B.</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>A. K.</given-names>
</name>
<name>
<surname>Ying</surname> <given-names>X. P.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Cadmium-induced oxidative stress in <italic>Meretrix meretrix</italic> gills leads to mitochondria-mediated apoptosis</article-title>. <source>Ecotoxicology</source> <volume>30</volume>, <fpage>2011</fpage>&#x2013;<lpage>2023</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10646-021-02465-8</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>G. W.</given-names>
</name>
<name>
<surname>Klein</surname> <given-names>J. B.</given-names>
</name>
<name>
<surname>Kang</surname> <given-names>Y. J.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Metallothionein inhibits doxorubicin-induced mitochondrial cytochrome c release and caspase-3 activation in cardiomyocytes</article-title>. <source>J. Pharmacol. Exp. Ther.</source> <volume>298</volume>, <fpage>461</fpage>&#x2013;<lpage>468</lpage>.</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Lei</surname> <given-names>W. W.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>D. M.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y. J.</given-names>
</name>
<name>
<surname>Xuan</surname> <given-names>R. J.</given-names>
</name>
<etal/>
</person-group>. (<year>2011</year>). <article-title>Cadmium-induced oxidative stress and apoptotic changes in the testis of freshwater crab, <italic>Sinopotamon henanense</italic>
</article-title>. <source>PloS One</source> <volume>6</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0027853</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>S. M.</given-names>
</name>
<name>
<surname>Jong</surname> <given-names>K. J.</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>Y. J.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Relationships among metallothionein, cadmium accumulation, and cadmium tolerance in three species of fish</article-title>. <source>Bull. Environ. Contam. Toxicol.</source> <volume>76</volume>, <fpage>595</fpage>&#x2013;<lpage>600</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00128-006-0961-7</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>S. M.</given-names>
</name>
<name>
<surname>Tsai</surname> <given-names>P. J.</given-names>
</name>
<name>
<surname>Chou</surname> <given-names>M. Y.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>W. D.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Effects of maternal cadmium exposure on female reproductive functions, gamete quality, and offspring development in zebrafish (<italic>Danio rerio</italic>)</article-title>. <source>Arch. Environ. Contam. Toxicol.</source> <volume>65</volume>, <fpage>521</fpage>&#x2013;<lpage>536</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00244-013-9909-1</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>S. M.</given-names>
</name>
<name>
<surname>Tsai</surname> <given-names>P. R.</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>C. J.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Maternal cadmium exposure induces mt2 and smtB mRNA expression in zebrafish (<italic>Danio rerio</italic>) females and their offspring</article-title>. <source>Comp. Biochem. Physiol. C Toxicol. Pharmacol.</source> <volume>156</volume>, <fpage>1</fpage>&#x2013;<lpage>6</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cbpc.2012.02.001</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xia</surname> <given-names>L. P.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>S. H.</given-names>
</name>
<name>
<surname>Dahms</surname> <given-names>H. U.</given-names>
</name>
<name>
<surname>Ying</surname> <given-names>X. P.</given-names>
</name>
<name>
<surname>Peng</surname> <given-names>X.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Cadmium induced oxidative damage and apoptosis in the hepatopancreas of <italic>Meretrix meretrix</italic>
</article-title>. <source>Ecotoxicology</source> <volume>25</volume>, <fpage>959</fpage>&#x2013;<lpage>969</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10646-016-1653-7</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xie</surname> <given-names>J. F.</given-names>
</name>
<name>
<surname>Fan</surname> <given-names>R. J.</given-names>
</name>
<name>
<surname>Meng</surname> <given-names>Z. Q.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Protein oxidation and DNA-protein crosslink induced by sulfur dioxide in lungs, livers, and hearts from mice</article-title>. <source>Inhal. Toxicol.</source> <volume>19</volume>, <fpage>759</fpage>&#x2013;<lpage>765</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/08958370701399885</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Xi</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Mao</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Oxidative stress induced by acute and sub-chronic cadmium exposure in the ovaries of the freshwater crab <italic>Sinopotamon henanense</italic> (DAI 1975)</article-title>. <source>Crustaceana</source> <volume>89</volume>, <fpage>1041</fpage>&#x2013;<lpage>1055</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1163/15685403-00003573</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname> <given-names>Y. R.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>W. X.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Roles of three Es-caspases during spermatogenesis and cadmium-induced apoptosis in <italic>Eriocheir sinensis</italic>
</article-title>. <source>Aging-Us</source> <volume>10</volume>, <fpage>1146</fpage>&#x2013;<lpage>1165</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.18632/aging.101454</pub-id>
</citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yamada</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Yoshida</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Mechanical insights into the regulation of programmed cell death by p53 <italic>via</italic> mitochondria</article-title>. <source>Biochim. Biophys. Acta Mol. Cell Res.</source> <volume>1866</volume>, <fpage>839</fpage>&#x2013;<lpage>848</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bbamcr.2019.02.009</pub-id>
</citation>
</ref>
<ref id="B53">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>Q. S.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>X. J.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>X. J.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>W. P.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Inhibition of cytoskeletal protein carbonylation may protect against oxidative damage in traumatic brain injury</article-title>. <source>Exp. Ther. Med.</source> <volume>12</volume>, <fpage>4107</fpage>&#x2013;<lpage>4112</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3892/etm.2016.3889</pub-id>
</citation>
</ref>
<ref id="B54">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhan</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Ji</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Global characterization of dose-dependent effects of cadmium in clam <italic>Ruditapes philippinarum</italic>
</article-title>. <source>Environ. Pollut. (Barking Essex: 1987)</source> <volume>273</volume>, <fpage>116443</fpage>&#x2013;<lpage>116443</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.envpol.2021.116443</pub-id>
</citation>
</ref>
<ref id="B55">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zheng</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Zhuo</surname> <given-names>L. L.</given-names>
</name>
<name>
<surname>Ran</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>Y. G.</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>T. W.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>H. Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Cadmium induces apoptosis <italic>via</italic> generating reactive oxygen species to activate mitochondrial p53 pathway in primary rat osteoblasts</article-title>. <source>Toxicology</source> <volume>446</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.tox.2020.152611</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>