<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.3 20210610//EN" "JATS-journalpublishing1-3-mathml3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="1.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title-group>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
</journal-title-group>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2026.1757174</article-id>
<article-version article-version-type="Version of Record" vocab="NISO-RP-8-2008"/>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Original Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Engineering of induced pluripotent stem cells for the efficient development of non-alloreactive, hypoimmunogenic CD8&#x3b1;&#x3b2; CAR-T cells</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name><surname>Nianias</surname><given-names>Alexandros</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="author-notes" rid="fn003"><sup>&#x2020;</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis/">Formal analysis</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name><surname>Katsarou</surname><given-names>Afroditi</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="author-notes" rid="fn003"><sup>&#x2020;</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis/">Formal analysis</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Prins</surname><given-names>Henk Jan</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/3300179/overview"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis/">Formal analysis</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Shahrabi</surname><given-names>Aida</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
<contrib contrib-type="author">
<name><surname>van Velzen</surname><given-names>Cindy</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Henneman</surname><given-names>Linda</given-names></name>
<xref ref-type="aff" rid="aff3"><sup>3</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Ruiter</surname><given-names>Ruud</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Mutis</surname><given-names>Tuna</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/888428/overview"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition/">Funding acquisition</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project-administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration/">Project administration</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="resources" vocab-term-identifier="https://credit.niso.org/contributor-roles/resources/">Resources</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision/">Supervision</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Groen</surname><given-names>Richard</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition/">Funding acquisition</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project-administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration/">Project administration</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="resources" vocab-term-identifier="https://credit.niso.org/contributor-roles/resources/">Resources</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision/">Supervision</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Themeli</surname><given-names>Maria</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="corresp" rid="c001"><sup>*</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/1693971/overview"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/conceptualization/">Conceptualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis/">Formal analysis</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition/">Funding acquisition</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project-administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration/">Project administration</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="resources" vocab-term-identifier="https://credit.niso.org/contributor-roles/resources/">Resources</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="software" vocab-term-identifier="https://credit.niso.org/contributor-roles/software/">Software</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision/">Supervision</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization/">Visualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
</contrib-group>
<aff id="aff1"><label>1</label><institution>Amsterdam University Medical Centers (UMC) location Vrije Universiteit Amsterdam, Departement of Hematology</institution>, <city>Amsterdam</city>,&#xa0;<country country="nl">Netherlands</country></aff>
<aff id="aff2"><label>2</label><institution>Cancer Center Amsterdam, Cancer Biology and Immunology</institution>, <city>Amsterdam</city>,&#xa0;<country country="nl">Netherlands</country></aff>
<aff id="aff3"><label>3</label><institution>Animal Modeling Facility, Netherlands Cancer Institute</institution>, <city>Amsterdam</city>,&#xa0;<country country="nl">Netherlands</country></aff>
<author-notes>
<corresp id="c001"><label>*</label>Correspondence: Maria Themeli, <email xlink:href="mailto:m.themeli@amsterdamumc.nl">m.themeli@amsterdamumc.nl</email></corresp>
<fn fn-type="equal" id="fn003">
<label>&#x2020;</label>
<p>These authors have contributed equally to this work and share first authorship</p></fn>
</author-notes>
<pub-date publication-format="electronic" date-type="pub" iso-8601-date="2026-02-20">
<day>20</day>
<month>02</month>
<year>2026</year>
</pub-date>
<pub-date publication-format="electronic" date-type="collection">
<year>2026</year>
</pub-date>
<volume>17</volume>
<elocation-id>1757174</elocation-id>
<history>
<date date-type="received">
<day>29</day>
<month>11</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>28</day>
<month>01</month>
<year>2026</year>
</date>
<date date-type="rev-recd">
<day>27</day>
<month>01</month>
<year>2026</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2026 Nianias, Katsarou, Prins, Shahrabi, van Velzen, Henneman, Ruiter, Mutis, Groen and Themeli.</copyright-statement>
<copyright-year>2026</copyright-year>
<copyright-holder>Nianias, Katsarou, Prins, Shahrabi, van Velzen, Henneman, Ruiter, Mutis, Groen and Themeli</copyright-holder>
<license>
<ali:license_ref start_date="2026-02-20">https://creativecommons.org/licenses/by/4.0/</ali:license_ref>
<license-p>This is an open-access article distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License (CC BY)</ext-link>. The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</license-p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>Induced pluripotent stem cells (iPSCs) are a promising platform to produce &#x201c;off-the-shelf&#x201d; chimeric antigen receptor (CAR)-engineered T cells (CAR-T) with thepotential for multiplex genetic engineering.</p>
</sec>
<sec>
<title>Methods</title>
<p>Here, we employed genome editing to knock out the TRAC and B2M genes in iPSC lines, while simultaneously harnessing the edited loci to introduce a drug-inducible CAR and the human leukocyte antigen (HLA)-E single chain trimer.</p>
</sec>
<sec>
<title>Results</title>
<p>The inducible CAR expression allowed the robust generation of T-cell receptor (TCR)-negative CD8ab+ CAR-T cells with demonstrable anti-tumor efficacy and lack of alloreactivity. HLA-class Inegative, HLA-Epositive CD8 CAR-T cells were protected against immune rejection; however, disruption of B2M resulted in genomic instability and affected the efficiency of T-cell development and the functionality of the generated T cells.</p>
</sec>
<sec>
<title>Discussion</title>
<p>Facilitating multiplex engineering at well-characterized genomic loci and regulation of possible developmental effects will empower the use of engineered iPSC as a viable method to efficiently produce &#x201c;off-the-shelf&#x201d; CART cells.</p>
</sec>
</abstract>
<kwd-group>
<kwd>allogeneic</kwd>
<kwd>CAR-T cell therapy</kwd>
<kwd>chimeric antigen receptor</kwd>
<kwd>hypoimmunogenic</kwd>
<kwd>induced pluripotent stem cells</kwd>
</kwd-group>
<funding-group>
<funding-statement>The author(s) declared that financial support was received for this work and/or its publication. This work was conducted with the financial support of the Dutch Cancer Society grant KWF #11811 to MT; the European Commission with MSCA Individual Fellowship grant (H2020-MSCA-IF-2014-658490) to MT; AND the Emerging Investigators EHA-EBMT Joint Fellowship Award to MT and AN.</funding-statement>
</funding-group>
<counts>
<fig-count count="6"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="39"/>
<page-count count="17"/>
<word-count count="11330"/>
</counts>
<custom-meta-group>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>T Cell Biology</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>The clinical success of cell therapy with chimeric antigen receptor (CAR)-engineered T (CAR T) cells against hematological malignancies opens up new avenues for the further exploitation of this breakthrough therapy for more patients and additional diseases. Unfortunately, the rapid development of CAR-T cell therapy has also revealed important challenges that limit the feasibility of cost-effective, easier, and broader application. Current CAR-T cell manufacturing is time-consuming and the required vein-to-vein processing time can be critical in cases of rapid disease progression. Furthermore, the isolation, genetic modification, and expansion of autologous T cells is, in many cases, technically challenging and leads sometimes to production failure (<xref ref-type="bibr" rid="B1">1</xref>). In addition, the quality of the patient-derived, apheresis product is highly variable, as it depends on the type and stage of the disease, previous therapies, and immune cell composition (<xref ref-type="bibr" rid="B1">1</xref>&#x2013;<xref ref-type="bibr" rid="B3">3</xref>). The use of allogeneic healthy donor-derived T cells can be an alternative, readily available source of CAR-T cells. However, their use requires substantial genome engineering to avoid graft-versus-host disease (GvHD) and graft rejection (<xref ref-type="bibr" rid="B4">4</xref>&#x2013;<xref ref-type="bibr" rid="B6">6</xref>). Ensuring sufficient production yield of safe, primary allogeneic CAR-T cells with consistent functional properties after multiplex genetic engineering is still challenging (<xref ref-type="bibr" rid="B7">7</xref>).</p>
<p>To overcome the aforementioned issues, induced pluripotent stem cells (iPSCs) have been proposed as an alternative and perpetual source of therapeutic CAR-T cells (<xref ref-type="bibr" rid="B8">8</xref>). iPSC&#x2019;s unlimited self-renewal capacity allows for long-term use and theoretically endless genetic modifications in order to accommodate all the desirable characteristics for their T-cell derivatives (iT), such as tumor specificity, improved efficacy, and reduced immunogenicity. In contrast to primary T cells, fully modified clonal iPSC lines can be selected and extensively evaluated, resulting in a stable, scalable, and safe source of CAR-T cells (<xref ref-type="bibr" rid="B9">9</xref>).</p>
<p>Previously, T cell-derived iPSCs (T-iPSCs) were engineered to express a CD19-targeting CAR and differentiated to functional CD19-specific T-iPSC-derived CAR-T cells (CAR-iT) (<xref ref-type="bibr" rid="B10">10</xref>). However, phenotypic, functional, and transcriptional analysis revealed that the CAR-iT cells were rather CD8&#x3b1;&#x3b2;<sup>&#x2212;</sup>CD4<sup>&#x2212;</sup> double-negative (DN) or CD8&#x3b1;&#x3b1; single-positive (SP), resembling more to innate cells than mature CD8 or CD4 T cells (<xref ref-type="bibr" rid="B10">10</xref>, <xref ref-type="bibr" rid="B11">11</xref>). According to the physiological model of T-cell development, a critical step to obtain mature CD8&#x3b1;&#x3b2;<sup>+</sup> T cells is the process of &#x3b2;-selection and the emergence of CD4<sup>+</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> double-positive (DP) cells (<xref ref-type="bibr" rid="B12">12</xref>). Recently, van der Stegen et&#xa0;al. showed that the lineage skewing in CAR-iT cells can be attributed to premature expression of the endogenous TCR as well as the constitutively expressed CAR (<xref ref-type="bibr" rid="B13">13</xref>). The efficient transition of CAR-engineered T-iPSC-derived lymphoid progenitors to &#x3b2;-selection is partially restored by the absence of a TCR, the timely CAR expression driven by the endogenous TCR&#x3b1; promoter, and a calibrated CAR signaling (<xref ref-type="bibr" rid="B13">13</xref>).</p>
<p>To ensure the broad applicability of CAR-iT cells, genetic modifications need to be applied to guarantee their safe use on an allogeneic basis. Apart from facilitating the development of mature CAR-iT cells, TCR silencing warrants the absence of graft-versus-host reactivity. Furthermore, hypoimmunogenic pluripotent stem cell (PSC) lines can be generated by the elimination of HLA class I and II expression through the disruption of <italic>B2M</italic> and <italic>CIITA</italic> genes, respectively (<xref ref-type="bibr" rid="B14">14</xref>). Additionally, introduction of non-classical HLA class I molecules (HLA-E and HLA-G) or patient-specific HLA-C and genetic knockout of NK cell activating ligands (CD155, B7-H3) have been shown to reduce NK-mediated rejection of iPSC-derived cellular products (<xref ref-type="bibr" rid="B15">15</xref>&#x2013;<xref ref-type="bibr" rid="B17">17</xref>).</p>
<p>In this study, we used CRISPR-mediated genome editing to engineer TCR<sup>negative</sup> and HLA class I<sup>negative</sup> T-iPSC lines by knocking out the <italic>TRAC</italic> and <italic>&#x3b2;2m</italic> genes. The 4 alleles of these edited loci were successfully harnessed to introduce transgenes of interest, such as an inducible CD38-CAR expression cassette and an HLA-E single chain trimer (HLA-E SCT) (<xref ref-type="bibr" rid="B18">18</xref>). We demonstrate that expression of the CAR at a more &#x201c;physiological&#x201d; developmental stage can overcome the issues of misplaced CAR signaling and allow the efficient generation of non-alloreactive CD38CAR-iT cells, which successfully controlled tumor growth <italic>in vivo</italic>. Disruption of <italic>B2M</italic> and HLA-E SCT insertion not only protected CAR-iT against T cell- and NK cell-mediated rejection, but also led to the expansion of chromosomally unstable T-iPSCs, the decreased efficiency of iT cell development, and the reduced expansion of CAR-iT cells.</p>
</sec>
<sec id="s2" sec-type="results">
<title>Results</title>
<sec id="s2_1">
<title>Generation of <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup> T-iPSC clones engineered with an inducible CAR</title>
<p>In order to facilitate the development of mature CAR-iT cells and ensure the absence of alloreactivity, we used CRISPR to knock out the <italic>TCR&#x3b1;</italic> chain by targeting the exon 1 of the <italic>TRAC</italic> locus of an established T-iPSC line with demonstrated potential to generate iT cells <italic>in vitro</italic> (T-iPSC 1.5, <xref ref-type="table" rid="T1"><bold>Table&#xa0;1</bold></xref>) (<xref ref-type="bibr" rid="B10">10</xref>) (<xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1A</bold></xref>). We hypothesized that temporal induction of CAR expression in the DP cells will facilitate efficient production of mature CD8&#x3b1;&#x3b2;<sup>+</sup> T cells. To investigate this, we used a doxycycline (dox)-inducible Tet-On system to control the expression of a second-generation CD38-CAR (<xref ref-type="bibr" rid="B19">19</xref>). We used homologous recombination and simultaneously inserted the elements of the Tet-On inducible CAR (indCAR) expression (<xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1A</bold></xref>). Briefly, one template encoded the constitutive expression of green fluorescent protein (GFP) and reverse tetracycline-controlled transactivator (rtTA) and the other template encoded the doxycycline-inducible expression of mCherry and the CD38-CAR. Eleven T-iPSC clones were selected based on GFP expression (clones GFP1-11), eight of which were further assessed by PCR for bi-allelic targeting of the <italic>TRAC</italic> locus (<xref ref-type="table" rid="T2"><bold>Table&#xa0;2</bold></xref>). Three of these clones, GFP1, GFP4, and GFP9 (<xref ref-type="table" rid="T1"><bold>Table&#xa0;1</bold></xref>), were verified to be targeted in both alleles with an insertion (<xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1B</bold></xref> and <xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figure S1</bold></xref>) and contained both the GFP and mCherry transgenes (<xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1C</bold></xref> and <xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figure S2</bold></xref>), indicating that each template has been inserted in a separate <italic>TRAC</italic> allele. Southern blot analysis confirmed a single copy insertion of every template in each of the 2 alleles of the <italic>TRAC</italic> locus (<xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1D</bold></xref> and <xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figures S3A, B</bold></xref>). After treatment with dox, the induction of mCherry expression (<xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1E</bold></xref>) and the indCAR expression were confirmed in protein level (<xref ref-type="fig" rid="f1"><bold>Figures&#xa0;1F, G</bold></xref> and <xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figure S4</bold></xref>). TCR&#x3b1;<sup>&#x2212;/&#x2212;</sup> indCAR T-iPSC displayed an intact chromosomal pattern (<xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figure S5</bold></xref>). Using the same strategy, we also generated <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup> T-iPSC with an inducible CD19-CAR (data not shown).</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Names of iPSC lines and passages at the time of generation.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">iPSC line</th>
<th valign="middle" align="center">Work passage number</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">1.5</td>
<td valign="middle" align="left">22</td>
</tr>
<tr>
<td valign="middle" align="left">1.5 GFP1</td>
<td valign="middle" align="left">33</td>
</tr>
<tr>
<td valign="middle" align="left">1.5 GFP4</td>
<td valign="middle" align="left">32</td>
</tr>
<tr>
<td valign="middle" align="left">1.5 GFP9</td>
<td valign="middle" align="left">31</td>
</tr>
<tr>
<td valign="middle" align="left">1.5 GFP9BFP2.1</td>
<td valign="middle" align="left">47</td>
</tr>
<tr>
<td valign="middle" align="left">1.5 GFP9BFP2.3</td>
<td valign="middle" align="left">47</td>
</tr>
<tr>
<td valign="middle" align="left">1.5 BFP2.1</td>
<td valign="middle" align="left">31</td>
</tr>
<tr>
<td valign="middle" align="left">1.5 B2MKO</td>
<td valign="middle" align="left">31</td>
</tr>
<tr>
<td valign="middle" align="left">1.5&#x2013;19 G8</td>
<td valign="middle" align="left">43</td>
</tr>
</tbody>
</table>
</table-wrap>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Generation of TCR&#x3b1;<sup>&#x2212;/&#x2212;</sup>T-iPSC clones bearing an inducible CAR. <bold>(A)</bold> Schematic strategy of CRISPR/Cas9-mediated bi-allelic disruption of the TRAC locus and insertion of indCD38CAR by homologous recombination. Arrows show the position of the double-strand break at the beginning of exon 1. <bold>(B)</bold> PCR for verification of bi-allelic donor plasmid integration. Arrows indicate the size of the insert template or of the original sequence. <bold>(C)</bold> Confirmation by PCR of the insertion of the GFP and the mCherry carrying donor cassettes. <bold>(D)</bold> Southern blot analysis for target-specific integration of donor templates using molecular probes for GFP and mCherry sequences after digestion with BamHI <bold>(E)</bold> Representative fluorescence microscopy images showing expression of GFP and mCherry of T-iPSC 1.5 GFP9 colonies before and after dox treatment for 48 h. Scale bar, 400 &#x3bc;m. <bold>(F)</bold> Western blot for CAR detection upon dox treatment on GFP9 T-iPSC clone. Actin was used as reference gene. <bold>(G)</bold> Detection of the CD38CAR surface expression after the addition of dox on GFP9 T-iPSC by staining with an anti-human F(ab&#x2032;)<sub>2</sub> antibody.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1757174-g001.tif">
<alt-text content-type="machine-generated">Panel A displays schematic diagrams of gene editing designs for inserting GFP or mCherry with donor plasmids into the TRAC gene. Panel B shows agarose gel electrophoresis results indicating successful insertions versus wild type bands in cell clones. Panel C presents PCR results confirming targeted integration for both GFP and mCherry groups. Panel D includes gene maps with probe locations and Southern blot images validating integration for GFP and mCherry constructs. Panel E provides fluorescence microscopy images showing GFP expression and dox-induced mCherry signal in cell colonies, along with merged overlays. Panel F presents a Western blot showing dox-dependent CD38-28&#x3b6; expression and actin loading control. Panel G displays a flow cytometry histogram demonstrating increased CD38-CAR expression in GFP9 cells after doxycycline treatment.</alt-text>
</graphic></fig>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Oligonucleotide sequences used for genome editing and molecular verification.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Oligonucleotide</th>
<th valign="middle" align="center">Sequence</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">TRAC gRNA</td>
<td valign="top" align="left">5&#x2032;-CAGGGTTCTGGATATCTGT<underline>GGG</underline>-3&#x2032;</td>
</tr>
<tr>
<td valign="top" align="left">&#x3b2;2m gRNA</td>
<td valign="top" align="left">5&#x2032;-GGCCGAGATGTCTCGCTCCG<underline>TGG</underline>-3&#x2032;</td>
</tr>
<tr>
<td valign="top" align="left">CD38 gRNA</td>
<td valign="top" align="left">5&#x2032;-TCAGACCGTACCTTGCAACA-3&#x2032;</td>
</tr>
<tr>
<td valign="top" align="left">TRAC primer 1</td>
<td valign="top" align="left">5&#x2032;-CAGCAAAGGAACTATGCCTTAG-3&#x2032;</td>
</tr>
<tr>
<td valign="top" align="left">TRAC primer 2</td>
<td valign="top" align="left">5&#x2032;-CAGCTGGATGTCTGCATTGC-3&#x2032;</td>
</tr>
<tr>
<td valign="top" align="left">GFP primer 1</td>
<td valign="top" align="left">5&#x2032;-GTGAGCAAGGGCGAGGAGCT-3&#x2032;</td>
</tr>
<tr>
<td valign="top" align="left">GFP primer 2</td>
<td valign="top" align="left">5&#x2032;-AACGGCCACAAGTTCAGCGTG-3&#x2032;</td>
</tr>
<tr>
<td valign="top" align="left">mCherry primer 1</td>
<td valign="top" align="left">5&#x2032;-TGAGCAAGGGCGAGGAGG-3&#x2032;</td>
</tr>
<tr>
<td valign="top" align="left">mCherry primer 2</td>
<td valign="top" align="left">5&#x2032;-CATGCGCTTCAAGGTGCACA-3&#x2032;</td>
</tr>
<tr>
<td valign="top" align="left">CD38 CAR-E2A-mCherry cDNA primer 1</td>
<td valign="top" align="left">5&#x2032;-ACGCTTTGTTGAAACTCGCTGGCGATGTTGAAAGTAACCCCGGTCCCATGGCTCTCCCAGTGACT-3&#x2032;</td>
</tr>
<tr>
<td valign="top" align="left">CD38 CAR-E2A-mCherry cDNA primer 2</td>
<td valign="top" align="left">5&#x2032;-GCGGCCGCGCTAGCTTAGCGAGGGGGCAGGGCCTGCAT-3&#x2032;</td>
</tr>
<tr>
<td valign="top" align="left">BFP primer 1</td>
<td valign="top" align="left">5&#x2032;-TCCATCGCCAccATGGTGAGCAAGGGCGAGGA-3&#x2032;</td>
</tr>
<tr>
<td valign="top" align="left">BFP primer 2</td>
<td valign="top" align="left">5&#x2032;-CTTGTACAGCTCGTCCATGC-3&#x2032;</td>
</tr>
<tr>
<td valign="top" align="left">&#x3b2;2m primer 1</td>
<td valign="top" align="left">5&#x2032;-AGTTATTGAGAGGGCTGGT-3&#x2032;</td>
</tr>
<tr>
<td valign="top" align="left">&#x3b2;2m primer 2</td>
<td valign="top" align="left">5&#x2032;-GTCGCCTAGGTTCTGATGATG-3&#x2032;</td>
</tr>
<tr>
<td valign="top" align="left">&#x3b2;2m primer 3</td>
<td valign="top" align="left">5&#x2032;-GGACTCCACCACCACGAAAT-3&#x2032;</td>
</tr>
<tr>
<td valign="top" align="left">&#x3b2;2m primer 4</td>
<td valign="top" align="left">5&#x2032;-TTATCTATGGCGGAAGATAACTG-3&#x2032;</td>
</tr>
<tr>
<td valign="top" align="left">GFP probe for Southern blot</td>
<td valign="top" align="left">5&#x2032;-GTGGCTGTTGTAGTTGTACTCCAGCTTGTGCCCCAGGATGTTGCCGTCCTCCTTGAAGTCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTGTCGCCCTCGAACTTCACCTCGGCGCGGGTCTTGTAGTTGCCGTCGTCCTTGAAGAAGATGGTGCGCTCCTGGACGTAGCCTTCGGGCATGGCGGACTTGAAGAAGTCGTGCTGCTTCATGTGGTCGGGGTAGCGGCTGAAGCACTGCACGCCGTAGGTCAGGGTGGTCAC-3&#x2032;</td>
</tr>
<tr>
<td valign="top" align="left">mCherry Probe for Southern blot</td>
<td valign="top" align="left">5&#x2032;-CTGCACGGGCTTCTTGGCCTTGTAGGTGGTCTTGACCTCAGCGTCGTAGTGGCCGCCGTCCTTCAGCTTCAGCCTCTGCTTGATCTCGCCCTTCAGGGCGCCGTCCTCGGGGTACATCCGCTCGGAGGAGGCCTCCCAGCCCATGGTCTTCTTCTGCATTACGGGGCCGTCGGAGGGGAAGTTGGTGCCGCGCAGCTTCACCTTGTAGATGAACTCGCCGTCCTGCAGGGAGGAGTCCTGGGTCACGGTCACCACGCCGCCGTCCTCGAAGTTCATCACGCGCTCCCACTTGAAGCCCTC-3&#x2032;</td>
</tr>
<tr>
<td valign="top" align="left">BFP probe for Southern blot</td>
<td valign="top" align="left">5&#x2032;-ACCATGTGATCGCGCTTCTCGTTGGGGTCTTTGCTCAGCACGGACTGGGTGCTCAGGTAGTGGCTGTCGGGCAGCAGCACGGGGCCGTCGCCGATGGGGGTGTTCTGCTGGTAGTGGTCGGCGAGCTGCACGCTGCCGTCCTCCACGTTGTGGCGGATCTTGAAGTTCACCTTGATGCCGTTCTTCTGCTTGACGGCCATGATATAGATGTTGTGGCTGTTGAAGTTGTACTCCAGCTTGTGCCCCAGGATGTTGCCGTCCTCCTTGAAGTCGACGCCCTTCAGCTCGATGCGGTTCACC-3&#x2032;</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_2">
<title><italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup> indCAR T-iPSC efficiently generate mature and functional TCR<sup>neg</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> CAR-iT cells</title>
<p>We further sought to investigate if the temporal control of CAR expression would lead to the successful generation of DP thymocytes and SP iT cells. <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup> indCAR-T-iPSCs were differentiated towards the lymphoid lineage using a previously described modified protocol (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2A</bold></xref>) (<xref ref-type="bibr" rid="B10">10</xref>). Indeed, in the absence of CAR expression, <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup> indCAR-T-iPSC-derived cells robustly committed to the T lymphoid lineage as &gt;90% were CD56<sup>&#x2212;</sup>CD7<sup>+</sup>CD5<sup>+</sup>, and within this population, &gt;95% were CD4<sup>+</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> DP thymocytes (<xref ref-type="fig" rid="f2"><bold>Figures&#xa0;2B, C</bold></xref> and <xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figure S6A</bold></xref>). As expected, those DP thymocytes were negative for the surface expression of the CD3/TCR complex (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2D</bold></xref>). The expression of mCherry and the CD38-CAR was efficiently induced on the surface after treatment with dox (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2E</bold></xref> and <xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figure S6B</bold></xref>). Interestingly, upon CAR expression, the DP thymocytes uniformly matured to single-positive CD8&#x3b1;&#x3b2;<sup>+</sup> CAR-iT cells (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2E</bold></xref> and <xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figure S6B</bold></xref>), probably receiving an activation/maturation signal due to the engagement of the CD38-CAR on CD38 expressed on the surface of the DP cells. Notably, CD38-mediated maturation resulted in approximately 30% survival of single-positive CD8&#x3b1;&#x3b2;<sup>+</sup> CAR-iT cells that had downregulated CD38 expression (<xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figures S6C, D</bold></xref>). DP thymocytes from TCR&#x3b1;<sup>&#x2212;/&#x2212;</sup> indCD19CAR T-iPSC (clone 1.5&#x2013;19 G8, <xref ref-type="table" rid="T1"><bold>Table&#xa0;1</bold></xref>) did not mature to CD8 SP iT cells upon the addition of dox, indicating that antigen encounter is required for efficient maturation. Indeed, CD8 SP CD19CAR iT cells could only be generated upon co-culture with irradiated CD19-expressing 3T3 cells (<xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figure S6E</bold></xref>). A CAR-mediated maturation is also supported by an observed reduction of CD8&#x3b2; expression (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2E</bold></xref>), which has been reported on primary T cells after stimulation (<xref ref-type="bibr" rid="B20">20</xref>) as well as CAR-iT cells (<xref ref-type="bibr" rid="B21">21</xref>). CD8&#x3b1;&#x3b2;<sup>+</sup> CAR-iT cells had an effector memory phenotype (CD45RA<sup>&#x2212;</sup>CD62L<sup>&#x2212;</sup>CCR7<sup>&#x2212;</sup>) and expressed the costimulatory molecules CD27 and CD28 (<xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figure S6F</bold></xref>). We further assessed the potential of TCR<sup>neg</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> CAR-iT cells for a specific CAR-mediated but not TCR-mediated response. After 48 h of dox treatment, CAR mRNA and protein surface expression returned to background after 7 days of expansion without dox (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2F</bold></xref> and <xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figures S6G, H</bold></xref> and <xref ref-type="supplementary-material" rid="SM1"><bold>S7</bold></xref>). Only dox-treated TCR<sup>neg</sup>CD8&#x3b1;&#x3b2;<sup>+</sup>indCD38CAR-iT cells, but not untreated TCR<sup>neg</sup> iT cells, could proliferate in a standard mixed lymphocyte culture assay with an allogeneic feeder mix consisting of CD38<sup>+</sup> Epstein&#x2013;Barr virus-immortalized lymphoblastoid cell lines (EBV-LCLs) and peripheral blood mononuclear cells (PBMCs) from three donors (<xref ref-type="bibr" rid="B19">19</xref>) (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2G</bold></xref>), confirming the lack of alloreactivity of the <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup> indCAR-iT cells (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2G</bold></xref>). <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup> indCAR-iT cells with a CD38- or a CD19-CAR could expand 8- to 12-fold following weekly antigen stimulations (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2G</bold></xref> and <xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figures S6I, J</bold></xref>). These results demonstrate that timely expression of the CAR allows for efficient and robust generation of CD4<sup>+</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> DP thymocytes that are able to mature and expand into functional non-alloreactive TCR<sup>neg</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> indCAR-iT cells.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Phenotypic and functional assessment of TCR<sup>neg</sup>indCD38CAR-iT cells. <bold>(A)</bold> Schematic representation of T-cell differentiation protocol. T-iPSCs give rise to CD34<sup>+</sup> hematopoietic progenitors via EB formation (day 0 to day 9). Subsequent co-culture with OP9-DL1 T cells induces T-cell commitment and generation of CD4<sup>+</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> DP thymocytes (Tdiff day 0 to day 25). The addition of dox for 48 h leads to CAR expression and maturation into CD8&#x3b1;&#x3b2;<sup>+</sup> CAR-iT cells (Tdiff day 27). <bold>(B)</bold> Representative flow cytometry plots of GFP9 CD4<sup>+</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> DP thymocytes at Tdiff day 25 for expression of T cell-specific markers. <bold>(C)</bold> Phenotype distribution of TCR<sup>neg</sup>indCD38CAR-iT cells on day 25 of T-cell commitment (<italic>n</italic> = 3 independent differentiations). Data are presented as mean &#xb1; SEM. <bold>(D)</bold> Immunophenotypic validation of CRISPR/Cas9-mediated TCR&#x3b1; disruption at Tdiff day 25. <bold>(E)</bold> Representative flow cytometry plots upon dox treatment for 48 h on GFP9 DP thymocytes at Tdiff day 27. mCherry levels correlate with CAR expression after staining with an anti-human F(ab&#x2032;)<sub>2</sub> antibody in a linear fashion. Emergence of CAR on the cell surface of GFP9 DP thymocytes leads to maturation into CD8&#x3b1;&#x3b2;<sup>+</sup> CAR-iT cells. <bold>(F)</bold> Kinetics of CD38 CAR surface expression upon dox withdrawal by staining with anti-human F(ab&#x2032;)<sub>2</sub> antibody. <bold>(G)</bold> Expansion of TCR<sup>neg</sup> indCD38CAR-iT cells in the absence (clone 1.5 GFP9, <italic>n</italic> = 2 independent differentiations) and in the presence of dox (clone 1.5 GFP4, <italic>n</italic> = 1 and clone 1.5 GFP9, <italic>n</italic> = 1) as well as TRE-mock transduced primary T cells with and without dox treatment (<italic>n</italic> = 2 donors) after co-culture on irradiated allogeneic feeder mix. Data are presented as mean &#xb1; SEM. Panel <bold>(A)</bold> was Created in BioRender. Themeli, M. (2026) <ext-link ext-link-type="uri" xlink:href="https://BioRender.com/b2b1eol">https://BioRender.com/b2b1eol</ext-link>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1757174-g002.tif">
<alt-text content-type="machine-generated">Panel A shows a timeline with illustrations depicting the differentiation protocol from iPSC to CAR-iT cells, indicating key factors and days. Panel B displays four flow cytometry dot plots with gating on markers CD5, CD7, CD8&#x3b1;, CD4, CD8&#x3b2;, and CD56, with percentages indicating population frequencies. Panel C presents a bar graph with percentages of different T cell developmental stages (DN, CD4ISP, DP, CD8&#x3b1;&#x3b2;). Panel D shows two flow cytometry plots comparing CD3 and TCR&#x3b1;&#x3b2; expression in WT and GFP9 with population percentages. Panel E includes flow cytometry plots for mCherry, GFP, and CD38 CAR in the presence and absence of doxycycline (+dox, -dox), along with CD4 and CD8&#x3b1; expression, with percentages for each gated population. Panel F is a bar graph showing the percentage of CD38 CAR positive cells over six days in the presence of doxycycline, revealing a progressive decrease. Panel G presents a bar graph of fold expansion for CAR-iT and mock-iT cells with or without doxycycline, highlighting greater expansion in CAR-iT under doxycycline.</alt-text>
</graphic></fig>
</sec>
<sec id="s2_3">
<title>TCR<sup>neg</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> indCAR-iT cells display anti-tumor efficacy <italic>in vitro</italic> and <italic>in vivo</italic></title>
<p>We further assessed the CAR-mediated anti-tumor potential of the TCR<sup>neg</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> indCAR-iT cells. TCR<sup>neg</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> indCD38CAR-iT cells were able to secrete IFN-&#x3b3; upon co-culture with a CD38<sup>+</sup> MM cell line, only upon dox treatment (<xref ref-type="fig" rid="f3"><bold>Figure&#xa0;3A</bold></xref>). Also, expanded indCD38CAR-iT cells exerted tumor lysis against CD38<sup>+</sup> MM cells (<xref ref-type="fig" rid="f3"><bold>Figure&#xa0;3B</bold></xref>). In order to further interrogate the anti-tumor potency of CAR-iT cells <italic>in vivo</italic>, we used a scaffold-based, humanized bone marrow (BM), xenograft murine model of MM (<xref ref-type="bibr" rid="B22">22</xref>), where luciferase-expressing CD38<sup>+</sup> UM9 cells were engrafted on the BM-like scaffold niches in the flanks of immunodeficient mice (<xref ref-type="fig" rid="f3"><bold>Figure&#xa0;3C</bold></xref>). Administration of a single intravenous (i.v.) dose of TCR<sup>neg</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> indCD38CAR-iT cells and intraperitoneal (i.p.) injection of dox resulted in a significant delay in MM tumor load compared to control mice receiving only dox (<xref ref-type="fig" rid="f3"><bold>Figures&#xa0;3D, E</bold></xref>). Taken together, our data demonstrate that indCD38CAR-iT cells, generated from engineered T-iPSC, exhibit robust tumor lytic potential and can successfully control tumor growth <italic>in vivo</italic>.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>TCR<sup>neg</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> indCD38CAR-iT cells exhibit anti-tumor activity. <bold>(A)</bold> Measurement of IFN-&#x3b3; secretion by GFP9 CD8&#x3b1;&#x3b2;<sup>+</sup> CAR-iT cells after co-culture with CD38<sup>+</sup> UM9 cells (E:T 1:1) with or without dox treatment (<italic>n</italic> = 2 technical replicates). Data are presented as mean &#xb1; SD. <bold>(B)</bold> Bioluminescence-based <italic>in vitro</italic> cytotoxicity assay of TCR<sup>neg</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> indCD38CAR-iT cells against UM9 Luc-GFP cells for 24 h. Data are presented as mean &#xb1; SD. <bold>(C)</bold> Schematic representation of the xenograft multiple myeloma mouse model. UM9 Luc-GFP cells were injected intra-scaffold, followed 4 days after by intravenous injection of GFP9 TCR<sup>neg</sup> CD8&#x3b1;&#x3b2;<sup>+</sup> indCD38CAR-iT cells + dox or dox only. IL-2, IL-15, and dox were injected i.p. as described. <bold>(D)</bold> Tumor burden was measured by BLI weekly. Images here shown with the pixel intensity represented in color. <bold>(E)</bold> Average tumor burden was quantified by BLI and is depicted as units per second per square centimeter per steradian (ph/s/cm<sup>2</sup>/sr) for the dox-only group (<italic>n</italic> = 4 mice) and the GFP9 TCR<sup>neg</sup> CD8&#x3b1;&#x3b2;<sup>+</sup> indCD38CAR-iT cells + dox group (<italic>n</italic> = 3 mice). Data are presented as mean &#xb1; SEM. Statistical significance was calculated by Mann&#x2013;Whitney test. **<italic>p</italic> &lt; 0.01. Panel <bold>(C)</bold> was Created in BioRender. Themeli, M. (2026) <ext-link ext-link-type="uri" xlink:href="https://BioRender.com/jjl5kt">https://BioRender.com/jjl5kt</ext-link>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1757174-g003.tif">
<alt-text content-type="machine-generated">Panel A shows a bar graph comparing IFN-gamma secretion in the presence and absence of doxycycline, with a significant increase upon doxycycline addition. Panel B depicts a bar graph showing high percent lysis at different effector-to-target ratios. Panel C is a schematic of a mouse model experimental timeline with IL-2, IL-15, and doxycycline interventions and cell injections. Panel D displays bioluminescent imaging of mice over four weeks, comparing untreated and indCD38CAR-iT cell-treated groups, with less signal in the treated group. Panel E is a line graph showing reduced tumor signal in the indCD38CAR-iT cell-treated group compared to untreated controls over time, with statistical significance noted.</alt-text>
</graphic></fig>
</sec>
<sec id="s2_4">
<title>Generation of <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup><italic>B2M</italic><sup>&#x2212;/&#x2212;</sup>HLA-E<sup>+</sup> indCAR-T-iPSC</title>
<p>Studies have shown that silencing the expression of &#x3b2;2-microglobulin (&#x3b2;2M), which is a universal accessory protein across all HLA class I molecules, was able to safeguard PSCs from alloreactive CD8<sup>+</sup> T cells (<xref ref-type="bibr" rid="B14">14</xref>, <xref ref-type="bibr" rid="B23">23</xref>). Since abrogation of HLA class I expression would render PSCs vulnerable against NK cell-mediated rejection, additional overexpression of non-classical HLA molecules, such as HLA-E, has been shown to successfully protect PSCs against an NK-mediated attack (<xref ref-type="bibr" rid="B14">14</xref>, <xref ref-type="bibr" rid="B16">16</xref>).</p>
<p>Given those findings, we set out to establish T-iPSC lines that would incorporate the aforementioned B2M/HLA modifications towards the ultimate goal of producing hypoimmunogenic T-iPSC. To this end, we used our previously established GFP9 T-iPSC clone to further genetically edit its B2M locus. This time, we knocked-in in exon 1 of <italic>B2M</italic> the coding sequence of a previously described HLA-E SCT (<xref ref-type="bibr" rid="B18">18</xref>, <xref ref-type="bibr" rid="B24">24</xref>) linked to a blue fluorescent protein (BFP) marker (<xref ref-type="fig" rid="f4"><bold>Figure&#xa0;4A</bold></xref>). We isolated 10 GFP<sup>+</sup>BFP<sup>+</sup> T-iPSC colonies (<xref ref-type="fig" rid="f4"><bold>Figure&#xa0;4B</bold></xref>) and confirmed the successful integration of the BFP-HLA-E SCT transgene by PCR in 9/10 (<xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figures S8A</bold></xref>, <xref ref-type="supplementary-material" rid="SM1"><bold>S9</bold></xref>), while in 5/10 colonies, the transgene was biallelic integrated (<xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figures S8A</bold></xref>, <xref ref-type="supplementary-material" rid="SM1"><bold>S9</bold></xref>). Southern blot verified specific integration of the transgene into the <italic>B2M</italic> locus of the selected GFP<sup>+</sup>mCherry<sup>+</sup>BFP<sup>+</sup> T-iPSC lines (<xref ref-type="fig" rid="f4"><bold>Figures&#xa0;4C, D</bold></xref> and <xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figure S10</bold></xref>), which could still express mCherry after dox treatment (<xref ref-type="fig" rid="f4"><bold>Figure&#xa0;4B</bold></xref>). We confirmed that GFP<sup>+</sup>BFP<sup>+</sup> T-iPSC lacked expression of HLA class I molecules and successfully expressed HLA-E on their cell surface (<xref ref-type="fig" rid="f4"><bold>Figure&#xa0;4E</bold></xref> and <xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figure S8B</bold></xref>). Although the parental GFP9 line (<italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup>) maintained a normal karyotype, the analysis of <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup><italic>B2M</italic><sup>&#x2212;/&#x2212;</sup>HLA-E<sup>+</sup> T-iPSCs (clone 1.5 GFP9BFP2.1, <xref ref-type="table" rid="T1"><bold>Table&#xa0;1</bold></xref>) showed the presence of trisomy 12 (<xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figures S8C</bold></xref>, <xref ref-type="supplementary-material" rid="SM1"><bold>S5</bold></xref>). This karyotypic pattern was further corroborated in an additional independent experiment targeting the <italic>B2M</italic> locus in the parental unmodified T-iPSC line (clone 1.5 BFP2.1, <xref ref-type="table" rid="T1"><bold>Table&#xa0;1</bold></xref>), where abnormal karyotype involving Chr12 [47,XY, + 12,t(12;12)(q10;q10)] was again observed in 50% of the metaphases (<xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figure S8C</bold></xref>). These results indicate that the chromosomal instability is probably correlated with the <italic>B2M</italic> knockout process. Since Cas9/gRNA cannot theoretically cause chromosomal trisomy, a role of the absence of B2M protein can be assumed.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Establishment of <italic>TCR&#x3b1;<sup>&#x2212;/&#x2212;</sup>B2M<sup>&#x2212;/&#x2212;</sup></italic>HLA-E<sup>+</sup> indCAR-T-iPSC clones. <bold>(A)</bold> Schematic strategy for bi-allelic disruption of the <italic>B2M</italic> locus and insertion of a cassette for HLA-E SCT expression. Arrows show the position of the double-strand break at the beginning of exon 1. <bold>(B)</bold> Representative fluorescence microscopy images confirming the successful generation of TCR&#x3b1;<sup>&#x2212;/&#x2212;</sup>&#x3b2;2m<sup>&#x2212;/&#x2212;</sup>HLA-E<sup>+</sup> indCAR-T-iPSC clones via the expression of GFP, mCherry, and BFP. Scale bar, 400 &#x3bc;m. <bold>(C)</bold> Schematic representation of Southern blot strategy to confirm the specific integration of the HLA-E SCT-BFP donor sequence. The area of interest is digested with NcoI and is targeted with a BFP-specific radiolabeled probe. <bold>(D)</bold> Southern blot analysis showing the successful insertion of HLA-E SCT on GFP9BFP T-iPSC clones by the presence of a band at 3.7 kb. <bold>(E)</bold> Expression of BFP, HLA-ABC, and HLA-E on GFP9BFP2.1 TCR&#x3b1;<sup>&#x2212;/&#x2212;</sup>&#x3b2;2m<sup>&#x2212;/&#x2212;</sup>HLA-E<sup>+</sup> indCAR-T-iPSC compared to the WT.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1757174-g004.tif">
<alt-text content-type="machine-generated">Panel A depicts a schematic of gene targeting using CRISPR-Cas9 and template plasmid design with labeled regions and gene components. Panel B shows four fluorescent microscopy images of cells expressing GFP, mCherry, BFP, and an overlay, each labeled with a scale bar of 400 micrometers. Panel C gives a diagram of the targeted locus with features and probe placement indicated. Panel D presents a Southern blot with bands for three BFP clones and a wild-type control, with molecular weights labeled at 4.4, 2.3, and 2.0 kilobases. Panel E displays three flow cytometry histograms comparing marker expression between cell lines Ti-iPSC-1.5 and GFP9BFP2.1 for BFP, HLA-ABC, and HLA-E.</alt-text>
</graphic></fig>
</sec>
<sec id="s2_5">
<title>Efficient generation of functional and hypoimmunogenicTCR<sup>neg</sup>&#x3b2;2M<sup>neg</sup>HLA-E<sup>+</sup> indCAR-iT cells</title>
<p>After having established the <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup><italic>B2M</italic><sup>&#x2212;/&#x2212;</sup>HLA-E<sup>+</sup> T-iPSC clones, we further set out to differentiate them towards <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup><italic>B2M</italic><sup>&#x2212;/&#x2212;</sup>HLA-E<sup>+</sup> indCAR-iT cell derivatives. Interestingly, the <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup><italic>B2M</italic><sup>&#x2212;/&#x2212;</sup>HLA-E<sup>+</sup> T-iPSC, when differentiated on OP9-DL1 feeder cells, failed to generate CD4<sup>+</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> DP cells, but only gave rise to CD56<sup>&#x2212;</sup>CD7<sup>+</sup>CD5<sup>low</sup> lymphoid cells (<xref ref-type="fig" rid="f5"><bold>Figure&#xa0;5A</bold></xref>). The use of the DLL4 Notch-ligand can rescue the developmental skewing of T-iPSC caused by the premature expression of the TCR (<xref ref-type="bibr" rid="B13">13</xref>). We thus hypothesized that the use of OP9-DL4 may also improve the development of DP cells from <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup><italic>B2M</italic><sup>&#x2212;/&#x2212;</sup>HLA-E<sup>+</sup> T-iPSC. Indeed, when using OP9-DL4 feeder cells, we succeeded in generating CD7<sup>+</sup>CD5<sup>+</sup> cells from <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup><italic>B2M</italic><sup>&#x2212;/&#x2212;</sup>HLA-E<sup>+</sup> T-iPSC, which were, in their majority, CD4<sup>+</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> DP (<xref ref-type="fig" rid="f5"><bold>Figures&#xa0;5A, B</bold></xref>). These data suggest that lack of B2M can influence the T lymphoid potential of T-iPSC and the use of DL4 can partially rescue the developmental block. We observed the same decrease of DP cell generation when starting from <italic>TCR&#x3b1;<sup>+/+</sup>B2M</italic><sup>&#x2212;/&#x2212;</sup> T-iPSC versus wild-type T-iPSC (<xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figure S11A</bold></xref>).</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Efficient generation of functional TCR<sup>neg</sup> B2M<sup>neg</sup> HLA-E<sup>+</sup> indCD38CAR-iT cells. <bold>(A)</bold> Representative flow cytometry plots showing expression of classical T-cell markers of TCR<sup>neg</sup> B2M<sup>neg</sup> HLA-E<sup>+</sup> indCD38CAR-iT cells at Tdiff day 25 after co-culture with either OP9-DL1 or OP9-DL4 feeders. <bold>(B)</bold> Phenotype distribution of TCR<sup>neg</sup> B2M<sup>neg</sup> HLA-E<sup>+</sup> indCD38CAR-iT without dox on day 25 of T-cell induction on OP9-DL1 or OP9-DL4 feeders (<italic>n</italic> = 3 independent differentiations). Data are presented as mean &#xb1; SEM. <bold>(C)</bold> Representative plot of purified TCR<sup>neg</sup> B2M<sup>neg</sup> HLA-E<sup>+</sup> CD4 ISP and CD4<sup>+</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> DP thymocytes at Tdiff day 25 after co-culture with OP9-DL4 cells. The addition of dox for 48 h results in maturation into TCR<sup>neg</sup> B2M<sup>neg</sup> HLA-E<sup>+</sup> CD8&#x3b1;&#x3b1;<sup>+</sup> indCD38CAR-iT cells. <bold>(D)</bold> TCR<sup>neg</sup> B2M<sup>neg</sup> HLA-E<sup>+</sup> CD8&#x3b1;&#x3b1;<sup>+</sup> indCD38CAR-iT cells display antigen-specific lysis. TCR<sup>neg</sup> B2M<sup>neg</sup> HLA-E<sup>+</sup> CD8&#x3b1;&#x3b1;<sup>+</sup> indCD38CAR-iT cells were co-cultured with irradiated EBV-LCLs for 1 week. Expanded cells were co-cultured with UM9 WT or CD38KO Luc-GFP cells at E:T 2:1 for 24 h and lysis was measured based on bioluminescence signal (<italic>n</italic> = 2, technical replicates). Data are displayed as mean &#xb1; SD. <bold>(E)</bold> Levels of secreted IFN-&#x3b3; after co-culture of expanded TCR<sup>neg</sup> B2M<sup>neg</sup> HLA-E<sup>+</sup> CD8&#x3b1;&#x3b1;<sup>+</sup> indCD38CAR-iT cells with UM9 WT or CD38KO Luc-GFP cells at E:T 2:1 for 24 h (<italic>n</italic> = 2, technical replicates). Data are presented as mean &#xb1; SD. <bold>(F)</bold> Cell yield of CD34<sup>+</sup> HEPs per T-iPSC of <italic>wt</italic> (<italic>n</italic> = 4 independent differentiations), <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup> (<italic>n</italic> = 4 independent differentiations), and <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup><italic>B2M</italic><sup>&#x2212;/&#x2212;</sup>HLA-E<sup>+</sup> T-iPSC (<italic>n</italic> = 4 independent differentiations). Data are presented as mean &#xb1; SEM. Statistical significance was calculated by unpaired student&#x2019;s t-test or Mann&#x2013;Whitney test. <bold>(G)</bold> Cell yield of ISP/DP cells per T-iPSC of <italic>wt</italic> (<italic>n</italic> = 4 independent differentiations), <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup> indCD38-CAR (<italic>n</italic> = 4 independent differentiations), and <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup><italic>B2M</italic><sup>&#x2212;/&#x2212;</sup>HLA-E+ indCD38CAR-T-iPSC (<italic>n</italic> = 4 independent differentiations). <bold>(H)</bold> Surface CD38 CAR expression kinetics of TCR<sup>neg</sup> B2M<sup>neg</sup> HLA-E<sup>+</sup> CD8&#x3b1;&#x3b1;<sup>+</sup> indCD38CAR-iT cells upon dox withdrawal. <bold>(I)</bold> Bioluminescence-based <italic>in vitro</italic> cytotoxicity assay of TCR<sup>neg</sup>CD8&#x3b1;&#x3b2;+ indCD38CAR-iT and TCR<sup>neg</sup> B2M<sup>neg</sup> HLA-E<sup>+</sup> CD8&#x3b1;&#x3b1;<sup>+</sup> indCD38CAR-iT cells against UM9 Luc-GFP cells (E:T 1:1) for 24 h (<italic>n</italic> = 3, technical replicates). Data are presented as mean &#xb1; SD. Statistical significance was calculated by unpaired student&#x2019;s t-test. <bold>(J)</bold> Proliferation potential of TCR<sup>neg</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> indCD38CAR-iT (<italic>n</italic> = 3 technical replicates) and TCR<sup>neg</sup> B2M<sup>neg</sup> HLA-E<sup>+</sup> CD8&#x3b1;&#x3b1;<sup>+</sup> indCD38CAR-iT cells (<italic>n</italic> = 2 technical replicates) upon co-culture with an allogeneic feeder mix. CAR-iT cells were stained with Cell Trace Far Red (CTFR) and proliferation capacity was evaluated by proliferation index. Data are presented as mean &#xb1; SD. <bold>(K)</bold> Generation peaks of TCR<sup>neg</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> indCD38CAR-iT and TCR<sup>neg</sup> B2M<sup>neg</sup> HLA-E<sup>+</sup> CD8&#x3b1;&#x3b1;<sup>+</sup> indCD38CAR-iT as shown by CTFR staining during proliferation. *<italic>p</italic> &lt; 0.05; ns, not significant.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1757174-g005.tif">
<alt-text content-type="machine-generated">Panel figure showing a series of flow cytometry plots, bar graphs, and histograms related to immune cell differentiation, phenotype, and function. Panel A includes flow cytometry dot plots depicting the gating strategy and quantification of various cell populations using markers such as CD5, CD7, CD4, CD8&#x3b1;, and CD8&#x3b2;. Panel B shows a grouped bar graph of cell subsets DN, CD8&#x3b1;+, CD4 ISP, and DP with statistical significance indicated. Panel C presents flow plots from CD4 sorted populations, comparing untreated and doxycycline-treated conditions. Panels D and E display bar graphs quantifying cell lysis percentage and interferon gamma production respectively. Panels F, G, and H contain bar graphs quantifying the number or percent of specific cell populations under various genetic backgrounds. Panel I shows a bar graph of percent lysis for two different TCR conditions. Panel J presents a proliferation index comparison. Panel K displays overlayed histograms comparing CFTR levels between two groups.</alt-text>
</graphic></fig>
<p>We further proceeded in investigating the functional potential of the TCR<sup>neg</sup>&#x3b2;2M<sup>neg</sup>HLA-E<sup>+</sup> indCAR-iT cells. To exclude any contamination of innate T cells, we first performed purification of the total CD4<sup>+</sup> population [including the DP and CD4 immature single-positive (ISP) cells]. The addition of dox induced, as expected, the maturation of the DP cells to CD8<sup>+</sup> SP cells (<xref ref-type="fig" rid="f5"><bold>Figure&#xa0;5C</bold></xref>). However, the expression of CD8&#x3b2; was decreased on the surface of the TCR<sup>neg</sup>&#x3b2;2M<sup>neg</sup><italic><sup>-</sup></italic>HLA-E<sup>+</sup> indCAR-iT cells after maturation. Nevertheless, the TCR<sup>neg</sup>&#x3b2;2M<sup>neg</sup>HLA-E<sup>+</sup> indCD38CAR-iT cells were able to elicit specific lysis of the CD38<sup>+</sup> UM9 MM cell line, while leaving intact the CD38-knockout derivative of the same cell line (UM9 CD38KO) (<xref ref-type="fig" rid="f5"><bold>Figure&#xa0;5D</bold></xref>). This was further corroborated by analysis of cytokine secretion, where only co-culture with UM9 cells resulted in secretion of IFN-&#x3b3; in contrast to co-culture with UM9 CD38KO cells (<xref ref-type="fig" rid="f5"><bold>Figure&#xa0;5E</bold></xref>). Phenotypically, the cells displayed a terminally differentiated effector phenotype (CD45RA<sup>+</sup>CD62L<sup>&#x2212;</sup>CCR7<sup>&#x2212;</sup>) expressing the costimulatory receptor CD27 but not CD28 (<xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figure S11B</bold></xref>). Furthermore, <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup><italic>B2M</italic><sup>&#x2212;/&#x2212;</sup>HLA-E<sup>+</sup> T-iPSC yielded lower numbers of CD34<sup>+</sup> hematopoietic progenitors (<xref ref-type="fig" rid="f5"><bold>Figure&#xa0;5F</bold></xref>) and ISP/DP cells (<xref ref-type="fig" rid="f5"><bold>Figure&#xa0;5G</bold></xref>) compared to both unmodified and <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup> T-iPSC. In line with the TCR<sup>neg</sup> indCAR-iT cells, TCR<sup>neg</sup>&#x3b2;2M<sup>neg</sup>HLA-E<sup>+</sup> indCAR-iT cells displayed downregulation of CAR expression within 1 week after dox withdrawal (<xref ref-type="fig" rid="f5"><bold>Figure&#xa0;5H</bold></xref> and <xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figure S11C</bold></xref>). Although we did not see any difference on the cytotoxic potential of TCR<sup>neg</sup>B2M<sup>neg</sup>HLA-E<sup>+</sup> indCD38CAR-iT cells compared to TCR<sup>neg</sup> CD8&#x3b1;&#x3b2;<sup>+</sup> indCD38CAR-iT cells (<xref ref-type="fig" rid="f5"><bold>Figure&#xa0;5I</bold></xref>), we did however observe that <italic>B2M</italic> knockout indCD38CAR-iT cells showed a lower proliferative potential (<xref ref-type="fig" rid="f5"><bold>Figures&#xa0;5J, K</bold></xref>).</p>
<p>Finally, we evaluated whether the engineered <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup><italic>B2M</italic><sup>&#x2212;/&#x2212;</sup>HLA-E<sup>+</sup> T-iPSC and indCAR-iT cells could trigger an immune response from allogeneic T cells and NK cells. Since the parental T-iPSC clone carries the HLA-A*02<sup>+</sup> allele, we assessed the lysis of engineered T-iPSC clones expressing firefly luciferase and their derivative iDP cells by an alloreactive anti-HLA-A*02 T cell clone (allo-HLA-A*02). Immunogenicity at the iDP cell level was performed without dox treatment in order to avoid CAR-mediated interactions with the CD38 molecule expressed on the effector cells in this assay. Although allo-HLA-A*02 T cells effectively lysed the parental GFP9 T-iPSC and their derivative <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup> indCD38CAR-iT cells, abrogation of B2M and lack of HLA class I expression was able to confer protection in the <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup><italic>B2M</italic><sup>&#x2212;/&#x2212;</sup>HLA-E<sup>+</sup> T-iPSC clone (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6A</bold></xref>) as well as the TCR<sup>neg</sup>&#x3b2;2M<sup>neg</sup>HLA-E<sup>+</sup> indCAR-iT cells (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6B</bold></xref>). Furthermore, as expected, the lack of HLA class I expression resulted in the lysis of <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup><italic>B2M</italic><sup>&#x2212;/&#x2212;</sup> T-iPSC (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6C</bold></xref>) and <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup><italic>B2M</italic><sup>&#x2212;/&#x2212;</sup> iDP cells from primary NKG2A<sup>+</sup> NK cells (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6D</bold></xref>). The overexpression of HLA-E SCT, which was inserted in the <italic>&#x3b2;2m</italic> locus, was able to successfully compensate for the lack of HLA class I molecules and safeguard the recognition of <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup><italic>B2M</italic><sup>&#x2212;/&#x2212;</sup>HLA-E<sup>+</sup> T-iPSC and iDP cells from NKG2A<sup>+</sup> NK cells (<xref ref-type="fig" rid="f6"><bold>Figures&#xa0;6C, D</bold></xref>).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p><italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup><italic>B2M</italic><sup>&#x2212;/&#x2212;</sup>HLA-E<sup>+</sup> indCAR-T-iPSC and CD8&#x3b1;&#x3b2;<sup>+</sup> indCAR-iDP thymocytes are hypoimmunogenic. <bold>(A, B)</bold> Flow cytometry-based cytotoxicity assay of allo-HLA-A*02 T cells against <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup><italic>B2M<sup>+/+</sup></italic> or <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup><italic>B2M</italic><sup>&#x2212;/&#x2212;</sup>HLA-E<sup>+</sup> indCAR-T-iPSC <bold>(A)</bold> and indCAR-iDP thymocytes <bold>(B)</bold> after co-culture for 24 h (<italic>n</italic> = 3, technical replicates; <italic>n</italic> = 2 technical replicates, respectively). <bold>(C, D)</bold> Flow cytometry-based cytotoxicity assay of NKG2A<sup>+</sup> NK cells against TCR&#x3b1;<sup>&#x2212;/&#x2212;</sup>&#x3b2;2m<sup>+/+</sup> or TCR&#x3b1;<sup>&#x2212;/&#x2212;</sup>&#x3b2;2m<sup>&#x2212;/&#x2212;</sup>HLA-E<sup>+</sup> indCAR-T-iPSC <bold>(C)</bold> and indCAR-iDP thymocytes <bold>(D)</bold> after co-culture for 24 h; <italic>n</italic> = 3 technical replicates and <italic>n</italic> = 2 technical replicates, respectively. Survival percentage is calculated as the fold change in the cell numbers of the treated to the untreated conditions. Data are presented as mean &#xb1; SD. Statistical significance was calculated by 2-way ANOVA (A,C). **p &lt; 0.01, ***p &lt; 0.001, ****p &lt; 0.0001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1757174-g006.tif">
<alt-text content-type="machine-generated">Panel A shows a line chart comparing percent survival of Allo-HLA-A2 versus indCAR-T-iPSCs at different effector-to-target (E:T) ratios, with TCR&#x3b1;&#x2212;/&#x2212;&#x3b2;2m&#x2212;/&#x2212;HLA-E+ cells showing higher survival than TCR&#x3b1;&#x2212;/&#x2212;&#x3b2;2m+/+ cells. Panel B presents a similar comparison for Allo-HLA-A2 versus indCAR-iDP, showing greater survival in HLA-E+ cells. Panel C displays a line graph for NK cell cytotoxicity against indCAR-T-iPSCs, with HLA-E+ cells having higher survival across increasing E:T ratios compared to &#x3b2;2m&#x2212;/&#x2212; cells. Panel D is a bar graph showing that TCR&#x3b1;&#x2212;/&#x2212;&#x3b2;2m&#x2212;/&#x2212;HLA-E+ cells have significantly higher survival than other groups after NK cell exposure. Asterisks indicate statistical significance.</alt-text>
</graphic></fig>
</sec>
</sec>
<sec id="s3" sec-type="discussion">
<title>Discussion</title>
<p>The use of allogeneic donor-derived T cells has been pursued as an alternative resource of therapeutic T cells in order to surpass the shortcomings of current autologous CAR-T cell manufacturing methods. An optimal allogeneic therapeutic T cell, however, would need to possess specific features, which require substantial genome engineering. Unfortunately, genetic engineering of primary T cells in a multiplex manner is very challenging, as it currently results in (a) reduced production yield; (b) genotoxicity due to undesired off-target effects and gene translocations; (c) an exhausted T-cell phenotype due to the requirement of extended <italic>ex vivo</italic> expansion; and (d) high production costs and effort for safety release testing (<xref ref-type="bibr" rid="B25">25</xref>). The potential of iPSC for unlimited culture and genetic editing makes them an attractive platform to produce multi-engineered, selected, and carefully screened clonal cell banks that can be used to generate homogenous T-cell products with desired therapeutic properties (<xref ref-type="bibr" rid="B9">9</xref>). We, here, show an efficient strategy to genetically engineer iPSC by utilizing well-characterized loci to knock-in desirable transgenes and robustly generate functional CD8&#x3b1;&#x3b2; CAR-T cells, resistant to CD8<sup>+</sup> T and NK cell-mediated rejection. Our data provide insights for optimal CAR expression strategies and underscore the importance of evaluating the impact of every engineering step to the functional quality of CAR-iT cells.</p>
<p>Previous studies have reported strategies to confer human embryonic stem cells (ESCs) or iPSC hypoimmunogenic and resistant to T- and NK-cell rejection including the elimination of HLA class I and class II molecule expression, the introduction of the non-classical HLA-E molecule, and the knockout of NK-cell activating ligands (CD155, B7-H3) (<xref ref-type="bibr" rid="B14">14</xref>&#x2013;<xref ref-type="bibr" rid="B17">17</xref>, <xref ref-type="bibr" rid="B26">26</xref>). In the majority of these studies, the engineered iPSC lines were made by numerous sequential genetic editing processes along with additional steps of retro/lentiviral delivery of transgenes (e.g., HLA-E and CAR), even at the iT stage. However, the accommodation of as many optimized immunotherapeutic properties as possible in the iPSC-derived CAR-T cells requires the facilitation of engineering processes.</p>
<p>Here, we propose that all required features of CAR-iT cells can be engineered at the iPSC level. Most importantly, the loci of the genes required to be knocked out can serve as insertion sites for the overexpression of transgenes whose expression is desired, reducing in this way the required steps of genetic engineering. Using CRISPR/Cas9, we knocked out the <italic>TRAC</italic> and <italic>B2M</italic> loci and utilized the edited alleles to insert the expression cassettes coding for a doxycycline-inducible CD38CAR and the HLA-E SCT. In our study, the two alleles of the <italic>TRAC</italic> locus were successfully simultaneously modified with 2 different gene expression cassettes by homologous recombination. The sequence of the tetracycline-controlled transactivator rtTA driven by the Ubic promoter was inserted in one allele while the coding sequences of the TRE and the CD38CAR were inserted in the other allele. In a separate editing step, the HLA class I expression was silenced by disrupting the <italic>B2M</italic> locus and the immune modulatory HLA-E molecule, which has been used in pre-clinical studies and clinical trials, in order to inhibit NK-cell-mediated rejection (<xref ref-type="bibr" rid="B16">16</xref>, <xref ref-type="bibr" rid="B27">27</xref>). Thus, theoretically, when knocking out 2 genes, one has the opportunity to insert up to 4 different gene-expression cassettes. In our study, we limited the edited loci to 2, the <italic>TRAC</italic> and the <italic>B2M</italic>. However, the rationale of our study could be extended to other loci, which can be edited in order to further ensure the lack of immunogenicity and improve the efficacy of CAR-iT cells (HLA class I or II genes, <italic>CIITA</italic>, <italic>CD155</italic>, <italic>B7-H3</italic>, <italic>Pdcd1, CD52, CD38</italic>, etc.) (<xref ref-type="bibr" rid="B14">14</xref>&#x2013;<xref ref-type="bibr" rid="B17">17</xref>, <xref ref-type="bibr" rid="B28">28</xref>, <xref ref-type="bibr" rid="B29">29</xref>). Moreover, although we used T cell-derived iPSC in this study, this strategy could be theoretically applicable to iPSC of other origins.</p>
<p>Previous work on T-iPSC that are engineered to constitutively express a CAR has shown that these cells give rise mainly to CD8&#x3b1;&#x3b1;<sup>+</sup> CAR-T cells with an expression profile and function similar to innate T cells, which lack some key features for therapeutic potency, such as the long-term memory and <italic>in vivo</italic> persistence (<xref ref-type="bibr" rid="B10">10</xref>, <xref ref-type="bibr" rid="B13">13</xref>). Premature expression and signaling of an endogenous or transgenic TCR&#x3b1;&#x3b2; (<xref ref-type="bibr" rid="B30">30</xref>, <xref ref-type="bibr" rid="B31">31</xref>) as well as CAR-mediated tonic signaling can cause a block in T-cell development (<xref ref-type="bibr" rid="B32">32</xref>). Differentiation using an artificial thymic organoid system allowed the development of mature CD8&#x3b1;&#x3b2;<sup>+</sup> CD19CAR-iT cells from T-iPSC constitutively expressing a CD19CAR, suggesting that a 3D thymic-like structure might be important for T-cell development (<xref ref-type="bibr" rid="B14">14</xref>). Reducing the intensity of CAR-mediated tonic signaling by using a CD19CAR bearing mutated ITAMs and timing the CAR expression to a later time point during the differentiation process results in a partial rescue of &#x3b2;-selection and the emergence of CD4<sup>+</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> DP iT cells (<xref ref-type="bibr" rid="B13">13</xref>). We, here, show that allowing CAR expression only at the DP stage of development, when physiologically the full TCR&#x3b1;&#x3b2; complex is expected to be expressed, would allow the unobstructed and robust development of CD4<sup>+</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> DP iT cells. Indeed, T-iPSCs engineered with the dox-inducible CD38CAR were efficiently differentiated to CD4<sup>+</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> DP cells and upon dox treatment to CD8&#x3b1;&#x3b2;<sup>+</sup> CAR-iT cells (&gt;95% efficiency). Previously, the use of a single lentiviral vector for the dox-inducible control of CAR expression allowed some development of DP iT cells up to 60% (<xref ref-type="bibr" rid="B21">21</xref>). We believe that, in our system, the precise editing and insertion of one transgene copy in the T-iPSC results in better control of CAR expression without leakiness. Of course our method is limited by the use of the non-eukaryotic tetracycline response transactivator, which complicates a clinical application. Nevertheless, our study showcases that robust production of mature CD8&#x3b1;&#x3b2;<sup>+</sup> CAR-iT cells from engineered T-iPSC is possible by using measures that efficiently withhold the expression of the CAR-transgene.</p>
<p>In contrast to the unimpeded emergence of CD8&#x3b1;&#x3b2;<sup>+</sup> CAR-iT cells from <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup> indCAR-T-iPSC, we found that knockout of <italic>B2M</italic> affected genomic stability and the efficiency of T lymphoid development. We observed karyotypic abnormalities in <italic>B2M</italic><sup>&#x2212;/&#x2212;</sup> T-iPSC, specifically the emergence of trisomy 12. Notably, similar chromosomal instability was detected in cells subjected to different independent rounds of <italic>B2M</italic> CRISPR knockout. Since theoretically trisomy cannot be a result of CRISPR off-target activity (<xref ref-type="bibr" rid="B33">33</xref>), we assumed a role of <italic>B2M</italic><sup>&#x2212;/&#x2212;</sup> in the propagation of genomic unstable clones. Indeed, a complete lack of &#x3b2;2M expression has been previously reported to slow the growth of normal, euploid ESCs (<xref ref-type="bibr" rid="B16">16</xref>). Moreover, trisomy 12 is a common aneuploidy described in human ESC and iPSC, possibly related to specific culture conditions (<xref ref-type="bibr" rid="B34">34</xref>). Overall, our findings and those of others suggest that <italic>B2M</italic>-edited iPSC should be carefully and regularly screened for genomic instability. Additionally, we found that <italic>B2M</italic><sup>&#x2212;/&#x2212;</sup> T-iPSC differentiated less efficiently to CD34<sup>+</sup> and DP iT cells. There is limited knowledge on a potential role of &#x3b2;2M or HLA-class I expression in T-cell development before the stage of positive and negative selection. According to a recent report, the addition of human recombinant &#x3b2;2M increased thymocyte cellularity in a thymic epithelial cells/thymocyte culture system (<xref ref-type="bibr" rid="B35">35</xref>). Wang et&#xa0;al. have shown the development of CD8&#x3b1;&#x3b2;<sup>+</sup> iT cells from chromosomally stable <italic>B2M</italic><sup>&#x2212;/&#x2212;</sup> T-iPSC (<xref ref-type="bibr" rid="B14">14</xref>). Thus, although there are indications that &#x3b2;2M may have less studied, non-obvious functions, we cannot exclude that the negative impact on genomic stability and T-cell development may be connected and related to the iPSC culture conditions (use of MEF feeders) or even the iPSC donor source. Nevertheless, the emergence of &#x3b2;2M<sup>neg</sup>CD4<sup>+</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> DP cells was partially restored when using OP9 bearing DL-4, a ligand with higher affinity for NOTCH1.</p>
<p>It is critical to assess the effects of any genomic editing on the functionality of the CAR-iT cells and confirm that the desired features are present without compromising the anti-tumor efficacy. Indeed, the lack of TCR rendered the CAR-iT cells non-alloreactive against a mix of allogeneic PBMCs, the lack of HLA class I expression protected them from lysis by anti-HLA-A*02 CD8<sup>+</sup> T cells, while the overexpression of the HLA-E SCT made them immune to rejection from NKG2A<sup>+</sup> NK cells. Importantly, knockout of the <italic>TRAC</italic> did not affect the anti-tumor functionality of TCR<sup>neg</sup> CD8&#x3b1;&#x3b2;<sup>+</sup> indCD38CAR-iT cells, which responded to CD38 engagement <italic>in vitro</italic> by proliferating, secreting IFN-&#x3b3;, and eliciting tumor lysis and successfully controlled tumor growth in a xenograft murine model for MM. Besides the reduced efficiency of <italic>TCR&#x3b1;</italic><sup>&#x2212;/&#x2212;</sup><italic>B2M</italic><sup>&#x2212;/&#x2212;</sup>HLA-E<sup>+</sup> T-iPSCs to differentiate them from TCR<sup>neg</sup>&#x3b2;2M<sup>neg</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> DP cells, induction of the CD38CAR resulted in the emergence of TCR<sup>neg</sup>&#x3b2;2M<sup>neg</sup>CD8&#x3b1;&#x3b1;<sup>+</sup> iT cells. Nevertheless, the TCR<sup>neg</sup>&#x3b2;2M<sup>neg</sup>CD8&#x3b1;&#x3b1;<sup>+</sup> indCAR-iT cells did not show innate-like, non-antigen-dependent cytokine secretion or tumor lysis, which has been previously described for iPSC-derived CD8&#x3b1;&#x3b1;<sup>+</sup> iT cells (<xref ref-type="bibr" rid="B36">36</xref>) and <italic>B2M</italic> knockout did not impair their antigen-dependent cytotoxic capacity. We did, though, observe that TCR<sup>neg</sup>&#x3b2;2M<sup>neg</sup>CD8&#x3b1;&#x3b1;<sup>+</sup> indCAR-iT cells had significantly reduced proliferation upon antigen engagement compared to TCR<sup>neg</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> indCAR-iT cells. Our data indicate a developmental and functional defect of the TCR<sup>neg</sup>&#x3b2;2M<sup>neg</sup>CD8&#x3b1;&#x3b1;<sup>+</sup> iT cells. However, since we did not succeed in generating a chromosomally stable <italic>B2M</italic><sup>&#x2212;/&#x2212;</sup> T-iPSC line (<xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figure S8C</bold></xref>), we cannot rule out a potential influence of the abnormal karyotype alone or in combination with B2M absence. Nevertheless, previous studies have also investigated the effect of B2M silencing on T-iPSCs or ESCs, which maintained normal karyotype. Despite the fact that no significant impact in the overall function of TCR- or CAR-iT cells was reported, careful evaluation of individual experiments showed cases of lower cell yield as well as slight reduction of lytic and proliferative performance <italic>in vitro</italic> (<xref ref-type="bibr" rid="B14">14</xref>, <xref ref-type="bibr" rid="B26">26</xref>).</p>
<p>In summary, we have succeeded in exploiting well-characterized genomic loci to engineer T-iPSC and generate mature, functional TCR<sup>neg</sup>&#x3b2;2M<sup>neg</sup> indCAR-iT cells. The inducible CAR expression allows for an unpreceded robust efficiency of production of CD4<sup>+</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> DP and CD8&#x3b1;&#x3b2;<sup>+</sup> CAR-iT cells. Our data suggest that the choice of target loci should be based on careful assessment of the impact of genetic modifications on the genomic stability and the developmental potential of iPSC as well as on the overall functional potential of the produced effector CAR-iT cells. The facilitation of multi-engineering at the iPSC level along with the improved production efficiency can further enable the use of iPSC as a powerful source of therapeutic T cells.</p>
</sec>
<sec id="s4" sec-type="materials|methods">
<title>Materials and methods</title>
<sec id="s4_1">
<title>Cell lines</title>
<p>The human multiple myeloma (MM) cell line UM9 (obtained from UMC Utrecht) [unmodified, lentivirally transduced to express luciferase (Luc-GFP) or with silenced CD38 expression (CD38 KO)] was cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (Thermo Fisher Scientific, Cat#21875091) along with 10% HyClone Fetal Clone I (Fisher Scientific, Cat#SH30080.03), 100 U/mL penicillin, and 100 &#xb5;g/mL streptomycin (Thermo Fisher Scientific, Cat#15140122). EBV-LCLs (obtained from UMC Utrecht) were cultured in RPMI-1640 medium (Thermo Fisher Scientific) supplemented with 10% fetal bovine serum [FBS (Sigma-Aldrich), Cat#F7524], 100 U/mL penicillin, and 100 &#xb5;g/mL streptomycin. CF-1 mitomycin C-treated mouse embryonic feeder cells [MEFs (Tebu Bio), Cat#MEF-MITC] were maintained in Dulbecco&#x2019;s Modified Eagle Medium (DMEM) high-glucose Glutamax (Thermo Fisher Scientific, Cat#10569010) supplemented with 10% FBS, 100 U/mL penicillin, and 100 &#xb5;g/mL streptomycin. The OP9-DL1 and OP9-DL4 cell lines (kind gift from Dr. Michel Sadelain, Memorial Sloan Kettering Cancer Center) were cultured in minimum essential medium alpha (MEM&#x3b1;) with no nucleosides (Fisher Scientific, Cat#12000014), 0.2% sodium bicarbonate (Thermo Fisher Scientific, Cat#25080094), 2 mM L-glutamine (Thermo Fisher Scientific, Cat#25030024), and 20% FBS Hyclone Characterized (Fisher Scientific, Cat#SH30071.03). The Allo-HLA-A*02 T cell clone (obtained from UMC Utrecht) was cultured with Iscove&#x2019;s Modified Dulbecco&#x2019;s Medium [IMDM (Thermo Fisher Scientific), Cat#21980032] supplemented with 10% Human Heat Inactivated AB Serum (Sigma-Aldrich, Cat#H3667), 100 U/mL penicillin, 100 &#xb5;g/mL streptomycin, and 25 U/mL recombinant human (rh) IL-2 [(Proleukin) Novartis, Cat#4764032NL]. They were weekly stimulated by co-culturing 200,000 Allo-HLA-A*02 T cells with 1 &#xd7; 10<sup>6</sup> irradiated feeder-PBMCs from three donors (25 Gy) and 1 &#xd7; 10<sup>5</sup> EBV-LCLs (50 Gy) in medium supplemented with 25 U/mL rhIL-2 and 1 &#xb5;g/mL Phytohemagglutinin-Ligand (PHA-L; Sigma-Aldrich, Cat#L4144). The fibroblast cell line NIH/3T3 (ATCC CRL-1658), lentivirally transduced to overexpress CD19, was cultured on DMEM high-glucose Glutamax supplemented with 10% FBS, 100 U/mL penicillin, and 100 &#xb5;g/mL streptomycin. All cell lines were incubated at 37 &#xb0;C with 5% CO<sub>2</sub> and were regularly checked with Short Tandem Repeat (STR) analysis and tested for mycoplasma.</p>
</sec>
<sec id="s4_2">
<title>Primary human cells</title>
<p>PBMCs were isolated from fresh healthy donor buffy coats, purchased by Sanquin Blood bank after informed consent. NKG2A<sup>+</sup> NK cells were sorted via FACS as CD3<sup>&#x2212;</sup>CD56<sup>+</sup>NKG2A<sup>+</sup> in a BD FACSAria&#x2122; III Cell Sorter. Isolated cells were then expanded by being co-cultured with irradiated (100 Gy) K562 cells (E:T 3:1) in RPMI-1640, 10% Human Heat-Inactivated AB Serum, 100 U/mL penicillin and 100 &#xb5;g/mL streptomycin supplemented with 100 U/mL rhIL-2, 10 ng/mL rhIL-15 (Peprotech, Cat#200-15), and 10 ng/mL rhIL-21 (R&amp;D Systems, Cat#8879-IL-010). For some experiments, NKG2A<sup>+</sup> NK cells were kindly offered by the group of Dr. Lotte Wieten (Maastricht University Medical Center).</p>
</sec>
<sec id="s4_3">
<title>Maintenance of T-iPSC</title>
<p>The original T-iPSC clone 1.5 was a kind gift of Dr. Michel Sadelain (Memorial Sloan Kettering Cancer Center). They were cultured on CF-1 mitomycin C-treated MEF cells at approximately 7,500 MEF cells/cm<sup>2</sup> in iPSC medium consisting of DMEM/F12 (Thermo Fisher Scientific, Cat#11330-057) along with 20% KnockOut Serum Replacement (KSR, Cat#10828-028), 2 mM L-glutamine, 1% nonessential amino acids (NEAA, Cat#11140050), and 55 &#x3bc;M 2-mercaptoethanol (Cat#21985023) (all Thermo Fisher Scientific). The medium was enriched with 10 ng/mL human basic fibroblast growth factor (hbFGF) Peprotech], Cat#100-18C-B). T-iPSCs before nucleofection or viral transduction were cultured on plates coated with Cultrex Basement Membrane Extract [(BME), R&amp;D Systems, Cat#3434-010-02] in mTeSR&#x2122; Plus medium (STEMCELL Technologies, Cat#100-0276). For induction of T-cell differentiation based on a monolayer system, T-iPSCs were cultured on Matrigel<sup>&#xae;</sup> Matrix (Corning, Cat#354234) at 1:40 dilution. Medium was refreshed every day and passaging of cells was performed upon treatment with 1 U/mL Dispase (STEMCELL Technologies, Cat#07923) at a ratio of 1:3, every 4&#x2013;5 days. Freezing of iPSCs was performed in medium consisting of 60% KSR, 20% iPSC medium and 10% dimethyl sulfoxide [DMSO (Sigma-Aldrich), D8418-250ml]. Cryovials (Greiner BIO-ONE, Cat#123263) were placed on a Mr Frosty device (Thermo Fisher Scientific, Cat#5100-0001) and stored at &#x2212;80&#xb0;C for 24 h, before being transferred to liquid nitrogen barrels for long-term storage. Frozen cells were thawed on DMEM F/12 medium at 1:10 ratio, centrifuged at 300<italic>g</italic> and seeded on MEFs with iPSC medium. Characterization and cryopreserving of each clone were performed on passage number described in <xref ref-type="table" rid="T1"><bold>Table&#xa0;1</bold></xref>. In principle, each iPSC clone was kept in culture for approximately 15 passages. Pluripotency was tested by flow cytometry upon clone generation, measuring the expression of markers TRA-1-60, TRA-1-81, SSEA-3, and SSEA-4 (data not shown). Mycoplasma testing was performed every 6 months by Eurofins Nederland.</p>
</sec>
<sec id="s4_4">
<title>Mouse strains and animal care</title>
<p>RAG-2<sup>&#x2212;/&#x2212;</sup>&#x3b3;c<sup>&#x2212;/&#x2212;</sup> female mice were bred and maintained at the Amsterdam Animal Research Center (Universitair Proefdiercentrum, AARC-UPC) under proper environmental conditions with free access to water and food. The animal experiments were performed under the approval of the central authority for scientific procedures on animals (CCD) (protocol number AVD114002015345). In strict accordance with the Dutch Animal Experimentation Act, animal welfare was monitored, and euthanasia was induced. Mice (with a minimum of <italic>n</italic> = 4 per group) were randomly assigned to treatment groups and the anti-tumor efficacy was analyzed.</p>
</sec>
<sec id="s4_5">
<title>Generation of genome-edited T-iPSC clones</title>
<p>For the generation of the TCR<sup>&#x2212;/&#x2212;</sup>indCAR clones, CRISPR/Cas9-directed homologous recombination was used. The transgene donor template sequences were integrated in pBluescript (pBS) vector plasmids containing right and left homology arms flanking the starting codon of exon 1 of the <italic>TRAC</italic> locus (kind gift of Dr. Sadelain, MSKCC) (<xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1A</bold></xref>). One donor vector contained the sequence encoding the rtTA and a GFP reporter gene under the control of the Ubic promoter (pBS-TRAC-Ubic-GFPrtTA). The second template contained the sequence of a previously described CD38-CAR (CD38-28&#x3b6;) (<xref ref-type="bibr" rid="B19">19</xref>) or CD1928&#x3b6;-CAR (<xref ref-type="bibr" rid="B10">10</xref>), linked to the mCherry reporter gene, under the transcriptional control of a tetracycline response element (TRE). Both cassettes were inserted in reverse orientation. For targeted integration in the <italic>B2M</italic> locus, the homology arms of the template vector were replaced with sequences flanking the starting codon of <italic>B2M.</italic> The insert sequence contained the BFP reporter gene and the HLA-E SCT as described in Crew et&#xa0;al. (2005) (kind gift of Dr. Seebach, University Hospital of Z&#xfc;rich), driven by the Ubic promoter.</p>
<p>Targeted delivery of the above sequences into the T-iPSC was mediated via CRISPR/Cas9 genomic editing. Briefly, undifferentiated T-iPSC colonies cultured on Cultrex BME-coated plates were dissociated into single cells with Accutase (Thermo Fisher Scientific, Cat#A1110501). For each condition, 4 &#xd7; 10<sup>6</sup> cells were used, which were resuspended in 100 &#xb5;L of Amaxa Cell Line Nucleofector Kit V solution (Lonza, Cat#VCA-1003). From each template plasmid, 2.6 &#xb5;g was added along with 2.6 &#xb5;g of the pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene), which carried the spCas9 gene and a gRNA specific for the <italic>TRAC</italic> or the <italic>B2M</italic> locus. Electroporation took place in an Amaxa Nucleofector II device (Lonza) using program B-025, and after nucleofection, cells were transferred on MEF-plated dishes along with 10 &#xb5;M Y-27632 (Selleckchem, Cat#S1049). Single cell-derived colonies were picked according to reporter gene expression (GFP, mCherry and BFP) using fluorescent microscopy (EVOS FL fluorescence microscope, Life Technologies) or flow cytometry.</p>
<p>Molecular verification of successful genomic editing was performed with PCR using the Phusion Hot Start II High-Fidelity Mastermix (Thermo Fisher Scientific) and specific primer pairs (sequences described in <xref ref-type="table" rid="T2"><bold>Table&#xa0;2</bold></xref>). Briefly, for detecting the template insertion in both alleles of the <italic>TRAC</italic> locus, primers were designed binding or flanking the left and right homology arms (TRAC-1 and TRAC-2). In addition, the insertion of both separate template sequences was confirmed by PCR with primers specific for amplifying GFP and mCherry coding sequences (GFP-1 and -2, mCherry-1 and -2). Similarly, to confirm the insertion of BFP and HLA-E genes in the <italic>B2M</italic> locus, we performed a PCR with primers amplifying a targeted version of the locus (primers &#x3b2;2m-1 and &#x3b2;2m-2) and a second PCR with primers specific for the non-modified locus (primers &#x3b2;2m-3 and &#x3b2;2m-4) (see <xref ref-type="table" rid="T2"><bold>Table&#xa0;2</bold></xref>).</p>
<p>Karyotypic analysis of the edited clones was performed by the Department Human Genetics at VU Medical Center. Verification of editing was performed upon sufficient expansion of each generated line, which took place approximately one to two passages after each round of genome editing.</p>
</sec>
<sec id="s4_6">
<title>RT-PCR for CAR mRNA detection</title>
<p>RNA was isolated from iT cells on different phases of dox treatment by using TRIzol&#x2122; Reagent (Thermo Fisher Scientific, Cat#15596026) following the manufacturer&#x2019;s guidelines. cDNA was subsequently synthesized by using the SuperScript&#x2122; IV First-Strand Synthesis System (Thermo Fisher Scientific, Cat#8091050). For RT-PCR, the Phusion Hot Start II High-Fidelity PCR Master Mix (Thermo Fisher Scientific, Cat#F565S) was used for amplification by employing CD38 CAR-E2A-mCherry cDNA primers 1 and 2 (see <xref ref-type="table" rid="T2"><bold>Table&#xa0;2</bold></xref>).</p>
</sec>
<sec id="s4_7">
<title>Generation of UM9-CD38KO cells</title>
<p>UM9 cells were transfected with the pX330-U6-Chimeric_BB-CBh-hSpCas9 vector containing a gRNA for CD38 (see <xref ref-type="table" rid="T2"><bold>Table&#xa0;2</bold></xref>). After expansion, UM9-CD38KO cells were selected after sorting based on CD38 negativity.</p>
</sec>
<sec id="s4_8">
<title>Southern blot</title>
<p>Genomic DNA of T-iPSC clones was obtained by phenol/chloroform extraction. Southern blot analysis was carried out with 10 &#xb5;g of genomic DNA digested with the appropriate restriction enzymes (BamHI or NcoI). The probes corresponding to GFP (299-bp fragment), mCherry (300-bp fragment), and BFP (302-bp fragment) were generated by PCR and labeled with 32P-dCTP using the Random Primers DNA Labeling System (Invitrogen).</p>
</sec>
<sec id="s4_9">
<title>Western blot</title>
<p>T-iPSC colonies treated with or without dox were lysed for 45 min in radioimmunoprecipitation assay (RIPA) lysis buffer (50&#x2009;mM Tris, pH 7.4, 150&#x2009;mM NaCl, 1% NP40, 0.5% sodium deoxycholate, and 0.1% SDS) supplemented with cOmplete&#x2122;, Mini Protease Inhibitor Cocktail (Roche, Cat#11836153001) to allow protein extraction. Protein amount was quantified by using a bovine serum albumin (BSA) standard curve. For immunoblotting, 10 &#xb5;g of protein lysate was loaded on 4%&#x2013;20% precast gels (Bio-Rad, Cat#4561095) and proteins were fractioned by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Gel was then transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Cat#IPFL00010). Blocking was performed by using 5% w/v non-fat dried milk powder (Nutricia, Cat#8712400117654) for at least 30 min in PBS/0.1% Tween (PBS/T). For CAR identification, membranes were incubated overnight with an anti-CD247 monoclonal antibody (1D4) 1:250, purchased from BD Biosciences, at 4&#xb0;C. After washing with PBS/T, membranes were incubated with horseradish peroxidase-conjugated rabbit anti-mouse secondary antibody, 1:2,000 purchased from Cell Signaling Technology, for 1 h at room temperature. Actin detection was used as positive control by staining with a mouse anti-human actin antibody (C4), 1:5,000 purchased from Sigma-Aldrich. Results were visualized by digital fluorescence in Odyssey machine (Licor).</p>
</sec>
<sec id="s4_10">
<title>Differentiation of T-iPSC into CAR-iT cells</title>
<p>T-iPSCs were differentiated into T lineage cells using a previously described protocol with modifications. In brief, undifferentiated T-iPSC colonies were treated with 1 U/mL Dispase and transferred into ultra-low attachment plates to allow embryoid body (EB) formation. EBs were cultured in StemPro-34 medium (Thermo Fisher Scientific, Cat#10639-011) supplemented with 2 mM L-glutamine, 1% NEAA, 55 &#x3bc;M 2-mercaptoethanol, 100 U/mL penicillin, 100 &#xb5;g/mL streptomycin, and 50 mg/mL L-ascorbic acid (Thermo Fisher Scientific, Cat#A4544). EB formation was facilitated by overnight incubation along with 30 ng/mL rhBMP-4 (R&amp;D Systems, Cat#314-BP-010/CF). Medium was refreshed the next day and EBs were then cultured with 30 ng/mL rhBMP4 and 5 ng/mL hbFGF until day 3 to promote mesoderm induction. Afterwards, hematopoietic specification was achieved by the addition of 20 ng/mL rhVEGF (Peprotech, Cat#100-20-B) and 5 ng/mL hbFGF as well as a cocktail of hematopoietic cytokines [100 ng/mL rhSCF (Cat#300-07_100&#x3bc;g), 20 ng/mL rhFlt3L (Cat#300-19B), and 20 ng/mL rhIL-3 (Cat#200-03B) (all Peprotech)]. Medium was refreshed every 2 days until day 9 (hbFGF was added until day 7), where EBs were dissociated by treatment with Accutase and mechanical disruption to allow egression of CD34<sup>+</sup> cells.</p>
<p>For experiments regarding cell yield, a previously described monolayer protocol with slight modifications was used (<xref ref-type="bibr" rid="B37">37</xref>, <xref ref-type="bibr" rid="B38">38</xref>). Briefly, on day 3, T-iPSC colonies were dissociated into single cells via treatment with Accutase and seeded onto Matrigel-coated plates (1:40 dilution) at a concentration of 4.2 &#xd7; 10<sup>4</sup> cells/cm<sup>2</sup> cultured in mTeSR&#x2122; Plus medium supplemented with 10&#xb5;M Y-27632. After 24 h, Y-27632 compound was removed and T-iPSCs were cultured in mTeSR&#x2122; Plus medium for an additional 2 days. On day 0, medium was changed into HEP medium consisting of RPMI-1640 medium without glutamine (Cat#31870074), 2% B-27&#x2122; (Cat#17504044), 2&#x2009;mM GlutaMAX&#x2122; (Cat#35050061) (all from Gibco), and 60&#x2009;&#x3bc;g/mL L-ascorbic acid (Sigma-Aldrich), supplemented with 6&#x2009;&#x3bc;M GSK3 inhibitor CHIR990921 (Merck, Cat#S2924). On day 2, medium was changed into HEP medium along with 50 ng/mL rhVEGF and 10 ng/mL hbFGF. The following day (day 3), cells were replated onto Matrigel-coated plates at a concentration of 5.2 &#xd7; 10<sup>4</sup> cells/cm<sup>2</sup> cultured with HEP medium along with 50 ng/mL VEGF and 10 ng/mL bFGF and 10 &#xb5;M SB431542 (Merck Millipore, Cat#616461). Medium was refreshed on day 4, and on day 5, CD34<sup>+</sup> hematoendothelial progenitors (HEPs) were cultured on OP9-DL4 feeder layers as described below.</p>
<p>T lineage commitment was induced by culturing generated hematopoietic progenitors into OP9-DL1 or OP9-DL4 monolayers in a T-cell differentiation medium consisting of OP9 medium along with 1% NEAA, 55 &#x3bc;M 2-mercaptoethanol, 100 U/mL penicillin, 100 &#xb5;g/mL streptomycin, and 50 mg/mL L-ascorbic acid. For efficient T-cell generation, T differentiation medium was enriched with 10 ng/mL rhSCF, 5 ng/mL rhIL-7, and 10 ng/mL rhFlt3L (all Peprotech). Medium was refreshed every 2 days and differentiating cells were transferred into a new monolayer every 5 days until day 25, where the presence of CD4<sup>+</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> DP cells was observed. OP9-DL1 or OP9-DL4 cells were seeded a day prior to the cell transfer at a concentration of 2.1 &#xd7; 10<sup>4</sup> cells/cm<sup>2</sup> in OP9 cell culture medium. For further maturation into CD8<sup>+</sup> SP T cells, CD4<sup>+</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> DP thymocytes were seeded on OP9-DL1 or OP9-DL4 feeder layers in T-cell differentiation medium supplemented with rhIL-7, rhFlt3L, and rhSCF along with 1 &#xb5;g/mL dox (Clontech Laboratories, Cat#631311). After 48 h, dox was washed out and cells were cultured in RPMI-1640 supplemented with 10% FBS, 100 U/mL penicillin, and 100 &#xb5;g/mL streptomycin supplemented with 10 ng/mL IL-7, until used for downstream assays.</p>
</sec>
<sec id="s4_11">
<title><italic>In vitro</italic> expansion of CAR-iT cells</title>
<p>A total of 2 &#xd7; 10<sup>5</sup> CD38 CAR-iT cells were co-cultured with a feeder mix containing 1 &#xd7; 10<sup>5</sup> EBV-LCLs (two donors) and 1 &#xd7; 10<sup>6</sup> PBMCs (three donors). PBMCs were irradiated with 25 Gy and EBV-LCLs were irradiated with 50 Gy. Cell mixture was suspended in medium containing RPMI-1640, 10% FBS, 100 U/mL penicillin, and 100 &#xb5;g/mL streptomycin enriched with 1 &#xb5;g/mL dox, 100 U/mL rhIL-2, 10 ng/mL rhIL-7, and 10 ng/mL IL-15. Medium along with cytokines and dox was replenished after 4 days. On the experiments assessing alloreactive potential, 1 &#xb5;g/mL PHA-L was also added on the proliferation medium. In some experiments, CD38 CAR-iT cells were expanded in a feeder-mix consisting of irradiated EBV-LCLs (50 Gy) at a ratio 1:2.5 resuspended in RPMI proliferation medium as described above along with 1 &#xb5;g/mL dox, 10 ng/mL rhIL-7, and 10 ng/mL rhIL-21. Fresh medium along with dox and cytokines was added after 4 days. For the maturation of CD19 CAR-iT cells, 150,000 effectors cells were co-cultured with 50,000 irradiated (50 Gy) 3T3-CD19 cells on Tdiff medium along with dox and cytokines for 7 days as described above. To assess the proliferation potential, mature CD19 CAR-iT cells were expanded on 3T3-CD19<sup>+</sup> at E:T 3:1 on proliferation medium along with 1 &#xb5;g/mL dox, 100 U/mL rhIL-2, 10 ng/mL rhIL-7, and 10 ng/mL IL-15 for 7 days.</p>
<p>For assessment of proliferation potential, CAR-iT cells were stained with 1 &#x3bc;&#x3bc; Cell Trace Far Red (Thermo Fisher Scientific, Cat#C34564) according to manufacturer&#x2019;s guidelines. Proliferation capacity was assessed after 1 week of stimulation with the allogeneic feeder mix as described above and evaluated by flow cytometry.</p>
<p>Data were further analyzed with FCS Express v7.</p>
</sec>
<sec id="s4_12">
<title>Generation of primary CAR-T cells</title>
<p>Primary CAR-T cells were generated as previously described (<xref ref-type="bibr" rid="B39">39</xref>). Healthy donor PBMCs were stimulated with 1 &#xb5;g/mL PHA-L at a concentration of 3 &#xd7; 10<sup>6</sup>/well for 48 h. Activated T cells were transduced to express a CD38-28&#x3b6; CAR with &#x3b3;-retroviral particles produced by a stable virus producer cell line 293Vec-RD114 (BioVec Pharma Inc.). TRE-mock T cells were generated by retroviral transduction with mock-LNGFR and TET viruses as previously described (<xref ref-type="bibr" rid="B19">19</xref>) Cell mixture along with 4 &#xb5;g/mL polybrene (Sigma-Aldrich, Cat#107689) was spinoculated at 1500<italic>g</italic> for 1 h in RT followed by a second transduction step with fresh virus the day after. Twenty-four hours after the second transduction, two-thirds of the medium were replaced with fresh RPMI-1640 medium along with 10% FCS, 100 U/mL penicillin, 100 &#xb5;g/mL streptomycin, and 10 ng/mL rhIL-7.</p>
</sec>
<sec id="s4_13">
<title>Bioluminescence-based cytotoxicity assay</title>
<p>CAR-iT cells, treated with dox for 48 h to allow CAR expression or expanded after 1 week in feeder mix, were incubated with 10,000 Luc-GFP UM9 cells in different effector-to-target ratios. Cytotoxicity was determined after 16 h as the fraction of surviving UM9 cells based on bioluminescence emission after the addition of 125 mg/mL D-luciferin (Promega, Cat#E1605) for 30 min. Bioluminescence signal was quantified with a GloMax 96 Microplate Luminometer (Promega), and the percent lysis was measured based on the formula: 1 &#x2212; (BLI signal in treated wells/BLI signal in untreated wells) &#xd7; 100%.</p>
<p>To test their immunogenic potential, engineered T-iPSC were stably transduced with a lentiviral vector encoding Luciferase (Luc) and a puromycin selection marker (puro) [pRRL-cPPT-CMV-Luc2-IRES-GFP-PRE-SIN, after replacing GFP with a puromycin]. Luc-T-iPSC were seeded on Cultrex BME-coated plates cultured with mTESR medium supplemented with 500 U/mL recombinant human interferon-gamma (rhIFN-&#x3b3;) (Peprotech, Cat#300-02) for 48&#x2013;72 h to induce HLA class I upregulation. T-iPSC clones were then co-cultured either with allo-HLA-A*02 T cells or with NK cells for 24 h and bioluminescence signal was quantified as described above.</p>
</sec>
<sec id="s4_14">
<title>Flow cytometry-based cytotoxicity assay</title>
<p>Allo-HLA-A*02 T cells were co-cultured with TCR&#x3b1;<sup>&#x2212;/&#x2212;</sup>&#x3b2;2m<sup>+/+</sup>and TCR&#x3b1;<sup>&#x2212;/&#x2212;</sup>&#x3b2;2m<sup>&#x2212;/&#x2212;</sup>HLA-E<sup>+</sup> CD4<sup>+</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> iDP thymocytes at serial dilutions for 24 h. To test the immunogenicity against NK cells, freshly isolated and expanded NKG2A<sup>+</sup> NK cells were co-cultured with TCR&#x3b1;<sup>+/+</sup>&#x3b2;2m<sup>&#x2212;/&#x2212;</sup> and TCR&#x3b1;<sup>&#x2212;/&#x2212;</sup>&#x3b2;2m<sup>&#x2212;/&#x2212;</sup>HLA-E<sup>+</sup> CD4<sup>+</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> iDP thymocytes at a ratio 9:1 for 24 h. Absolute numbers were calculated by using Flow-Count Fluorospheres (Beckman Coulter, Cat#7547053) as a reference. Percentage cell lysis was calculated as: % lysis = 1 &#x2212; ((# viable target cells in treated wells/# of beads)/(# viable target cells in untreated wells/# of beads)) &#xd7; 100%.</p>
</sec>
<sec id="s4_15">
<title>Cytokine measurement</title>
<p>To measure the levels of secreted cytokines, supernatants from co-cultures of CAR-iT against UM9 were collected after 24 h. Cytokine amount was determined using the Cytometric Bead Array (CBA) Human Th1/Th2/Th17 Kit (BD Biosciences, Cat#560484) following the manufacturer&#x2019;s guidelines.</p>
</sec>
<sec id="s4_16">
<title>Immunophenotyping</title>
<p>The following conjugated antibodies were used for flow cytometry analysis: CD7-PE/Cy7 (CD7-6B7), 1:100; CD8&#x3b1; PE/Cy7 (HIT8a), 1:100 purchased from Sony Biotechnology; CD3-FITC (SK7), 1:50; CD3-BUV395 (UCHT1), 1:100; CD3-BUV737 (UCHT1), 1:100; CD4-BV650 (L200), 1:100; CD4-BUV395 (SK3), 1:100; CD8&#x3b2;-APC (2ST8.5H7), 1:25; CD38-HV450 (HB7), 1:20; CD45RA-BUV737 (HI100), 1:100; CD56-BUV737 (NCAM16.2), 1:100 purchased from BD Biosciences; CD5-PerCP (UCHT2),1:50; CD8&#x3b1;-APC/Cy7 (Hit8a), 1:50; CD27-BV785 (O323), 1:100; CD28-BV650 (CD28.2), 1:100; CD45RA-BV421 (HI100), 1:100; CD56-BV785 (5.1H11), 1:100; CD62L-PE/Cy7 (DREG-56), 1:100; CD159a (NKG2A)-APC (S19004C), 1:20; CD197 [CCR7 (G043H7)]-BV650, 1:50; HLA-ABC-PE/Cy7 (W6/32), 1:100; HLA-E-APC (3D12), 1:50; Zombie Aqua Fixable Viability Kit, 1:500; purchased from BioLegend; CD56-PE/Cy7 (N901) 1:100 purchased from Beckman Coulter; TCR&#x3b1;&#x3b2;-APC (IP26), 1:50; TCR&#x3b1;&#x3b2;-SuperBright780 (IP26), 1:100; LIVE/DEAD&#x2122; Fixable Near-IR Dead Cell Stain Kit, 1:1,000; Fixable Viability Dye eFluor&#x2122; 455UV, 1:500 purchased from Thermo Fisher Scientific; CD5-RPE (DK23), 1:50 purchased from Dako; and F(ab&#x2032;)<sub>2</sub> Fragment Goat Anti-Human IgG Fc&#x3b3; fragment specific-AF647, 1:100 purchased from Jackson ImmunoResearch. GFP, mCherry, and BFP expression was measured in the FITC, PE-CF594, and DAPI channels, respectively. Sample readout was performed in LSRFortessa cytometer (BD Biosciences), and results were analyzed by using the FCS Express Flow Cytometry Version 6 software. Cell sorting was performed in in a BD FACSAria&#x2122; III Cell Sorter. For vendors and catalogue numbers, refer to <xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Table S1</bold></xref>.</p>
</sec>
<sec id="s4_17">
<title><italic>In vivo</italic> xenograft studies</title>
<p>Hybrid scaffolds were subcutaneously implanted in mice, each consisting of three 2- to 3-mm<sup>3</sup> biphasic calcium phosphate particles, coated <italic>in vitro</italic> with human BM mesenchymal stromal cells (BM-MSC; 2 &#xd7; 10<sup>5</sup> cells/scaffold). Eight to twelve weeks after implantation, mice were injected with Busulfan intraperitoneally [(18 mg/kg in 500 &#x3bc;L) (day &#x2212;5), Teva], and the next day, they were intra-scaffold injected with luciferase-transduced multiple myeloma cells (0.5 &#xd7; 10<sup>6</sup> UM9 per scaffold) (day &#x2212;4). Four days after injection of tumor cells (day 0), mice received indCD38CAR-iT cells (0.5 &#xd7; 10<sup>6</sup> cells/mice, <italic>n</italic> = 3 mice, 1 mouse did not survive anesthesia of day 0) intravenously or PBS (<italic>n</italic> = 4 mice). From day 0 until the end of the experiment, doxycycline (5 mg/kg) was intraperitoneally injected, at specific groups, three times per week. rhIL-15 was injected intraperitoneally (5 &#x3bc;g) from day 0 until day 10, every 2 days. rhIL-2 was injected intraperitoneally (50,000 U) every day from day 0 until day 10. Tumor growth was monitored by weekly bioluminescence (BLI) measurements using a PhotonIMAGER (Biospace Lab) (intraperitoneal injection of 100 &#x3bc;L of D-luciferin). To induce anesthesia, mice were subjected to isoflurane inhalation, 3% for initial induction and 1.5% for subsequent anesthesia. Upon reaching the Human Endpoint as established by the CCD, mice were euthanized by inhalation of 20% CO<sub>2</sub>.</p>
</sec>
<sec id="s4_18">
<title>Statistical analysis</title>
<p>Data analysis and visualization were performed using GraphPad Prism v9.5.1 software. No pre-specified effect size was used to determine sample sizes. Graphs represent individual values &#xb1; standard error of the mean (SEM) for biological replicates or standard deviation (SD) for technical replicates. Normal data distribution was calculated by Shapiro-Wilk test. The statistical tests that were used to calculate the <italic>p</italic>-values are described in the relevant figure legends. Differences were considered significant at <italic>p</italic> &lt; 0.05 and <italic>p</italic>-values are denoted with asterisks as follows: *<italic>p</italic> &lt; 0.05, **<italic>p</italic> &lt; 0.01, ***<italic>p</italic> &lt; 0.001, ****<italic>p</italic> &lt; 0.0001, ns, not significant.</p>
</sec>
</sec>
</body>
<back>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/<xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Material</bold></xref>. Further inquiries can be directed to the corresponding author.</p></sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>Ethical approval was not required for the studies involving humans because peripheral blood samples from healthy volunteers donated upon informed consent were purchased by the Sanquin Blood bank. The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study. The animal study was approved by Central Authority for Scientific Procedures on Animals (CCD) and Instantie voor dierenwelzijn (IvD), Amsterdam UMC. The study was conducted in accordance with the local legislation and institutional requirements.</p></sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>AN: Data curation, Formal analysis, Investigation, Methodology, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing. AK: Data curation, Formal analysis, Investigation, Methodology, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing. H-JP: Data curation, Formal analysis, Investigation, Methodology, Writing &#x2013; review &amp; editing. AS: Investigation, Writing &#x2013; review &amp; editing. CV: Investigation, Writing &#x2013; review &amp; editing. LH: Investigation, Writing &#x2013; review &amp; editing. RR: Data curation, Investigation, Writing &#x2013; review &amp; editing. TM: Funding acquisition, Project administration, Resources, Supervision, Writing &#x2013; review &amp; editing. RG: Funding acquisition, Project administration, Resources, Supervision, Writing &#x2013; review &amp; editing. MT: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing.</p></sec>
<ack>
<title>Acknowledgments</title>
<p>The authors would like to thank Michel Sadelain (MSKCC) and J&#xf6;rg Seebach (University Hospital Zurich) for providing materials for this study. Figures were generated with BioRender.</p>
</ack>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>AK is inventor of unrelated patents on CAR-T cell technologies. TM has received research support from Janssen Research and Development, Celgene, Onkimmune, and Genmab. MT is inventor of patents and patent applications related to the development of CARs and CAR-T cells from iPSC.</p>
<p>The remaining author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p></sec>
<sec id="s10" sec-type="ai-statement">
<title>Generative AI statement</title>
<p>The author(s) declared that generative AI was not used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p></sec>
<sec id="s11" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p></sec>
<sec id="s12" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fimmu.2026.1757174/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fimmu.2026.1757174/full#supplementary-material</ext-link></p>
<supplementary-material xlink:href="Table1.docx" id="ST1" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
<supplementary-material xlink:href="Image1.jpeg" id="SM1" mimetype="image/jpeg"><label>Supplementary Figure S1</label>
<caption>
<p>Original PCR gel related to <xref ref-type="fig" rid="f1"><bold>Figure 1B</bold></xref>. </p>
</caption></supplementary-material>
<supplementary-material xlink:href="Image2.jpeg" id="SM2" mimetype="image/jpeg"><label>Supplementary Figure S2</label>
<caption>
<p>Original PCR gel related to <xref ref-type="fig" rid="f1"><bold>Figure 1C</bold></xref>. </p>
</caption></supplementary-material>
<supplementary-material xlink:href="Image3.jpeg" id="SM3" mimetype="image/jpeg"><label>Supplementary Figure S3</label>
<caption>
<p>Original Southern Blot related to <xref ref-type="fig" rid="f1"><bold>Figure 1D</bold></xref>. <bold>(A)</bold> Verification for the specific integration of the GFP donor cassette into the <italic>TRAC</italic> locus <bold>(B)</bold> Target-specific confirmation for the integration of the mCherry donor template into the <italic>TRAC</italic> locus. </p>
</caption></supplementary-material>
<supplementary-material xlink:href="Image4.jpeg" id="SM4" mimetype="image/jpeg"><label>Supplementary Figure S4</label>
<caption>
<p>Original immunoblot related to <xref ref-type="fig" rid="f1"><bold>Figure 1F</bold></xref>. </p>
</caption></supplementary-material>
<supplementary-material xlink:href="Image5.jpeg" id="SM5" mimetype="image/jpeg"><label>Supplementary Figure S5</label>
<caption>
<p>Karyotypic analysis of WT and <italic>TCR&#x3b1;</italic><sup>-/-</sup> indCAR T-iPSC. Both the parental and the edited T-iPSC lines had a normal 46, XY karyotype. </p>
</caption></supplementary-material>
<supplementary-material xlink:href="Image1.jpeg" id="SM6" mimetype="image/jpeg"><label>Supplementary Figure S6</label>
<caption>
<p>Immunophenotypic profile of TCRneg DP and indCD38CAR-iT cells. <bold>(A)</bold> Representative plots for T cell markers iDP thymocytes derived from clone GFP1. <bold>(B)</bold> Flow cytometry analysis of GFP1 TCR<sup>neg</sup> CD8&#x3b1;&#x3b2;<sup>+</sup> indCD38CAR-iT cells after addition of dox for 48h. <bold>(C)</bold> Representative plot for CD38 expression at CD4<sup>+</sup>CD8&#x3b1;&#x3b2;<sup>+</sup> iDP thymocyte and CAR-iT CD8 SP stage derived from clone GFP9. <bold>(D)</bold> Relative fratricide upon CD38 engagement compared to iDP cells (n=3 independent differentiations). <bold>(E)</bold> Immunophenotype TCR<sup>neg</sup> indCD19CAR-iT without dox (iDP stage), after dox without CD19 engagement and after dox addition upon CD19 encounter. of <bold>(F)</bold> Immunophenotyping of TCR<sup>neg</sup> indCD38CAR-iT compared to primary CD8<sup>+</sup> CD38CAR-T cells after 5 days of dox withdrawal or second transduction hit respectively. <bold>(G)</bold> RT-PCR for CAR expression on GFP9-derived cells at iDP, CD8 SP after dox and CD8 SP after removal of dox stage. <bold>(H)</bold> Flow cytometry analysis for surface expression kinetics of CD38 CAR. Grey histograms represent CAR expression on DP thymocytes without dox and red ones on CAR-iT after dox addition. <bold>(I)</bold> Expansion potential after weekly stimulations of CD38CAR-iT (clone 1.5 GFP4, n=1) <bold>(J)</bold> Proliferation capacity of CD19CAR-iT cells after weekly rechallenges (clone 1.5 19 G8, n=1). </p>
</caption></supplementary-material>
<supplementary-material xlink:href="Image7.jpeg" id="SM7" mimetype="image/jpeg"><label>Supplementary Figure S7</label>
<caption>
<p>Original PCR gel related to <xref ref-type="supplementary-material" rid="SM1"><bold>Figure S6G</bold></xref>. </p>
</caption></supplementary-material>
<supplementary-material xlink:href="Image8.jpeg" id="SM8" mimetype="image/jpeg"><label>Supplementary Figure S8</label>
<caption>
<p>Validation of &#x3b2;2m locus editing and insertion of the HLA-E SCT expression-cassette. <bold>(A)</bold> PCR strategy for confirmation of successful integration for HLA-E SCT template into the <italic>&#x3b2;2m</italic> locus. Arrows show the amplified areas. Successful insertion creates a fragment of 1765 bp whereas the wild type generates a band of 2019 bp. <bold>(B)</bold> Representative flow cytometry plots for BFP, HLA class I (HLA-ABC) and HLA-E expression on GFP9BFP2.3 TCR&#x3b1;<sup>-/-</sup> &#x3b2;2m<sup>-/-</sup> HLA-E<sup>+</sup> indCAR-T-iPSCs compared to the WT. <bold>(C)</bold> Karyotypic analysis of <italic>TCR&#x3b1;</italic><sup>-/</sup>- <italic>&#x3b2;2m</italic><sup>-/</sup>- HLA-E<sup>+</sup> indCAR and <italic>&#x3b2;2m</italic><sup>-/</sup>- HLA-E<sup>+</sup> T-iPSC. </p>
</caption></supplementary-material>
<supplementary-material xlink:href="Image9.jpeg" id="SM9" mimetype="image/jpeg"><label>Supplementary Figure S9</label>
<caption>
<p>Original non-targeted PCR gel related to <xref ref-type="supplementary-material" rid="SM1"><bold>Figure S8B</bold></xref>. </p>
</caption></supplementary-material>
<supplementary-material xlink:href="Image10.jpeg" id="SM10" mimetype="image/jpeg"><label>Supplementary Figure S10</label>
<caption>
<p>Original Southern Blot related to <xref ref-type="fig" rid="f1"><bold>Figure 4D</bold></xref>. </p>
</caption></supplementary-material>
<supplementary-material xlink:href="Image11.jpeg" id="SM11" mimetype="image/jpeg"><label>Supplementary Figure S11</label>
<caption>
<p>Use of DL4 is needed for successful T cell development upon lack of B2M. <bold>(A)</bold> Representative flow cytometry plots of CD4 and CD8 expression in the presence or absence of B2M expression after co-culture with either OP9-DL1 or OP9-DL4 feeder cells for 25 days. <bold>(B)</bold> Immunophenotypic analysis TCR<sup>neg</sup> B2M<sup>neg</sup> indCD38CAR-iT after 5 days of dox withdrawal. <bold>(C)</bold> Histograms of surface CD38 CAR expression on TCR<sup>neg</sup> B2M<sup>neg</sup> indCD38CAR-iT cells upon dox withdrawal. Grey peaks display show CAR expression on no dox-treated iDP thymocytes and blue ones on CAR-iT after dox withdrawal. </p>
</caption></supplementary-material></sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Bersenev</surname> <given-names>A</given-names></name>
</person-group>. 
<article-title>CAR-T cell manufacturing: time to put it in gear</article-title>. <source>Transfusion</source>. (<year>2017</year>) <volume>57</volume>:<page-range>1104&#x2013;6</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/trf.14110</pub-id>, PMID: <pub-id pub-id-type="pmid">28425600</pub-id>
</mixed-citation>
</ref>
<ref id="B2">
<label>2</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Tyagarajan</surname> <given-names>S</given-names></name>
<name><surname>Spencer</surname> <given-names>T</given-names></name>
<name><surname>Smith</surname> <given-names>J</given-names></name>
</person-group>. 
<article-title>Optimizing CAR-T cell manufacturing processes during pivotal clinical trials</article-title>. <source>Mol Ther Methods Clin Dev</source>. (<year>2020</year>) <volume>16</volume>:<page-range>136&#x2013;44</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.omtm.2019.11.018</pub-id>, PMID: <pub-id pub-id-type="pmid">31988978</pub-id>
</mixed-citation>
</ref>
<ref id="B3">
<label>3</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Haradhvala</surname> <given-names>NJ</given-names></name>
<name><surname>Leick</surname> <given-names>MB</given-names></name>
<name><surname>Maurer</surname> <given-names>K</given-names></name>
<name><surname>Gohil</surname> <given-names>SH</given-names></name>
<name><surname>Larson</surname> <given-names>RC</given-names></name>
<name><surname>Yao</surname> <given-names>N</given-names></name>
<etal/>
</person-group>. 
<article-title>Distinct cellular dynamics associated with response to CAR-T therapy for refractory B cell lymphoma</article-title>. <source>Nat Med</source>. (<year>2022</year>) <volume>28</volume>:<page-range>1848&#x2013;59</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41591-022-01959-0</pub-id>, PMID: <pub-id pub-id-type="pmid">36097221</pub-id>
</mixed-citation>
</ref>
<ref id="B4">
<label>4</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Benjamin</surname> <given-names>R</given-names></name>
<name><surname>Graham</surname> <given-names>C</given-names></name>
<name><surname>Yallop</surname> <given-names>D</given-names></name>
<name><surname>Jozwik</surname> <given-names>A</given-names></name>
<name><surname>Mirci-Danicar</surname> <given-names>OC</given-names></name>
<name><surname>Lucchini</surname> <given-names>G</given-names></name>
<etal/>
</person-group>. 
<article-title>Genome-edited, donor-derived allogeneic anti-CD19 chimeric antigen receptor T cells in paediatric and adult B-cell acute lymphoblastic leukaemia: results of two phase 1 studies</article-title>. <source>Lancet</source>. (<year>2020</year>) <volume>396</volume>:<page-range>1885&#x2013;94</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0140-6736(20)32334-5</pub-id>, PMID: <pub-id pub-id-type="pmid">33308471</pub-id>
</mixed-citation>
</ref>
<ref id="B5">
<label>5</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Qasim</surname> <given-names>W</given-names></name>
<name><surname>Zhan</surname> <given-names>H</given-names></name>
<name><surname>Samarasinghe</surname> <given-names>S</given-names></name>
<name><surname>Adams</surname> <given-names>S</given-names></name>
<name><surname>Amrolia</surname> <given-names>P</given-names></name>
<name><surname>Stafford</surname> <given-names>S</given-names></name>
<etal/>
</person-group>. 
<article-title>Molecular remission of infant B-ALL after infusion of universal TALEN gene-edited CAR T cells</article-title>. <source>Sci Transl Med</source>. (<year>2017</year>) <volume>9</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/scitranslmed.aaj2013</pub-id>, PMID: <pub-id pub-id-type="pmid">28123068</pub-id>
</mixed-citation>
</ref>
<ref id="B6">
<label>6</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Mailankody</surname> <given-names>S</given-names></name>
<name><surname>Matous</surname> <given-names>JV</given-names></name>
<name><surname>Chhabra</surname> <given-names>S</given-names></name>
<name><surname>Liedtke</surname> <given-names>M</given-names></name>
<name><surname>Sidana</surname> <given-names>S</given-names></name>
<name><surname>Oluwole</surname> <given-names>OO</given-names></name>
<etal/>
</person-group>. 
<article-title>Allogeneic BCMA-targeting CAR T cells in relapsed/refractory multiple myeloma: phase 1 UNIVERSAL trial interim results</article-title>. <source>Nat Med</source>. (<year>2023</year>) <volume>29</volume>:<page-range>422&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41591-022-02182-7</pub-id>, PMID: <pub-id pub-id-type="pmid">36690811</pub-id>
</mixed-citation>
</ref>
<ref id="B7">
<label>7</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Ren</surname> <given-names>J</given-names></name>
<name><surname>Liu</surname> <given-names>X</given-names></name>
<name><surname>Fang</surname> <given-names>C</given-names></name>
<name><surname>Jiang</surname> <given-names>S</given-names></name>
<name><surname>June</surname> <given-names>CH</given-names></name>
<name><surname>Zhao</surname> <given-names>Y</given-names></name>
</person-group>. 
<article-title>Multiplex genome editing to generate universal CAR T cells resistant to PD1 inhibition</article-title>. <source>Clin Cancer Res</source>. (<year>2017</year>) <volume>23</volume>:<page-range>2255&#x2013;66</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/1078-0432.CCR-16-1300</pub-id>, PMID: <pub-id pub-id-type="pmid">27815355</pub-id>
</mixed-citation>
</ref>
<ref id="B8">
<label>8</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Themeli</surname> <given-names>M</given-names></name>
<name><surname>Rivi&#xe8;re</surname> <given-names>I</given-names></name>
<name><surname>Sadelain</surname> <given-names>M</given-names></name>
</person-group>. 
<article-title>New cell sources for T cell engineering and adoptive immunotherapy</article-title>. <source>Cell Stem Cell</source>. (<year>2015</year>) <volume>16</volume>:<page-range>357&#x2013;66</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.stem.2015.03.011</pub-id>, PMID: <pub-id pub-id-type="pmid">25842976</pub-id>
</mixed-citation>
</ref>
<ref id="B9">
<label>9</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Nianias</surname> <given-names>A</given-names></name>
<name><surname>Themeli</surname> <given-names>M</given-names></name>
</person-group>. 
<article-title>Induced pluripotent stem cell (iPSC)-derived lymphocytes for adoptive cell immunotherapy: recent advances and challenges</article-title>. <source>Curr Hematol Malig Rep</source>. (<year>2019</year>) <volume>14</volume>:<page-range>261&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11899-019-00528-6</pub-id>, PMID: <pub-id pub-id-type="pmid">31243643</pub-id>
</mixed-citation>
</ref>
<ref id="B10">
<label>10</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Themeli</surname> <given-names>M</given-names></name>
<name><surname>Kloss</surname> <given-names>CC</given-names></name>
<name><surname>Ciriello</surname> <given-names>G</given-names></name>
<name><surname>Fedorov</surname> <given-names>VD</given-names></name>
<name><surname>Perna</surname> <given-names>F</given-names></name>
<name><surname>Gonen</surname> <given-names>M</given-names></name>
<etal/>
</person-group>. 
<article-title>Generation of tumor-targeted human T lymphocytes from induced pluripotent stem cells for cancer therapy</article-title>. <source>Nat Biotechnol</source>. (<year>2013</year>) <volume>31</volume>:<page-range>928&#x2013;33</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nbt.2678</pub-id>, PMID: <pub-id pub-id-type="pmid">23934177</pub-id>
</mixed-citation>
</ref>
<ref id="B11">
<label>11</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Li</surname> <given-names>S</given-names></name>
<name><surname>Wang</surname> <given-names>CS</given-names></name>
<name><surname>Montel-Hagen</surname> <given-names>A</given-names></name>
<name><surname>Chen</surname> <given-names>HC</given-names></name>
<name><surname>Lopez</surname> <given-names>S</given-names></name>
<name><surname>Zhou</surname> <given-names>O</given-names></name>
<etal/>
</person-group>. 
<article-title>Strength of CAR signaling determines T cell versus ILC differentiation from pluripotent stem cells</article-title>. <source>Cell Rep</source>. (<year>2023</year>) <volume>42</volume>:<fpage>112241</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.celrep.2023.112241</pub-id>, PMID: <pub-id pub-id-type="pmid">36906850</pub-id>
</mixed-citation>
</ref>
<ref id="B12">
<label>12</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Carpenter</surname> <given-names>AC</given-names></name>
<name><surname>Bosselut</surname> <given-names>R</given-names></name>
</person-group>. 
<article-title>Decision checkpoints in the thymus</article-title>. <source>Nat Immunol</source>. (<year>2010</year>) <volume>11</volume>:<page-range>666&#x2013;73</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/ni.1887</pub-id>, PMID: <pub-id pub-id-type="pmid">20644572</pub-id>
</mixed-citation>
</ref>
<ref id="B13">
<label>13</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>van der Stegen</surname> <given-names>SJC</given-names></name>
<name><surname>Lindenbergh</surname> <given-names>PL</given-names></name>
<name><surname>Petrovic</surname> <given-names>RM</given-names></name>
<name><surname>Xie</surname> <given-names>H</given-names></name>
<name><surname>Diop</surname> <given-names>MP</given-names></name>
<name><surname>Alexeeva</surname> <given-names>V</given-names></name>
<etal/>
</person-group>. 
<article-title>Generation of T-cell-receptor-negative CD8&#x3b1;&#x3b2;-positive CAR T cells from T-cell-derived induced pluripotent stem cells</article-title>. <source>Nat BioMed Eng</source>. (<year>2022</year>) <volume>6</volume>:<page-range>1284&#x2013;97</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41551-022-00915-0</pub-id>, PMID: <pub-id pub-id-type="pmid">35941192</pub-id>
</mixed-citation>
</ref>
<ref id="B14">
<label>14</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Wang</surname> <given-names>B</given-names></name>
<name><surname>Iriguchi</surname> <given-names>S</given-names></name>
<name><surname>Waseda</surname> <given-names>M</given-names></name>
<name><surname>Ueda</surname> <given-names>N</given-names></name>
<name><surname>Ueda</surname> <given-names>T</given-names></name>
<name><surname>Xu</surname> <given-names>H</given-names></name>
<etal/>
</person-group>. 
<article-title>Generation of hypoimmunogenic T cells from genetically engineered allogeneic human induced pluripotent stem cells</article-title>. <source>Nat BioMed Eng</source>. (<year>2021</year>) <volume>5</volume>:<page-range>429&#x2013;40</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41551-021-00730-z</pub-id>, PMID: <pub-id pub-id-type="pmid">34002062</pub-id>
</mixed-citation>
</ref>
<ref id="B15">
<label>15</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Xu</surname> <given-names>H</given-names></name>
<name><surname>Wang</surname> <given-names>B</given-names></name>
<name><surname>Ono</surname> <given-names>M</given-names></name>
<name><surname>Kagita</surname> <given-names>A</given-names></name>
<name><surname>Fujii</surname> <given-names>K</given-names></name>
<name><surname>Sasakawa</surname> <given-names>N</given-names></name>
<etal/>
</person-group>. 
<article-title>Targeted Disruption of HLA Genes via CRISPR-Cas9 Generates iPSCs with Enhanced Immune Compatibility</article-title>. <source>Cell Stem Cell</source>. (<year>2019</year>) <volume>24</volume>:<fpage>566</fpage>&#x2013;<lpage>78.e7</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.stem.2019.02.005</pub-id>, PMID: <pub-id pub-id-type="pmid">30853558</pub-id>
</mixed-citation>
</ref>
<ref id="B16">
<label>16</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Gornalusse</surname> <given-names>GG</given-names></name>
<name><surname>Hirata</surname> <given-names>RK</given-names></name>
<name><surname>Funk</surname> <given-names>SE</given-names></name>
<name><surname>Riolobos</surname> <given-names>L</given-names></name>
<name><surname>Lopes</surname> <given-names>VS</given-names></name>
<name><surname>Manske</surname> <given-names>G</given-names></name>
<etal/>
</person-group>. 
<article-title>HLA-E-expressing pluripotent stem cells escape allogeneic responses and lysis by NK cells</article-title>. <source>Nat Biotechnol</source>. (<year>2017</year>) <volume>35</volume>:<page-range>765&#x2013;72</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nbt.3860</pub-id>, PMID: <pub-id pub-id-type="pmid">28504668</pub-id>
</mixed-citation>
</ref>
<ref id="B17">
<label>17</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Chimienti</surname> <given-names>R</given-names></name>
<name><surname>Baccega</surname> <given-names>T</given-names></name>
<name><surname>Torchio</surname> <given-names>S</given-names></name>
<name><surname>Manenti</surname> <given-names>F</given-names></name>
<name><surname>Pellegrini</surname> <given-names>S</given-names></name>
<name><surname>Cospito</surname> <given-names>A</given-names></name>
<etal/>
</person-group>. 
<article-title>Engineering of immune checkpoints B7-H3 and CD155 enhances immune compatibility of MHC-I(-/-) iPSCs for &#x3b2; cell replacement</article-title>. <source>Cell Rep</source>. (<year>2022</year>) <volume>40</volume>:<fpage>111423</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.celrep.2022.111423</pub-id>, PMID: <pub-id pub-id-type="pmid">36170817</pub-id>
</mixed-citation>
</ref>
<ref id="B18">
<label>18</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Lilienfeld</surname> <given-names>BG</given-names></name>
<name><surname>Crew</surname> <given-names>MD</given-names></name>
<name><surname>Forte</surname> <given-names>P</given-names></name>
<name><surname>Baumann</surname> <given-names>BC</given-names></name>
<name><surname>Seebach</surname> <given-names>JD</given-names></name>
</person-group>. 
<article-title>Transgenic expression of HLA-E single chain trimer protects porcine endothelial cells against human natural killer cell-mediated cytotoxicity</article-title>. <source>Xenotransplantation</source>. (<year>2007</year>) <volume>14</volume>:<page-range>126&#x2013;34</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1399-3089.2007.00378.x</pub-id>, PMID: <pub-id pub-id-type="pmid">17381687</pub-id>
</mixed-citation>
</ref>
<ref id="B19">
<label>19</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Drent</surname> <given-names>E</given-names></name>
<name><surname>Poels</surname> <given-names>R</given-names></name>
<name><surname>Mulders</surname> <given-names>MJ</given-names></name>
<name><surname>van de Donk</surname> <given-names>N</given-names></name>
<name><surname>Themeli</surname> <given-names>M</given-names></name>
<name><surname>Lokhorst</surname> <given-names>HM</given-names></name>
<etal/>
</person-group>. 
<article-title>Feasibility of controlling CD38-CAR T cell activity with a Tet-on inducible CAR design</article-title>. <source>PloS One</source>. (<year>2018</year>) <volume>13</volume>:<fpage>e0197349</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0197349</pub-id>, PMID: <pub-id pub-id-type="pmid">29847570</pub-id>
</mixed-citation>
</ref>
<ref id="B20">
<label>20</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Konno</surname> <given-names>A</given-names></name>
<name><surname>Okada</surname> <given-names>K</given-names></name>
<name><surname>Mizuno</surname> <given-names>K</given-names></name>
<name><surname>Nishida</surname> <given-names>M</given-names></name>
<name><surname>Nagaoki</surname> <given-names>S</given-names></name>
<name><surname>Toma</surname> <given-names>T</given-names></name>
<etal/>
</person-group>. 
<article-title>CD8&#x3b1;&#x3b1; memory effector T cells descend directly from clonally expanded CD8&#x3b1;+&#x3b2;high TCR&#x3b1;&#x3b2; T cells <italic>in vivo</italic></article-title>. <source>Blood</source>. (<year>2002</year>) <volume>100</volume>:<page-range>4090&#x2013;7</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1182/blood-2002-04-1136</pub-id>, PMID: <pub-id pub-id-type="pmid">12393564</pub-id>
</mixed-citation>
</ref>
<ref id="B21">
<label>21</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Ueda</surname> <given-names>T</given-names></name>
<name><surname>Shiina</surname> <given-names>S</given-names></name>
<name><surname>Iriguchi</surname> <given-names>S</given-names></name>
<name><surname>Terakura</surname> <given-names>S</given-names></name>
<name><surname>Kawai</surname> <given-names>Y</given-names></name>
<name><surname>Kabai</surname> <given-names>R</given-names></name>
<etal/>
</person-group>. 
<article-title>Optimization of the proliferation and persistency of CAR T cells derived from human induced pluripotent stem cells</article-title>. <source>Nat BioMed Eng</source>. (<year>2023</year>) <volume>7</volume>:<fpage>24</fpage>&#x2013;<lpage>37</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41551-022-00969-0</pub-id>, PMID: <pub-id pub-id-type="pmid">36509913</pub-id>
</mixed-citation>
</ref>
<ref id="B22">
<label>22</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Groen</surname> <given-names>RW</given-names></name>
<name><surname>Noort</surname> <given-names>WA</given-names></name>
<name><surname>Raymakers</surname> <given-names>RA</given-names></name>
<name><surname>Prins</surname> <given-names>HJ</given-names></name>
<name><surname>Aalders</surname> <given-names>L</given-names></name>
<name><surname>Hofhuis</surname> <given-names>FM</given-names></name>
<etal/>
</person-group>. 
<article-title>Reconstructing the human hematopoietic niche in immunodeficient mice: opportunities for studying primary multiple myeloma</article-title>. <source>Blood</source>. (<year>2012</year>) <volume>120</volume>:<fpage>e9</fpage>&#x2013;<lpage>e16</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1182/blood-2012-03-414920</pub-id>, PMID: <pub-id pub-id-type="pmid">22653974</pub-id>
</mixed-citation>
</ref>
<ref id="B23">
<label>23</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Riolobos</surname> <given-names>L</given-names></name>
<name><surname>Hirata</surname> <given-names>RK</given-names></name>
<name><surname>Turtle</surname> <given-names>CJ</given-names></name>
<name><surname>Wang</surname> <given-names>PR</given-names></name>
<name><surname>Gornalusse</surname> <given-names>GG</given-names></name>
<name><surname>Zavajlevski</surname> <given-names>M</given-names></name>
<etal/>
</person-group>. 
<article-title>HLA engineering of human pluripotent stem cells</article-title>. <source>Mol Therapy: J Am Soc Gene Ther</source>. (<year>2013</year>) <volume>21</volume>:<page-range>1232&#x2013;41</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/mt.2013.59</pub-id>, PMID: <pub-id pub-id-type="pmid">23629003</pub-id>
</mixed-citation>
</ref>
<ref id="B24">
<label>24</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Crew</surname> <given-names>MD</given-names></name>
<name><surname>Cannon</surname> <given-names>MJ</given-names></name>
<name><surname>Phanavanh</surname> <given-names>B</given-names></name>
<name><surname>Garcia-Borges</surname> <given-names>CN</given-names></name>
</person-group>. 
<article-title>An HLA-E single chain trimer inhibits human NK cell reactivity towards porcine cells</article-title>. <source>Mol Immunol</source>. (<year>2005</year>) <volume>42</volume>:<page-range>1205&#x2013;14</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.molimm.2004.11.013</pub-id>, PMID: <pub-id pub-id-type="pmid">15829309</pub-id>
</mixed-citation>
</ref>
<ref id="B25">
<label>25</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Depil</surname> <given-names>S</given-names></name>
<name><surname>Duchateau</surname> <given-names>P</given-names></name>
<name><surname>Grupp</surname> <given-names>SA</given-names></name>
<name><surname>Mufti</surname> <given-names>G</given-names></name>
<name><surname>Poirot</surname> <given-names>L</given-names></name>
</person-group>. 
<article-title>&#x2018;Off-the-shelf&#x2019; allogeneic CAR T cells: development and challenges</article-title>. <source>Nat Rev Drug Discov</source>. (<year>2020</year>) <volume>19</volume>:<page-range>185&#x2013;99</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41573-019-0051-2</pub-id>, PMID: <pub-id pub-id-type="pmid">31900462</pub-id>
</mixed-citation>
</ref>
<ref id="B26">
<label>26</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Chang</surname> <given-names>PC</given-names></name>
<name><surname>Yuan</surname> <given-names>X</given-names></name>
<name><surname>Zampieri</surname> <given-names>A</given-names></name>
<name><surname>Towns</surname> <given-names>C</given-names></name>
<name><surname>Yoo</surname> <given-names>SP</given-names></name>
<name><surname>Engstrom</surname> <given-names>C</given-names></name>
<etal/>
</person-group>. 
<article-title>Generation of antigen-specific mature T cells from RAG1&#x2013;/&#x2013;RAG2&#x2013;/&#x2013;B2M&#x2013;/&#x2013; stem cells by engineering their microenvironment</article-title>. <source>Nat Biomed Engineering</source>. (<year>2024</year>) <volume>8</volume>:<page-range>461&#x2013;78</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41551-023-01146-7</pub-id>, PMID: <pub-id pub-id-type="pmid">38062131</pub-id>
</mixed-citation>
</ref>
<ref id="B27">
<label>27</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Degagn&#xe9;</surname> <given-names>&#xc9;</given-names></name>
<name><surname>Donohoue</surname> <given-names>PD</given-names></name>
<name><surname>Roy</surname> <given-names>S</given-names></name>
<name><surname>Scherer</surname> <given-names>J</given-names></name>
<name><surname>Fowler</surname> <given-names>TW</given-names></name>
<name><surname>Davis</surname> <given-names>RT</given-names></name>
<etal/>
</person-group>. 
<article-title>High-specificity CRISPR-mediated genome engineering in anti-BCMA allogeneic CAR T cells suppresses allograft rejection in preclinical models</article-title>. <source>Cancer Immunol Res</source>. (<year>2024</year>) <volume>12</volume>(<issue>7</issue>):<page-range>462&#x2013;77</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/2326-6066.CIR-23-0679</pub-id>, PMID: <pub-id pub-id-type="pmid">38345397</pub-id>
</mixed-citation>
</ref>
<ref id="B28">
<label>28</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Rafiq</surname> <given-names>S</given-names></name>
<name><surname>Yeku</surname> <given-names>OO</given-names></name>
<name><surname>Jackson</surname> <given-names>HJ</given-names></name>
<name><surname>Purdon</surname> <given-names>TJ</given-names></name>
<name><surname>van Leeuwen</surname> <given-names>DG</given-names></name>
<name><surname>Drakes</surname> <given-names>DJ</given-names></name>
<etal/>
</person-group>. 
<article-title>Targeted delivery of a PD-1-blocking scFv by CAR-T cells enhances anti-tumor efficacy <italic>in vivo</italic></article-title>. <source>Nat Biotechnol</source>. (<year>2018</year>) <volume>36</volume>:<page-range>847&#x2013;56</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nbt.4195</pub-id>, PMID: <pub-id pub-id-type="pmid">30102295</pub-id>
</mixed-citation>
</ref>
<ref id="B29">
<label>29</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Hosking</surname> <given-names>MP</given-names></name>
<name><surname>Shirinbak</surname> <given-names>S</given-names></name>
<name><surname>Omilusik</surname> <given-names>K</given-names></name>
<name><surname>Chandra</surname> <given-names>S</given-names></name>
<name><surname>Kaneko</surname> <given-names>MK</given-names></name>
<name><surname>Gentile</surname> <given-names>A</given-names></name>
<etal/>
</person-group>. 
<article-title>Preferential tumor targeting of HER2 by iPSC-derived CAR T cells engineered to overcome multiple barriers to solid tumor efficacy</article-title>. <source>Cell Stem Cell</source>. (<year>2025</year>) <volume>32</volume>:<page-range>1087&#x2013;1101.e4</page-range>.. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.stem.2025.05.007</pub-id>, PMID: <pub-id pub-id-type="pmid">40472844</pub-id>
</mixed-citation>
</ref>
<ref id="B30">
<label>30</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Terrence</surname> <given-names>K</given-names></name>
<name><surname>Pavlovich</surname> <given-names>CP</given-names></name>
<name><surname>Matechak</surname> <given-names>EO</given-names></name>
<name><surname>Fowlkes</surname> <given-names>BJ</given-names></name>
</person-group>. 
<article-title>Premature expression of T cell receptor (TCR)alphabeta suppresses TCRgammadelta gene rearrangement but permits development of gammadelta lineage T cells</article-title>. <source>J Exp Med</source>. (<year>2000</year>) <volume>192</volume>:<page-range>537&#x2013;48</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1084/jem.192.4.537</pub-id>, PMID: <pub-id pub-id-type="pmid">10952723</pub-id>
</mixed-citation>
</ref>
<ref id="B31">
<label>31</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Egawa</surname> <given-names>T</given-names></name>
<name><surname>Kreslavsky</surname> <given-names>T</given-names></name>
<name><surname>Littman</surname> <given-names>DR</given-names></name>
<name><surname>von Boehmer</surname> <given-names>H</given-names></name>
</person-group>. 
<article-title>Lineage diversion of T cell receptor transgenic thymocytes revealed by lineage fate mapping</article-title>. <source>PloS One</source>. (<year>2008</year>) <volume>3</volume>:<fpage>e1512</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0001512</pub-id>, PMID: <pub-id pub-id-type="pmid">18231598</pub-id>
</mixed-citation>
</ref>
<ref id="B32">
<label>32</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Maluski</surname> <given-names>M</given-names></name>
<name><surname>Ghosh</surname> <given-names>A</given-names></name>
<name><surname>Herbst</surname> <given-names>J</given-names></name>
<name><surname>Scholl</surname> <given-names>V</given-names></name>
<name><surname>Baumann</surname> <given-names>R</given-names></name>
<name><surname>Huehn</surname> <given-names>J</given-names></name>
<etal/>
</person-group>. 
<article-title>Chimeric antigen receptor-induced BCL11B suppression propagates NK-like cell development</article-title>. <source>J Clin Invest</source>. (<year>2019</year>) <volume>129</volume>:<page-range>5108&#x2013;22</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1172/JCI126350</pub-id>, PMID: <pub-id pub-id-type="pmid">31479431</pub-id>
</mixed-citation>
</ref>
<ref id="B33">
<label>33</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Hunt</surname> <given-names>JMT</given-names></name>
<name><surname>Samson</surname> <given-names>CA</given-names></name>
<name><surname>Ad</surname> <given-names>R</given-names></name>
<name><surname>Sheppard</surname> <given-names>HM</given-names></name>
</person-group>. 
<article-title>Unintended CRISPR-Cas9 editing outcomes: a review of the detection and prevalence of structural variants generated by gene-editing in human cells</article-title>. <source>Hum Genet</source>. (<year>2023</year>) <volume>142</volume>:<page-range>705&#x2013;20</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00439-023-02561-1</pub-id>, PMID: <pub-id pub-id-type="pmid">37093294</pub-id>
</mixed-citation>
</ref>
<ref id="B34">
<label>34</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>DuBose</surname> <given-names>CO</given-names></name>
<name><surname>Daum</surname> <given-names>JR</given-names></name>
<name><surname>Sansam</surname> <given-names>CL</given-names></name>
<name><surname>Gorbsky</surname> <given-names>GJ</given-names></name>
</person-group>. 
<article-title>Dynamic features of chromosomal instability during culture of induced pluripotent stem cells</article-title>. <source>Genes (Basel)</source>. (<year>2022</year>) <volume>13</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/genes13071157</pub-id>, PMID: <pub-id pub-id-type="pmid">35885940</pub-id>
</mixed-citation>
</ref>
<ref id="B35">
<label>35</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Ruggeri</surname> <given-names>L</given-names></name>
<name><surname>Urbani</surname> <given-names>E</given-names></name>
<name><surname>Chiasserini</surname> <given-names>D</given-names></name>
<name><surname>Susta</surname> <given-names>F</given-names></name>
<name><surname>Orvietani</surname> <given-names>PL</given-names></name>
<name><surname>Burchielli</surname> <given-names>E</given-names></name>
<etal/>
</person-group>. 
<article-title>Donor natural killer cells trigger production of &#x3b2;-2-microglobulin to enhance post-bone marrow transplant immunity</article-title>. <source>Blood</source>. (<year>2022</year>) <volume>140</volume>:<page-range>2323&#x2013;34</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1182/blood.2021015297</pub-id>, PMID: <pub-id pub-id-type="pmid">35984965</pub-id>
</mixed-citation>
</ref>
<ref id="B36">
<label>36</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Maeda</surname> <given-names>T</given-names></name>
<name><surname>Nagano</surname> <given-names>S</given-names></name>
<name><surname>Ichise</surname> <given-names>H</given-names></name>
<name><surname>Kataoka</surname> <given-names>K</given-names></name>
<name><surname>Yamada</surname> <given-names>D</given-names></name>
<name><surname>Ogawa</surname> <given-names>S</given-names></name>
<etal/>
</person-group>. 
<article-title>Regeneration of CD8&#x3b1;&#x3b2; T cells from T-cell-derived iPSC imparts potent tumor antigen-specific cytotoxicity</article-title>. <source>Cancer Res</source>. (<year>2016</year>) <volume>76</volume>:<page-range>6839&#x2013;50</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/0008-5472.CAN-16-1149</pub-id>, PMID: <pub-id pub-id-type="pmid">27872100</pub-id>
</mixed-citation>
</ref>
<ref id="B37">
<label>37</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Netsrithong</surname> <given-names>R</given-names></name>
<name><surname>Suwanpitak</surname> <given-names>S</given-names></name>
<name><surname>Boonkaew</surname> <given-names>B</given-names></name>
<name><surname>Trakarnsanga</surname> <given-names>K</given-names></name>
<name><surname>Chang</surname> <given-names>LJ</given-names></name>
<name><surname>Tipgomut</surname> <given-names>C</given-names></name>
<etal/>
</person-group>. 
<article-title>Multilineage differentiation potential of hematoendothelial progenitors derived from human induced pluripotent stem cells</article-title>. <source>Stem Cell Res Ther</source>. (<year>2020</year>) <volume>11</volume>:<fpage>481</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s13287-020-01997-w</pub-id>, PMID: <pub-id pub-id-type="pmid">33176890</pub-id>
</mixed-citation>
</ref>
<ref id="B38">
<label>38</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Duan</surname> <given-names>F</given-names></name>
<name><surname>Huang</surname> <given-names>R</given-names></name>
<name><surname>Zhang</surname> <given-names>F</given-names></name>
<name><surname>Zhu</surname> <given-names>Y</given-names></name>
<name><surname>Wang</surname> <given-names>L</given-names></name>
<name><surname>Chen</surname> <given-names>X</given-names></name>
<etal/>
</person-group>. 
<article-title>Biphasic modulation of insulin signaling enables highly efficient hematopoietic differentiation from human pluripotent stem cells</article-title>. <source>Stem Cell Res Ther</source>. (<year>2018</year>) <volume>9</volume>:<fpage>205</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s13287-018-0934-x</pub-id>, PMID: <pub-id pub-id-type="pmid">30053898</pub-id>
</mixed-citation>
</ref>
<ref id="B39">
<label>39</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Katsarou</surname> <given-names>A</given-names></name>
<name><surname>Sj&#xf6;strand</surname> <given-names>M</given-names></name>
<name><surname>Naik</surname> <given-names>J</given-names></name>
<name><surname>Mansilla-Soto</surname> <given-names>J</given-names></name>
<name><surname>Kefala</surname> <given-names>D</given-names></name>
<name><surname>Kladis</surname> <given-names>G</given-names></name>
<etal/>
</person-group>. 
<article-title>Combining a CAR and a chimeric costimulatory receptor enhances T cell sensitivity to low antigen density and promotes persistence</article-title>. <source>Sci Trans Med</source>. (<year>2021</year>) <volume>13</volume>:<fpage>eabh1962</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/scitranslmed.abh1962</pub-id>, PMID: <pub-id pub-id-type="pmid">34878825</pub-id>
</mixed-citation>
</ref>
</ref-list>
<fn-group>
<fn id="n1" fn-type="custom" custom-type="edited-by">
<p>Edited by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/17920">Nick Gascoigne</ext-link>, Augusta State University, United States</p></fn>
<fn id="n2" fn-type="custom" custom-type="reviewed-by">
<p>Reviewed by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/3122319">Hemant Mishra</ext-link>, University of Minnesota Twin Cities, United States</p>
<p><ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/3337632">Audrey Roussel-Gervais</ext-link>, Antion Biosciences, Switzerland</p></fn>
</fn-group>
</back>
</article>