<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.3 20210610//EN" "JATS-journalpublishing1-3-mathml3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="1.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title-group>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
</journal-title-group>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2026.1755280</article-id>
<article-version article-version-type="Version of Record" vocab="NISO-RP-8-2008"/>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Original Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Integrating bioinformatic prediction and the &#x201c;gut microbiota-inflammation-skin axis&#x201d; to decipher the mechanisms of quercetin (from <italic>Evodia rutaecarpa</italic>) in diabetic wound healing</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name><surname>Huang</surname><given-names>Zhixuan</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition/">Funding acquisition</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/conceptualization/">Conceptualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Liu</surname><given-names>Jian</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis/">Formal analysis</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Zheng</surname><given-names>Xu</given-names></name>
<xref ref-type="aff" rid="aff3"><sup>3</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/2360511/overview"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Geng</surname><given-names>Xinrong</given-names></name>
<xref ref-type="aff" rid="aff4"><sup>4</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis/">Formal analysis</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Tan</surname><given-names>Jinlong</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Ai</surname><given-names>Yangwen</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Li</surname><given-names>Hui</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="aff" rid="aff5"><sup>5</sup></xref>
<xref ref-type="corresp" rid="c001"><sup>*</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project-administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration/">Project administration</role>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Zhou</surname><given-names>Dongyue</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="corresp" rid="c001"><sup>*</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/2996180/overview"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project-administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration/">Project administration</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition/">Funding acquisition</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision/">Supervision</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
</contrib>
</contrib-group>
<aff id="aff1"><label>1</label><institution>Jiangxi Province Key Laboratory of Traditional Chinese Medicine Pharmacology, Institute of Traditional Chinese Medicine Health Industry, China Academy of Chinese Medical Sciences</institution>, <city>Nanchang</city>,&#xa0;<country country="cn">China</country></aff>
<aff id="aff2"><label>2</label><institution>Jiangxi Health Industry Institute of Traditional Chinese Medicine</institution>, <city>Nanchang</city>,&#xa0;<country country="cn">China</country></aff>
<aff id="aff3"><label>3</label><institution>Department of Tuina, The First Affiliated Hospital of Henan University of Chinese Medicine</institution>, <city>Zhengzhou</city>,&#xa0;<country country="cn">China</country></aff>
<aff id="aff4"><label>4</label><institution>Yantai Institute of Coastal Zone Research, Chinese Academy of Sciences, Yantai</institution>, <city>Shandong</city>,&#xa0;<country country="cn">China</country></aff>
<aff id="aff5"><label>5</label><institution>Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences</institution>, <city>Beijing</city>,&#xa0;<country country="cn">China</country></aff>
<author-notes>
<corresp id="c001"><label>*</label>Correspondence: Hui Li, <email xlink:href="mailto:lihuiyiren@163.com">lihuiyiren@163.com</email>; Dongyue Zhou, <email xlink:href="mailto:zhoudongyue@itcmhi.ac.cn">zhoudongyue@itcmhi.ac.cn</email></corresp>
</author-notes>
<pub-date publication-format="electronic" date-type="pub" iso-8601-date="2026-02-24">
<day>24</day>
<month>02</month>
<year>2026</year>
</pub-date>
<pub-date publication-format="electronic" date-type="collection">
<year>2026</year>
</pub-date>
<volume>17</volume>
<elocation-id>1755280</elocation-id>
<history>
<date date-type="received">
<day>27</day>
<month>11</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>03</day>
<month>02</month>
<year>2026</year>
</date>
<date date-type="rev-recd">
<day>28</day>
<month>01</month>
<year>2026</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2026 Huang, Liu, Zheng, Geng, Tan, Ai, Li and Zhou.</copyright-statement>
<copyright-year>2026</copyright-year>
<copyright-holder>Huang, Liu, Zheng, Geng, Tan, Ai, Li and Zhou</copyright-holder>
<license>
<ali:license_ref start_date="2026-02-24">https://creativecommons.org/licenses/by/4.0/</ali:license_ref>
<license-p>This is an open-access article distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License (CC BY)</ext-link>. The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</license-p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>Diabetic foot ulcer (DFU) is a serious complication of diabetes with impaired healing. This study focused on the herbal medicine <italic>Evodia rutaecarpa</italic> as a case to investigate the mechanisms of diabetic wound healing via the &#x201c;gut microbiota&#x2013;inflammation&#x2013;skin axis&#x201d;. We specifically aimed to elucidate the role of its core bioactive flavonoid, quercetin (Que), whose therapeutic potential in this context remains underexplored.</p>
</sec>
<sec>
<title>Methods</title>
<p><italic>In vitro</italic>, the direct interaction between Que and HIF1&#x3b1; was assessed by cellular thermal shift assay, and its functional effect on the HIF1&#x3b1;/VEGF pathway was evaluated in a lipopolysaccharide-induced RAW264.7/HUVEC co-culture system. <italic>In vivo</italic>, a streptozotocin-induced diabetic rat model with full-thickness dorsal wounds was treated with Que. Wound healing rates, metabolic parameters, systemic inflammation, and gut microbiota composition were analyzed. The causal role of the gut microbiota was further tested using fecal microbiota transplantation from Que-treated donors to diabetic recipient rats, and the biological activity of resulting drug-containing serum was assessed in HUVEC and RAW264.7 cell cultures.</p>
</sec>
<sec>
<title>Results</title>
<p>Que was identified as a principal active component of <italic>E. rutaecarpa</italic> with predicted binding affinity for key targets involved in inflammatory and hypoxic responses. <italic>In vitro</italic>, Que directly bound to and stabilized HIF1&#x3b1; protein and upregulated the expression of both HIF1&#x3b1; and VEGF in HUVECs under inflammatory co-culture conditions. In diabetic rats, Que treatment significantly accelerated wound closure, improved systemic glucose and lipid metabolism, reduced serum levels of TNF-&#x3b1; and IL-1&#x3b2;, and modulated the gut microbiota structure. FMT from Que-treated rats replicated the pro-healing effects, enhancing angiogenesis and collagen deposition in wounds, and reducing tissue inflammation. Consistently, serum derived from the FMT-Que group promoted HUVEC migration and tube formation, and attenuated the pro-inflammatory cytokine expression in RAW264.7 cells.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>This study demonstrated that Que promoted diabetic wound healing by modulating the &#x201c;gut microbiota&#x2013;inflammation&#x2013;skin axis&#x201d;, thereby reducing systemic inflammation and enhancing local angiogenesis.</p>
</sec>
</abstract>
<abstract abstract-type="graphical">
<title>Graphical Abstract</title>
<p>
<fig>
<caption><p>Integrating Bioinformatic Prediction and the "Gut Microbiota-Inflammation-Skin Axis" to Decipher the Mechanisms of Quercetin (from <italic>Evodia rutaecarpa</italic>) in Diabetic Wound Healing. The graphical abstract of this article was drawn by biorender (<ext-link ext-link-type="uri" xlink:href="http://www.biorender.com">www.biorender.com</ext-link>).</p></caption>
<graphic xlink:href="fimmu-17-1755280-g000.tif" position="anchor">
<alt-text content-type="machine-generated">Infographic illustrates Evodia rutaecarpa and its active compound Que, highlighting network pharmacology data, and schematic flow showing intervention in mice via gut-skin axis, fecal microbiota transplantation, modulating inflammation and angiogenesis to promote diabetic wound healing through HIF-1&#x3b1;/VEGF signaling and immune cell regulation.</alt-text>
</graphic>
</fig>
</p>
</abstract>
<kwd-group>
<kwd>bioinformatics analysis</kwd>
<kwd>diabetic foot ulcer</kwd>
<kwd>fecal microbiotatransplantation</kwd>
<kwd>gut&#x2013;skin axis</kwd>
<kwd>quercetin</kwd>
</kwd-group>
<funding-group>
<funding-statement>The author(s) declared that financial support was received for this work and/or its publication. This research was funded by the Fundamental Research Funds for the Central Public Welfare Research Institutes (ZZ16-ND-12, ZZ16-YQ-050, ZZ17-YQ-050, ZZ17-ND-12, ZZ18-ND-12, ZZ18-ZRZ-093), the Natural Science Foundation of Jiangxi Province (20232BAB216022, 20232BCJ25060, 20252BAC200568, 20252BAC240473), the General Project of Jiangxi Provincial Administration of Traditional Chinese Medicine (2025022997).</funding-statement>
</funding-group>
<counts>
<fig-count count="13"/>
<table-count count="8"/>
<equation-count count="0"/>
<ref-count count="53"/>
<page-count count="27"/>
<word-count count="10816"/>
</counts>
<custom-meta-group>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Inflammation</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Diabetes mellitus, recognized globally as a significant public health challenge, is a metabolic disorder resulting from the complex interplay of immunological, genetic, psychological, environmental, and other contributing factors (<xref ref-type="bibr" rid="B1">1</xref>). As the disease progresses, persistent hyperglycemia not only disrupts systemic homeostasis but also induces chronic damage and functional impairment across various bodily tissues (<xref ref-type="bibr" rid="B2">2</xref>). This ultimately inflicts irreversible damage to organs and tissues, triggering a cascade of complications. Diabetic foot ulcer (DFU), a severe microvascular complication of diabetes mellitus, poses a significant global health burden because of its complex pathophysiology involving chronic hyperglycemia, impaired angiogenesis, persistent inflammation, and microbial infections (<xref ref-type="bibr" rid="B3">3</xref>). Current therapeutic strategies remain largely unsatisfactory, with high risks of amputation and mortality (<xref ref-type="bibr" rid="B4">4</xref>).</p>
<p>Patients with type 1 diabetes exhibit distinct alterations in their gut microbiota composition (<xref ref-type="bibr" rid="B5">5</xref>), accompanied by heightened activity in inflammation and immunity-related biological processes (<xref ref-type="bibr" rid="B6">6</xref>). The &#x201c;gut&#x2013;skin axis&#x201d; represents a complex bidirectional communication network involving multiple physiological systems (<xref ref-type="bibr" rid="B7">7</xref>). Within this axis, the gut microbiota plays a pivotal regulatory role, which is primarily mediated through immunomodulatory, metabolic, and neuroendocrine pathways. On the one hand, gut microbial constituents and their metabolites can translocate to the skin via systemic circulation, thereby influencing cutaneous pathophysiological states (<xref ref-type="bibr" rid="B8">8</xref>). On the other hand, the gut microbiota critically modulates intestinal barrier integrity and permeability. Increased epithelial permeability may facilitate bacterial translocation, potentially triggering a systemic proinflammatory immune response that subsequently impairs skin function (<xref ref-type="bibr" rid="B9">9</xref>).</p>
<p>Traditional Chinese medicine (TCM) has garnered increasing attention for its multitarget therapeutic potential in managing diabetes-related complications (<xref ref-type="bibr" rid="B10">10</xref>). <italic>Evodia rutaecarpa</italic> is the dried nearly ripe fruit of <italic>Euodia rutaecarpa (Juss.) Benth.</italic>, <italic>Euodia rutaecarpa (Juss.) Benth.</italic> var. <italic>officinalis (Dode) Huang</italic>, <italic>Euodia rutaecarpa (Juss.) Benth.</italic> var. <italic>bodinieri (Dode) Huang</italic>. It has multiple pharmacological effects and is widely used in the prevention and treatment of migraine, diabetes, cardiovascular disease, cancer, and other chronic diseases (<xref ref-type="bibr" rid="B11">11</xref>). Studies have shown that <italic>Evodia Fructus</italic>-vinegar-processed <italic>Coptidis Rhizoma</italic> has superior efficacy to <italic>Coptidis Rhizoma</italic> alone in ameliorating ulcerative colitis in mice, effectively reducing colonic damage and inflammation while modulating the gut microbiota (<xref ref-type="bibr" rid="B12">12</xref>). In addition, the topical application <italic>Evodia rutaecarpa</italic> enhanced the anti-inflammatory and analgesic effects of indomethacin ointment (<xref ref-type="bibr" rid="B13">13</xref>). These properties render it a highly valuable research model for investigating the mechanisms through which the &#x201c;gut microbiota-inflammation-skin axis&#x201d; promotes diabetic wound healing.</p>
<p>This study aims to integrate bioinformatic prediction with experimental validation, using <italic>Evodia rutaecarpa</italic> as a starting point, to elucidate how this intervention influences the pathological process of diabetic wound healing, thereby providing a theoretical foundation for the development of novel therapeutic strategies.</p>
</sec>
<sec id="s2">
<label>2</label>
<title>Methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Bioinformatics analysis and molecular docking</title>
<sec id="s2_1_1">
<label>2.1.1</label>
<title>Target screening of <italic>Evodia rutaecarpa</italic> intervention for diabetic foot</title>
<p>The drug targets of <italic>Evodia rutaecarpa</italic> were studied via the Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform (TCMSP) (<ext-link ext-link-type="uri" xlink:href="https://tcmspw.com/tcmsp.php">https://tcmspw.com/tcmsp.php</ext-link>) (<xref ref-type="bibr" rid="B14">14</xref>). In addition, the OMIM database (<ext-link ext-link-type="uri" xlink:href="https://www.omim.org/">https://www.omim.org/</ext-link>) (<xref ref-type="bibr" rid="B15">15</xref>) and GeneCards database (<ext-link ext-link-type="uri" xlink:href="https://www.genecards.org/">https://www.genecards.org/</ext-link>) (<xref ref-type="bibr" rid="B16">16</xref>) were used to screen the pathological targets of DFU. A Venn diagram was used to integrate the drug targets of Chinese medicine and the pathological targets of DFU to determine the potential mechanism of action of traditional Chinese medicine in the treatment of DFU.</p>
</sec>
<sec id="s2_1_2">
<label>2.1.2</label>
<title>Chip data acquisition</title>
<p>The series matrix file of GSE147890 was downloaded from the NCBI GEO public database (<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/geo/info/datasets.html">https://www.ncbi.nlm.nih.gov/geo/info/datasets.html</ext-link>) (<xref ref-type="bibr" rid="B17">17</xref>), and the annotation file was GPL571. A total of 24 samples of expression spectrum data were included, including 12 cases in the control group and 12 cases in the disease group. The GSE165816 dataset from the NCBI GEO public database was downloaded, and a total of 22 datasets were included for single-cell analysis.</p>
</sec>
<sec id="s2_1_3">
<label>2.1.3</label>
<title>Consistency clustering of drug&#x2013;disease intersection genes</title>
<p>Consensus clustering was performed on the basis of the drug&#x2013;disease intersection gene expression matrix to define DFU subtypes. The analysis involved 50 iterative computations, each utilizing a random 80% subset of the samples. The determination of the optimal cluster count was informed by the characteristics of the consensus matrix heatmap and the trajectory of the consensus cumulative distribution function curve (<xref ref-type="bibr" rid="B18">18</xref>).</p>
</sec>
<sec id="s2_1_4">
<label>2.1.4</label>
<title>Gene set enrichment analysis pathway enrichment analysis</title>
<p>To investigate signalling pathway heterogeneity between the identified subtypes, GSEA was conducted. The background gene set was the version 7.0 annotation gene set downloaded from the MsigDB database (<ext-link ext-link-type="uri" xlink:href="https://www.gsea-msigdb.org/gsea/msigdb">https://www.gsea-msigdb.org/gsea/msigdb</ext-link>) as the annotation gene set for the subtype pathways. Gene sets demonstrating significant enrichment (adjusted P &lt; 0.05) in the intersubtype differential expression analysis were subsequently ranked on the basis of their normalized enrichment scores (<xref ref-type="bibr" rid="B19">19</xref>).</p>
</sec>
<sec id="s2_1_5">
<label>2.1.5</label>
<title>Feature selection process of LASSO regression</title>
<p>LASSO is a compression estimate. It constructs a penalty function to obtain a more refined model, which compresses some coefficients and sets some coefficients to zero. Therefore, the advantages of subset shrinkage are retained, and it is a biased estimate for processing data with complex collinearity. We used the Lasso logistic regression algorithm to select features for diagnostic markers of diseases. The Lasso algorithm uses the &#x201c;glmnet&#x201d; package.</p>
</sec>
<sec id="s2_1_6">
<label>2.1.6</label>
<title>Kyoto encyclopedia of genes and genomes functional annotation</title>
<p>The R package &#x201c;ClusterProfiler&#x201d; was used to perform functional annotations on important genes to explore the functional relevance of these genes fully. KEGG was used to evaluate relevant functional categories. KEGG-enriched pathways with p values and q values less than 0.05 were considered significant categories.</p>
</sec>
<sec id="s2_1_7">
<label>2.1.7</label>
<title>Single-cell analysis</title>
<p>First, the expression profile was read through the Seurat package, and low-expression genes were screened out (nFeature_RNA &gt; 200 &amp; percent.mt &lt;= median+3MAD &amp; nFeature_RNA &lt;= median+3MAD &amp; nCount_RNA &lt;= median+3MAD &amp; percent.ribo &lt;= median+3MAD); the data were standardized, homogenized, and subjected to principal component analysis (PCA). In turn, the optimal number of pcs was observed through ElbowPlot, and the positional relationship between each cluster was obtained through UMAP analysis. The clusters were annotated by marker genes, and some cells that were important for the occurrence of the disease were annotated.</p>
</sec>
<sec id="s2_1_8">
<label>2.1.8</label>
<title>Molecular docking</title>
<p>For the key genes, the corresponding protein 3D structure was obtained from the RCSB PDB database (<ext-link ext-link-type="uri" xlink:href="https://www.rcsb.org/">https://www.rcsb.org/</ext-link>), and the drug component structure was obtained from the PubChem database (<ext-link ext-link-type="uri" xlink:href="https://pubchem.ncbi.nlm.nih.gov/">https://pubchem.ncbi.nlm.nih.gov/</ext-link>). Molecular docking was performed via PyMOL software and AutoDock software.</p>
</sec>
<sec id="s2_1_9">
<label>2.1.9</label>
<title>Statistical analysis</title>
<p>Statistical analysis was performed via R language (version 4.2.2). P &lt; 0.05 was considered statistically significant.</p>
</sec>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Effects of Que on lipopolysaccharide-induced co-culture system of RAW264.7 and human umbilical vein endothelial cells</title>
<sec id="s2_2_1">
<label>2.2.1</label>
<title>Cell lines and cell culture</title>
<p>HUVECs and RAW264.7 cells were purchased from Haixing Biotechnology Co., Ltd. (Suzhou, China). HUVECs were cultured in Endothelial Cell Basal Medium supplemented with 5% fetal bovine serum (FBS), 1% Endothelial Cell Culture Supplement, and 1% penicillin/streptomycin. RAW264.7 cells were cultured in Dulbecco&#x2019;s Modified Eagle&#x2019;s Medium (5.5 mM D-glucose) supplemented with 10% FBS and 1% penicillin/streptomycin. Both cell lines were incubated at 37&#xb0;C under 5% CO<sub>2</sub> and cultured separately.</p>
</sec>
<sec id="s2_2_2">
<label>2.2.2</label>
<title>Cytotoxicity assay</title>
<p>RAW264.7 cells and HUVECs were seeded into 96-well plates, respectively. After 24-h incubation with various concentrations (0, 6.25, 12.5, 25, 50, 100 &#x3bc;M) of Que, 50 &#x3bc;L of 3-(4, 5)-dimethylthiahiazo(-z-y1)-2,5-diphenyltetrazolium bromide (MTT) (Solarbio, Beijing, China) (2 mg/mL) was added per well and then incubated for 3 h. The formazan crystals were dissolved in 200 &#x3bc;L of dimethyl sulfoxide (DMSO) and the absorbance was read at 490 nm using a microplate reader.</p>
</sec>
<sec id="s2_2_3">
<label>2.2.3</label>
<title>Cellular thermal shift assay</title>
<p>HUVECs in the logarithmic growth phase were pretreated with Que or DMSO at 37&#xb0;C for 30 min. The samples were then aliquoted and subjected to a temperature gradient (38, 42, 48, 54, 62, 68&#xb0;C) using a thermal cycler, followed by immediate cooling on ice. After centrifugation at 12,000 g and 4&#xb0;C for 15 min, the protein expression level of hypoxia-inducible factor-1 &#x3b1; (HIF1&#x3b1;) (Wanleibio, Shenyang, China) was quantified by western blotting.</p>
</sec>
<sec id="s2_2_4">
<label>2.2.4</label>
<title>Establishment of an <italic>in vitro</italic> macrophage and endothelial cell co-culture system</title>
<p>Based on a previously described method (<xref ref-type="bibr" rid="B20">20</xref>), a co-culture system was established using RAW264.7 cells and HUVECs. Specifically, HUVECs were seeded in the lower chamber of Transwell inserts, while RAW264.7 cells were placed in the upper chamber. The co&#x2212;culture system was treated with LPS (100 ng/mL) or varying concentrations of Que for 24 h. After incubation, HUVECs from the lower chamber were collected, and the protein expression levels of HIF1&#x3b1; and vascular endothelial growth factor (VEGF) (Wanleibio, Shenyang, China) were evaluated by western blotting.</p>
</sec>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Effects of Quercetin on wounds in diabetic rats</title>
<p>Male Sprague&#x2013;Dawley (SD) rats (180 &#xb1; 20 g body weight, n = 50) were purchased from Beijing Sibeifu Biotechnology Co., Ltd. (licence No. SCXK [Jing] 2019--0010). The animal study protocol was approved by the Laboratory Animal Ethics Committee of Jiangxi Health Industry Institute of Traditional Chinese Medicine (animal ethics number: 2023004). The rats were maintained under controlled environmental conditions (temperature: 22&#x2013;24&#xb0;C; humidity: 40&#x2013;60%) with a 12 h light/dark cycle. Following a week-long acclimatization period with ad libitum access to food and water, the experiments were initiated (<xref ref-type="bibr" rid="B21">21</xref>).</p>
<p>After the SD rats were adaptively fed for one week, type 1 diabetic rat models were established by a single intraperitoneal injection of streptozotocin (STZ) (Solarbio, Beijing, China) at a dose of 55 mg/kg in fasted SD rats (<xref ref-type="bibr" rid="B22">22</xref>). The rats with fasting blood glucose values &#x2265; 16.7 mM after 72 h of STZ injection were considered successfully replicated type I diabetes models. After the rats were anesthetized with isoflurane, the dorsal skin was disinfected, and a circular segment of the dorsal skin with a diameter of 20 mm was excised to establish a full-thickness cutaneous excision wound. Que (0.5% sodium carboxymethyl cellulose prepared with normal saline) (25 mg/kg) (<xref ref-type="bibr" rid="B23">23</xref>) and metformin (0.5% sodium carboxymethyl cellulose prepared with normal saline) (Merck, Darmstadt, Germany) (200 mg/kg) (<xref ref-type="bibr" rid="B24">24</xref>) were administered by oral gavage. The sham and model groups received an equivalent volume of 0.5% sodium carboxymethyl cellulose prepared with normal saline. Serum was collected on day 7, and serum/feces were harvested on day 14. After 14 d of intervention, the rats in each group were administered an oral gavage of glucose (2 g/kg) (<xref ref-type="bibr" rid="B25">25</xref>) for the oral glucose tolerance test, and blood glucose levels were assessed at 0, 30, 60, 90 and 120 min via a glucometer (Yuyue, Jiangsu, China).</p>
<sec id="s2_3_1">
<label>2.3.1</label>
<title>Serum biochemical tests</title>
<p>At the endpoint of the 7-day or 14-day intervention period, the rats were first anesthetized with 4% isoflurane for induction, followed by maintenance of anesthesia with 2% isoflurane. After serum collection, the isoflurane concentration was increased to 5% to ensure humane euthanasia and minimize animal suffering as much as possible. Serum levels of insulin (INS), low-density lipoprotein cholesterol (LDL-C), triglyceride (TG), total cholesterol (T-CHO), tumor necrosis factor &#x3b1; (TNF-&#x3b1;), and interleukin-1&#x3b2; (IL-1&#x3b2;) were assessed according to the manufacturers&#x2019; instructions for commercial kits (Jiancheng, Nanjing, China).</p>
</sec>
<sec id="s2_3_2">
<label>2.3.2</label>
<title>Histopathological analysis</title>
<p>The wounds were photographed via a digital camera, and the wound healing rate was calculated by measuring the wound area with ImageJ software. The reduction in wound size was calculated via the following equation: reduction in wound size (%) = (A<sub>0</sub> &#x2212; A<sub>t</sub>)/A<sub>0</sub> &#xd7; 100%, where A<sub>0</sub> is the initial wound area and A<sub>t</sub> is the wound area on days 0, 3, 7, 10 and 14 after surgery. The wound area at 7 d and 14 d was considered an important indicator of wound healing (<xref ref-type="bibr" rid="B26">26</xref>). Wound tissues were collected on days 7 and 14 after intervention, preserved in 4% paraformaldehyde solution, dehydrated, and processed with paraffin. The solidified paraffin-embedded samples were then subjected to serial sectioning. Histopathological evaluation was performed via hematoxylin&#x2013;eosin staining and Masson&#x2019;s trichrome staining.</p>
</sec>
<sec id="s2_3_3">
<label>2.3.3</label>
<title>Detection of serum via untargeted metabolomics</title>
<sec id="s2_3_3_1">
<label>2.3.3.1</label>
<title>Metabolite extraction</title>
<p>Metabolomic profiling was performed via a liquid chromatography&#x2013;mass spectrometry (LC&#x2013;MS) system consisting of a Waters Acquity I-Class PLUS UPLC coupled with a Xevo G2-XS QToF high-resolution mass spectrometer. Separation was achieved via a Waters Acquity UPLC HSS T3 column (2.1 &#xd7; 100 mm, 1.8 &#x3bc;m). The mobile phase for both positive and negative electrospray ionization modes comprised (A) 0.1% formic acid in water and (B) 0.1% formic acid in acetonitrile. The injection volume was set at 2 &#x3bc;L. The mobile phase conditions for liquid chromatography are shown in <xref ref-type="table" rid="T1"><bold>Table&#xa0;1</bold></xref> (<xref ref-type="bibr" rid="B27">27</xref>).</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Conditions of the liquid chromatography mobile phase.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Time (min)</th>
<th valign="middle" align="center">Flow rate (&#xb5;L/min)</th>
<th valign="middle" align="center">Mobile phase (A)</th>
<th valign="middle" align="center">Mobile phase (B)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="center">0.0</td>
<td valign="middle" align="center">400</td>
<td valign="middle" align="center">95%</td>
<td valign="middle" align="center">5%</td>
</tr>
<tr>
<td valign="middle" align="center">0.5</td>
<td valign="middle" align="center">400</td>
<td valign="middle" align="center">95%</td>
<td valign="middle" align="center">5%</td>
</tr>
<tr>
<td valign="middle" align="center">5.5</td>
<td valign="middle" align="center">400</td>
<td valign="middle" align="center">50%</td>
<td valign="middle" align="center">50%</td>
</tr>
<tr>
<td valign="middle" align="center">9.0</td>
<td valign="middle" align="center">400</td>
<td valign="middle" align="center">5%</td>
<td valign="middle" align="center">95%</td>
</tr>
<tr>
<td valign="middle" align="center">10.5</td>
<td valign="middle" align="center">400</td>
<td valign="middle" align="center">5%</td>
<td valign="middle" align="center">95%</td>
</tr>
<tr>
<td valign="middle" align="center">12.0</td>
<td valign="middle" align="center">400</td>
<td valign="middle" align="center">95%</td>
<td valign="middle" align="center">5%</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_3_3_2">
<label>2.3.3.2</label>
<title>LC&#x2013;MS/MS analysis</title>
<p>Mass spectrometry data were acquired via a Waters Xevo G2-XS QTOF high-resolution mass spectrometer governed by MassLynx V4.2 software. The instrument was operated in MSe mode to concurrently collect both primary and secondary mass spectral data in each acquisition cycle. This setup utilized a low collision energy channel and a high collision energy channel ramped from 10 to 40 V, with a spectral scan rate of 0.2 seconds. The ESI source parameters were configured as follows: capillary voltage at 2500 V (positive) or -2000 V (negative); cone voltage at 30 V; ion source temperature at 100&#xb0;C; desolvation gas temperature at 500&#xb0;C; cone gas flow rate at 50&#xa0;L/h; and desolvation gas flow rate at 800 L/h (<xref ref-type="bibr" rid="B28">28</xref>).</p>
</sec>
<sec id="s2_3_3_3">
<label>2.3.3.3</label>
<title>Data preprocessing and analysis</title>
<p>Data processing was initiated by subjecting the raw MassLynx V4.2 data to Progenesis QI software for peak extraction, alignment, and compound identification, which leveraged both the METLIN database (<ext-link ext-link-type="uri" xlink:href="https://metlin.scripps.edu">https://metlin.scripps.edu</ext-link>) and a self-established library. After normalization of the original peak areas to the total area, initial data quality assessment was performed through principal component analysis and Spearman correlation analysis to evaluate repeatability. The annotated compounds were queried against the KEGG, HMDB, and Lipid Maps databases for functional insights. Differential analysis involved the calculation of fold changes and the application of t-tests to determine statistical significance (p value). An orthogonal partial least squares-discriminant analysis (OPLS-DA) model was constructed with the ropls R package and rigorously validated by 200 permutation tests. The variable importance in projection (VIP) values from this model were then utilized, in conjunction with the criteria of fold change (FC) &gt; 1 and P value (P&#xa0;&lt; 0.05), to screen for robust differential metabolites. Enrichment analysis of relevant KEGG pathways was subsequently conducted via a hypergeometric test (<xref ref-type="bibr" rid="B28">28</xref>).</p>
</sec>
</sec>
<sec id="s2_3_4">
<label>2.3.4</label>
<title>16S rRNA gene sequencing of the gut microbiota</title>
<p>Following collection into sterile cryovials from each experimental group, the preservation of fecal samples involved immediate flash freezing in liquid nitrogen (1 h) prior to transfer to a -80&#xb0;C freezer. For characterization of the gut microbial community, 16S rRNA gene sequencing was performed by Biomarker Technologies Co., Ltd. (Beijing, China) (<xref ref-type="bibr" rid="B21">21</xref>).</p>
</sec>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Effects of faecal microbiota transplantation on wounds in diabetic rats</title>
<p>Male SD rats (180 &#xb1; 20 g body weight, n = 50) were purchased from Beijing Sibeifu Biotechnology Co., Ltd. (licence No. SCXK [Jing] 2019--0010). The diabetic rat wound model was established as described in Section 2.3. Four days prior to modelling, the donor rats were intraperitoneally administered antibiotics (Yuanye, Shanghai, China) (vancomycin 100 mg/kg, neomycin sulfate 200&#xa0;5mg/kg, metronidazole 200 mg/kg, and ampicillin 200 mg/kg) to deplete the gut microbiota (<xref ref-type="bibr" rid="B29">29</xref>). The rats were subsequently divided into faux aseptic sham (FS), faux aseptic model (FM), faux aseptic quercetin (FQ), and faux aseptic fecal microbiota transplantation quercetin (FMQ) groups. Following the final administration, the rats were anaesthetized, and blood was collected from the abdominal aorta. The blood was allowed to stand at room temperature for 2 h and then centrifuged at 3,500 r/min for 15 min at 4&#xb0;C, after which the supernatant was left undisturbed for 30 min. Subsequently, it was inactivated in a 56&#xb0;C&#xa0;water bath for 30 min and filtered through a 0.22 &#x3bc;m micropore filter, and the resulting drug-containing serum was stored at -80&#xb0;C.</p>
<sec id="s2_4_1">
<label>2.4.1</label>
<title>Effects of FMT on intestinal permeability in rats</title>
<p>After the intestinal tissues of the rats were lysed, the protein concentration was quantified via a BCA assay. The expression levels of Zonula occludens-1 (ZO-1), Occludin and Claudin 1 (Proteintech, Wuhan, China) were detected via western blotting.</p>
</sec>
<sec id="s2_4_2">
<label>2.4.2</label>
<title>Effects of FMT-derived drug-containing serum on cells</title>
<sec id="s2_4_2_1">
<label>2.4.2.1</label>
<title>Cell viability assay</title>
<p>Exponentially proliferating HUVECs/RAW264.7 cells, at a density of 1&#xd7;10<sup>4</sup> cells per well, were seeded in a 96-well plate and placed in an incubator until they reached a density of 80%. The cells were then treated with 5%/10% drug-containing serum obtained from the various FMT experiment groups for 24 h. Cell viability was determined via the MTT assay.</p>
</sec>
<sec id="s2_4_2_2">
<label>2.4.2.2</label>
<title>Reactive oxygen species level of cells</title>
<p>After treatment, the culture medium of the HUVECs was aspirated. The cells were then incubated with 2&#x2019;,7&#x2019;-dichlorodihydrofluorescein diacetate (DCFH-DA) diluted in serum-free medium at 37&#xb0;C for 30 min in the dark. Following incubation, the cells were thoroughly washed three times with prewarmed serum-free medium and subsequently ready for observation under a fluorescence microscope.</p>
</sec>
<sec id="s2_4_2_3">
<label>2.4.2.3</label>
<title>Cell migration assay</title>
<p>HUVECs were seeded into 6-well culture plates and cultured until a confluent monolayer formed. Scratch wounds were generated in the cell monolayers via a sterile 200 &#x3bc;L pipette tip, followed by two washes with PBS to remove detached cells and debris. The wounded monolayers were then coincubated with or without the drugs under standard culture conditions. Images of the cells were captured at specific time points via an inverted fluorescence microscope (DMi8, Leica, Germany), and the scratch wound healing rate was quantitatively analyzed with ImageJ software. Transwell chambers (Corning, NY, USA) were placed in a 24-well plate, with 600 &#x3bc;L of medium containing 10% FBS added to the lower chambers. The upper chambers received 200 &#x3bc;L of serum-free cell suspension with 1&#xd7;10<sup>4</sup> HUVECs in drug-containing or drug-free medium. After 16 h of coincubation at 37&#xb0;C, the cells were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. The invasive cells on the lower membrane surface were imaged via an optical microscope.</p>
</sec>
<sec id="s2_4_2_4">
<label>2.4.2.4</label>
<title>Angiogenesis assay</title>
<p>On the day prior to the experiment, the Matrigel<sup>&#xae;</sup> matrix (Mobiotech, Xiamen, China) was thawed at 4&#xb0;C overnight to ensure homogeneous dissolution. On the experimental day, prechilled 24-well plates were loaded with 150 &#xb5;L of liquefied Matrigel<sup>&#xae;</sup> per well and polymerized at 37&#xb0;C for 1 h to establish a three-dimensional matrix for cell adhesion and angiogenesis. The cell suspensions were adjusted to a density of 1&#xd7;10<sup>5</sup> HUVECs per well and seeded onto the solidified Matrigel<sup>&#xae;</sup> surface. The plates were incubated for 4 h at 37&#xb0;C to facilitate cellular adhesion and initial tubular network formation. After incubation, the angiogenic structures were visualized via an inverted optical microscope.</p>
</sec>
<sec id="s2_4_2_5">
<label>2.4.2.5</label>
<title>Real-time quantitative polymerase chain reaction of cells</title>
<p>Following the isolation of total RNA from HUVECs and RAW264.7 cells, complementary DNA was synthesized via reverse transcription (Servicebio, Wuhan, China). The internal reference utilized in the analysis was &#x3b2;-actin, and the relative expression of the target gene was determined by the 2<sup>-&#x394;&#x394;Cq</sup> method. The analyses quantified the expression of VEGF and HIF1&#x3b1; in HUVECs and that of TNF-&#x3b1;, IL-1&#x3b2;, interleukin-6 (IL-6), and interleukin-10 (IL-10) in RAW264.7 cells. All primer sequences utilized in this study are listed in <xref ref-type="table" rid="T2"><bold>Table&#xa0;2</bold></xref> (<xref ref-type="bibr" rid="B21">21</xref>) and <xref ref-type="table" rid="T3"><bold>Table&#xa0;3</bold></xref>.</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Primer sequences.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Gene (Rat) for tissues of animals</th>
<th valign="middle" align="center">Primer sequences (5&#x2032; &#x2192; 3&#x2032;)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" rowspan="2" align="center">&#x3b2;-actin</td>
<td valign="middle" align="left">Forward:&#xa0;GTCAGGTCATCACTATCGGCAAT</td>
</tr>
<tr>
<td valign="middle" align="left">Reverse:&#xa0;AGAGGTCTTTACGGATGTCAACGT</td>
</tr>
<tr>
<td valign="middle" rowspan="2" align="center">IL-1&#x3b2;</td>
<td valign="middle" align="left">Forward: CATCCAGCTTCAATCTCAC</td>
</tr>
<tr>
<td valign="middle" align="left">Reverse:&#xa0;ACCACTTGTTGGCTTATGTT</td>
</tr>
<tr>
<td valign="middle" rowspan="2" align="center">IL-6</td>
<td valign="middle" align="left">Forward:&#xa0;CTAGGAAGAACTGGCAATAT</td>
</tr>
<tr>
<td valign="middle" align="left">Reverse:&#xa0;AAACCATCTGGCTAGGTAAGA</td>
</tr>
<tr>
<td valign="middle" rowspan="2" align="center">IL-10</td>
<td valign="middle" align="left">Forward: CAGAACAGAACAGGAGAGTGGAGTG</td>
</tr>
<tr>
<td valign="middle" align="left">Reverse:&#xa0;GAGGGAGTGGAGGTGTGCTACTGGG</td>
</tr>
<tr>
<td valign="middle" rowspan="2" align="center">TNF-&#x3b1;</td>
<td valign="middle" align="left">Forward:&#xa0;ACGTCGTAGCAAACCACCAA</td>
</tr>
<tr>
<td valign="middle" align="left">Reverse:&#xa0;CTGGGAGTAGATAAGGTACA</td>
</tr>
<tr>
<td valign="middle" rowspan="2" align="center">HIF1&#x3b1;</td>
<td valign="middle" align="left">Forward: CTTGGAAACGAGTGAAAGGATACA</td>
</tr>
<tr>
<td valign="middle" align="left">Reverse:&#xa0;GGTTTCTGCTGCCTTGTATGG</td>
</tr>
<tr>
<td valign="middle" rowspan="2" align="center">VEGF</td>
<td valign="middle" align="left">Forward:&#xa0;GCACTGGACCCTGGCTTTACT</td>
</tr>
<tr>
<td valign="middle" align="left">Reverse:&#xa0;AACTTCACCACTTCATGGGCTTT</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="T3" position="float">
<label>Table&#xa0;3</label>
<caption>
<p>Primer sequences.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Gene (Mouse) for RAW264.7 cells</th>
<th valign="middle" align="center">Primer sequences (5&#x2032; &#x2192; 3&#x2032;)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" rowspan="2" align="center">&#x3b2;-actin</td>
<td valign="middle" align="left">Forward:&#xa0;CGTGGGCCGCCCTAGGCACCA</td>
</tr>
<tr>
<td valign="middle" align="left">Reverse:&#xa0;TTGGCCTTAGGGTTCAGGGGGG</td>
</tr>
<tr>
<td valign="middle" rowspan="2" align="center">IL-1&#x3b2;</td>
<td valign="middle" align="left">Forward:&#xa0;GAAATGCCACCTTTTGACAGTG</td>
</tr>
<tr>
<td valign="middle" align="left">Reverse:&#xa0;TGGATGCTCTCATCAGGACAG</td>
</tr>
<tr>
<td valign="middle" rowspan="2" align="center">IL-6</td>
<td valign="middle" align="left">Forward:&#xa0;CCCCAATTTCCAATGCTCTCC</td>
</tr>
<tr>
<td valign="middle" align="left">Reverse:&#xa0;CGCACTAGGTTTGCCGAGTA</td>
</tr>
<tr>
<td valign="middle" rowspan="2" align="center">IL-10</td>
<td valign="middle" align="left">Forward:&#xa0;GCTCTTACTGACTGGCATGAG</td>
</tr>
<tr>
<td valign="middle" align="left">Reverse:&#xa0;CGCAGCTCTAGGAGCATGTG</td>
</tr>
<tr>
<td valign="middle" rowspan="2" align="center">TNF-&#x3b1;</td>
<td valign="middle" align="left">Forward:&#xa0;ACCCTCACACTCACAAACCA</td>
</tr>
<tr>
<td valign="middle" align="left">Reverse:&#xa0;ATAGCAAATCGGCTGACGGT</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
</sec>
<sec id="s2_4_3">
<label>2.4.3</label>
<title>Effects of FMT on wound healing in diabetic rats</title>
<p>The wound images of each group were taken and recorded at 0, 3, 7, and 14 days. ImageJ software was used to measure and calculate the wound healing rate. Wound tissues from the rats were collected for histological analysis via hematoxylin&#x2013;eosin staining, Masson&#x2019;s trichrome staining, and cluster of differentiation 31 (CD31) immunohistochemical staining, followed by microscopic examination to evaluate remodelling and pathological changes. RNA was also extracted from these tissues to analyze the mRNA expression levels of VEGF, HIF1&#x3b1;, and IL-6 (<xref ref-type="table" rid="T4"><bold>Table&#xa0;4</bold></xref>). The expression levels of VEGF and HIF1&#x3b1; were detected via western blotting.</p>
<table-wrap id="T4" position="float">
<label>Table&#xa0;4</label>
<caption>
<p>Primer sequences.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Gene (Human) for HUVECs</th>
<th valign="middle" align="left">Primer sequences (5&#x2032; &#x2192; 3&#x2032;)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" rowspan="2" align="center">&#x3b2;-actin</td>
<td valign="middle" align="left">Forward:&#xa0;CACCCAGCACAATGAAGATCAAGAT</td>
</tr>
<tr>
<td valign="middle" align="left">Reverse:&#xa0;CCAGTTTTTAAATCCTGAGTCAAGC</td>
</tr>
<tr>
<td valign="middle" rowspan="2" align="center">HIF1&#x3b1;</td>
<td valign="middle" align="left">Forward: TGATTGCATCTCCATCTCCTACC</td>
</tr>
<tr>
<td valign="middle" align="left">Reverse:&#xa0;GACTCAAAGCGACAGATAACACG</td>
</tr>
<tr>
<td valign="middle" rowspan="2" align="center">VEGF</td>
<td valign="middle" align="left">Forward:&#xa0;GGAGGGCAGAATCATCACGA</td>
</tr>
<tr>
<td valign="middle" align="left">Reverse:&#xa0;GCTCATCTCTCCTATGTGCTGG</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Statistical analysis</title>
<p>Each experiment was independently repeated at least three times. The data represent the mean &#xb1; SD. We used GraphPad Prism 10.1.2 for all the statistical analyses, with the mean values compared via one-way ANOVA.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Potential active ingredients and targets of <italic>Evodia rutaecarpa</italic> for the treatment of DFU</title>
<p>The network pharmacology method was used to help determine the effect of <italic>Evodia rutaecarpa</italic> on DFU. This study first used the TCMSP database, which is based on the <italic>Evodia rutaecarpa</italic> and has a bioavailability &#x2265; 30% and a drug likeness &#x2265; 0.18, as the threshold for screening to obtain the active ingredients of the medicine and the targets on which the active ingredients act. Finally, a total of 56 corresponding drug targets were obtained, and Cytoscape was used to visualize the relationships between the Chinese herbal ingredients and the targets in the form of a network diagram (<xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1A</bold></xref>). Then, through the GeneCards database, 575 genes with relevance scores &gt; 10 were extracted to explore the related targets of DFU, and 610 diabetic foot ulcer targets were obtained from the OMIM database. After removing duplicate values, a total of 1154 disease targets were obtained. The disease targets were subsequently intersected with the 56 drug targets of the former, and 21 intersection targets were obtained (<xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1B</bold></xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Integrated pharmacological profiling and multiomics cluster analysis of drug targets with immune enrichment signatures. <bold>(A)</bold> Targets of drug ingredients. <bold>(B)</bold> Venn diagram. <bold>(C)</bold> Clustering heatmap. <bold>(D)</bold> Clustering analysis cumulative distribution curve. <bold>(E)</bold> Area under the curve of the cluster analysis distribution. <bold>(F)</bold> ssGSEA enrichment heatmap of clusters. <bold>(G)</bold> Cluster immune infiltration score difference map. <bold>(H)</bold> Cluster GSEA enrichment plot.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1755280-g001.tif">
<alt-text content-type="machine-generated">Panel A shows a network diagram linking Evodia rutaecarpa to multiple gene targets. Panel B presents a Venn diagram comparing overlapping genes between Evodia rutaecarpa and diabetic foot ulcer. Panel C provides a consensus matrix heatmap for k=2 clusters. Panel D is a consensus cumulative distribution function plot. Panel E shows a delta area plot indicating changes in the consensus index for different cluster numbers. Panel F displays a heatmap of gene expression across two groups, with genes listed on the left and expression values in color. Panel G contains a box plot comparing expression values across two subtypes for three genes. Panel H is an enrichment plot depicting several signaling pathways with enrichment scores comparing two groups.</alt-text>
</graphic></fig>
<p>To explore whether the molecular typing of drug&#x2013;disease intersection genes can explain the heterogeneity of patients with DFU, we downloaded the GSE147890 DFU-related dataset from the GEO database and included the expression profile data of 24 samples, including the control group (n = 12) and the disease group (n = 12). We further used the consistency clustering method and molecularly typed the disease group on the basis of the expression of drug&#x2013;disease intersection genes (<xref ref-type="fig" rid="f1"><bold>Figures&#xa0;1C&#x2013;E</bold></xref>). The results showed that when K = 2, the boundary between the two subtypes of the sample was clearer, so the DFU was divided into two clusters. Moreover, we generated a heatmap to display the expression of drug&#x2013;disease intersection genes in the two subtypes (<xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1F</bold></xref>). Then, we scored the immune infiltration of the two subtypes according to the estimation algorithm and determined the difference in expression between the subtypes. The immune score was significantly different between the subtype groups (<xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1G</bold></xref>). In addition, we further analyzed the differences in signalling pathways between subtypes through GSEA. The GSEA results revealed that the pathways enriched were the chemokine signalling pathway, the IL-17 signalling pathway, the NOD-like receptor signalling pathway, etc. (<xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1H</bold></xref>).</p>
<p>We selected 21 disease&#x2013;drug intersection genes from the GSE147890 dataset and performed feature screening through LASSO regression. The results showed that LASSO regression identified a total of 9 genes as characteristic genes of DFU (<xref ref-type="fig" rid="f2"><bold>Figures&#xa0;2A, B</bold></xref>), as indicated by the ROC curve (AUC = 1). While the high AUC value suggests excellent separation in the training set, we recognize the potential for overfitting given the limited sample size. Therefore, these bioinformatics results were interpreted strictly as exploratory guidance for target screening rather than as a definitive diagnostic model (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2C</bold></xref>). Then, we subsequently performed intergroup expression difference analysis between the 9 genes identified by LASSO and found that the 9 genes presented significant differences (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2D</bold></xref>). In addition, we used heatmaps to show the correlations among the 9 genes (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2E</bold></xref>). Therefore, these 9 key genes are the key genes for our subsequent research. The R package &#x201c;clusterprofiler&#x201d; was used to perform KEGG pathway analysis, and the results revealed that the pathways associated with the genes were the IL-17 signalling pathway, the HIF-1 signalling pathway, the TNF signalling pathway and other signalling pathways (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2F</bold></xref>). We constructed a protein interaction network of common targets for 9 key genes via the STRING database (<ext-link ext-link-type="uri" xlink:href="http://cn.string-db.org">http://cn.string-db.org</ext-link>) and visualized it via Cytoscape (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2G</bold></xref>), which included 9 nodes and 21 edges in the network. We use the network analysis plug-in to count the nodes in the network graph and analyze their connectivity on the basis of the node degree. The larger the node degree is, the more biological functions the node has in the network. In the figure, the larger the node degree is, the more purple the color and the larger the graph, and vice versa, the lighter the green color and the smaller the graph.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Analysis of key genes involved in DFU intervention by Evodia rutaecarpa. <bold>(A)</bold> LASSO regression analysis to screen feature genes. <bold>(B)</bold> LASSO regression &#x3bb; value. <bold>(C)</bold> LASSO regression ROC curve. <bold>(D)</bold> Differences in the expression of key genes between clusters. <bold>(E)</bold> Heatmap of the correlations of key gene expression. <bold>(F)</bold> KEGG enrichment plot of key genes. <bold>(G)</bold> PPI network diagram.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1755280-g002.tif">
<alt-text content-type="machine-generated">Panel A displays a line plot of gene coefficients versus log lambda for LASSO regression. Panel B shows mean-squared error versus log lambda with optimal points marked. Panel C presents a receiver operating characteristic (ROC) curve with an area under the curve (AUC) of 1. Panel D features a boxplot comparing gene expression between subtypes C1 and C2. Panel E is a heatmap of pairwise correlations between gene expressions, colored from blue to red representing negative to positive correlations. Panel F shows a horizontal bar plot of pathway enrichment analysis with count and adjusted p-value for different pathways. Panel G is a network diagram showing interactions among selected genes.</alt-text>
</graphic></fig>
<p>We downloaded the single-cell data of GSE165816 and performed single-cell analysis through the Seurat package, clustered the cells via the UMAP algorithm, and obtained 13 subtypes (<xref ref-type="fig" rid="f3"><bold>Figure&#xa0;3A</bold></xref>). Each subtype was annotated via the R package SingleR, and 13 clusters were annotated to 9 cell categories, including fibroblasts, T cells, endothelial cells, monocytes, keratinocytes, epithelial cells, B cells, melanocytes, and mast cells (<xref ref-type="fig" rid="f3"><bold>Figure&#xa0;3B</bold></xref>). We displayed the expression of key genes in 9 cell lines in the form of scatter plots and bubble plots (<xref ref-type="fig" rid="f3"><bold>Figures&#xa0;3C, D</bold></xref>). In addition, we analyzed the expression of the 9 key genes in each sample and displayed them in the form of violins (<xref ref-type="fig" rid="f3"><bold>Figure&#xa0;3E</bold></xref>).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Characterization of 9 Cellular Subtypes and Key Gene Expression Profiling in scRNA-seq Data. <bold>(A)</bold> UMAP algorithm for cell clustering. <bold>(B)</bold> Annotation of each subtype. <bold>(C)</bold> The expression of key genes in 9 types of cells is shown in the scatter plot. <bold>(D)</bold> The expression of key genes in 9 types of cells is shown in a bubble plot. <bold>(E)</bold> The expression of key genes in 9 types of cells is shown in the violin plot.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1755280-g003.tif">
<alt-text content-type="machine-generated">Panel A shows a UMAP plot with clusters of colored dots representing cell populations. Panel B labels clusters with cell types such as fibroblasts and T cells. Panel C presents gene expression UMAP plots for multiple genes, with color intensity indicating expression level. Panel D is a dot plot depicting average gene expression and percent expression for ten genes across eight cell types, with dot size and color as indicators. Panel E displays multiple bar graphs of gene expression levels by cell identity for the same ten genes.</alt-text>
</graphic></fig>
<p>We extracted the compounds corresponding to the 9 key genes on the basis of the target component of the previous drug and displayed them in the form of a Cytoscape (<xref ref-type="fig" rid="f4"><bold>Figure&#xa0;4A</bold></xref>). Among these genes, Que had the highest correlation with the 9 key genes. The results revealed that the binding energy of the 9 target genes with Que was less than -5 kcal/mol and that the receptor and ligand could spontaneously bind and have strong binding activity (<xref ref-type="fig" rid="f4"><bold>Figures&#xa0;4B-I</bold></xref>, <xref ref-type="table" rid="T5"><bold>Table&#xa0;5</bold></xref>). To validate the bioinformatic predictions, we employed cellular models. The cytocompatible concentration range of Que was first determined in both RAW264.7 cells and HUVECs (<xref ref-type="fig" rid="f5"><bold>Figures&#xa0;5A, B</bold></xref>). Based on this assessment and previous literature (<xref ref-type="bibr" rid="B30">30</xref>), a concentration of 25 &#x3bc;M Que was selected for CETSA. The CETSA results confirmed that Que directly binds to and stabilizes HIF1&#x3b1; in HUVECs (<xref ref-type="fig" rid="f5"><bold>Figures&#xa0;5C, D</bold></xref>). Furthermore, within a LPS-stimulated macrophage-endothelial co-culture system, Que was found to enhance the expression of both HIF1&#x3b1; and its downstream target VEGF (<xref ref-type="fig" rid="f5"><bold>Figures&#xa0;5E-G</bold></xref>). It is well established that diabetic wounds are characterized by persistent inflammation, which contributes to impaired healing (<xref ref-type="bibr" rid="B31">31</xref>). Based on these findings, our subsequent investigation into the mechanism of action primarily focused on the modulation of inflammatory responses and the promotion of wound repair.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Schematic diagram of the gene target map and molecular docking. <bold>(A)</bold> Component&#x2013;gene target map. <bold>(B)</bold> Molecular docking diagram of Que and AR. <bold>(C)</bold> Molecular docking diagram of Que and HIF1A. <bold>(D)</bold> Molecular docking diagram of Que and IGFBP3. <bold>(E)</bold> Molecular docking diagram of Que and IL-1B. <bold>(F)</bold> Molecular docking diagram of Que and IL-6. <bold>(G)</bold> Molecular docking diagram of Que and NFE2L2. <bold>(H)</bold> Molecular docking diagram of Que and INSR. <bold>(I)</bold> Molecular docking diagram of Que and CD40LG.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1755280-g004.tif">
<alt-text content-type="machine-generated">Panel A presents a network diagram showing interactions between various compounds, including quercetin, and target proteins labeled in pink nodes, with connecting green lines indicating associations. Panels B to I display molecular docking visualizations of quercetin (highlighted in cyan) bound to the active sites of specific protein targets (AR, HIF1A, IGFBP3, IL1B, IL6, NFE2L2, INSR, CD40LG) depicted in ribbon structure with amino acid residues shown and labeled.</alt-text>
</graphic></fig>
<table-wrap id="T5" position="float">
<label>Table&#xa0;5</label>
<caption>
<p>Binding energies of Que and core targets.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Core target</th>
<th valign="middle" align="center">AR</th>
<th valign="middle" align="center">HIF1A</th>
<th valign="middle" align="center">IGFBP3</th>
<th valign="middle" align="center">IL1B</th>
<th valign="middle" align="center">IL6</th>
<th valign="middle" align="center">NFE2L2</th>
<th valign="middle" align="center">INSR</th>
<th valign="middle" align="center">CD40LG</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="center">Binding energy (kcal/mol)</td>
<td valign="middle" align="center">-6.8</td>
<td valign="middle" align="center">-7.4</td>
<td valign="middle" align="center">-7.3</td>
<td valign="middle" align="center">-7.3</td>
<td valign="middle" align="center">-6.6</td>
<td valign="middle" align="center">-6.2</td>
<td valign="middle" align="center">-7.3</td>
<td valign="middle" align="center">-6.0</td>
</tr>
</tbody>
</table>
</table-wrap>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Effects of Que on LPS-induced co-culture system of RAW264.7 and HUVECs. <bold>(A)</bold> Cytotoxicity assessment of Que on HUVECs by cell viability assay. <bold>(B)</bold> Cytotoxicity assessment of Que on RAW264.7 macrophages by cell viability assay. <bold>(C)</bold> Representative Western blot images from CETSA. <bold>(D)</bold> Quantitative analysis of CETSA results. <bold>(E)</bold> Representative Western blot images showing protein levels of HIF-1&#x3b1; and VEGF in LPS-stimulated RAW264.7 and HUVEC co-culture system treated with Que at indicated concentrations. <bold>(F)</bold> Quantitative analysis of HIF-1&#x3b1; protein expression normalized to &#x3b2;-actin. <bold>(G)</bold> Quantitative analysis of VEGF protein expression normalized to &#x3b2;-actin. (All data are expressed as the mean &#xb1; SD (n = 3), *P &lt; 0.05, **P &lt; 0.01, ***P &lt; 0.001, ****P &lt; 0.0001. <bold>(A, B)</bold> vs. Control group; <bold>(E&#x2013;G)</bold> vs. LPS group.).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1755280-g005.tif">
<alt-text content-type="machine-generated">Panel A displays a bar graph showing decreased HUVEC cell viability with increasing Quercetin (Que) concentrations. Panel B presents a similar trend in RAW264.7 cells. Panel C includes western blot results indicating HIF1&#x3b1; protein levels and &#x3b2;-actin loading control at various temperatures with or without Que treatment. Panel D illustrates a line graph of relative HIF1&#x3b1; intensity versus temperature for DMSO and Que-treated groups, where Que reduces HIF1&#x3b1; stability. Panel E shows a western blot of HIF1&#x3b1; and VEGF expression in RAW264.7 cells after LPS and Que treatment. Panels F and G depict bar graphs quantifying HIF1&#x3b1; and VEGF protein levels, respectively, normalized to &#x3b2;-actin across indicated experimental conditions.</alt-text>
</graphic></fig>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Que accelerated wound healing in diabetic rats</title>
<sec id="s3_2_1">
<label>3.2.1</label>
<title>Effects of Que on body weight, biochemical parameters and wound tissue pathology in rats</title>
<p>To investigate the potential impact of Que on the progression of chronic diabetic wound healing, we used type 1 diabetic SD rats to further evaluate wound healing rates and quality (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6A</bold></xref>). As shown in <xref ref-type="fig" rid="f6"><bold>Figures&#xa0;6B, C</bold></xref>, on the 7th and 14th days, compared with the sham group, the model group exhibited a significant decrease in body weight, and the upper plasma presented a milky white and turbid appearance. In contrast, Que intervention attenuated the decrease in body weight of diabetic rats, and the plasma was clear and pale yellow. Oral glucose tolerance test data revealed a rapid increase in serum glucose levels in all groups following glucose administration, peaking at approximately 30 min, followed by a gradual decrease. Compared with the sham group, the model group presented significantly elevated serum glucose levels at all time-matched time points (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6D</bold></xref>). Que treatment also significantly reduced T-CHO, TG, and LDL-C levels (<xref ref-type="fig" rid="f6"><bold>Figures&#xa0;6E-G</bold></xref>) while increasing INS concentrations (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6H</bold></xref>). Compared with those in the untreated model groups, the levels of inflammatory cytokines, particularly TNF-&#x3b1; and IL-1&#x3b2;, were markedly lower in the Que-treated groups (<xref ref-type="fig" rid="f6"><bold>Figures&#xa0;6I, J</bold></xref>).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Effects of Que on the serum biochemical indices of diabetic wound-bearing rats. <bold>(A)</bold> Timeline of the rat experiment. <bold>(B)</bold> Representative pictures of the serum of each group of rats. <bold>(C)</bold> Weights of the rats in each group. <bold>(D)</bold> OGTTs of the rats in each group. <bold>(E)</bold> T-CHO levels in the serum of the rats in each group. <bold>(F)</bold> TG levels in the serum of the rats in each group. <bold>(G)</bold> LDL-C in the serum of the rats in each group. <bold>(H)</bold> INS in the serum of the rats in each group. <bold>(I)</bold> T-CHO levels in the serum of the rats in each group. <bold>(J)</bold> IL-1&#x3b2; levels in the serum of the rats in each group. (All data are expressed as the mean &#xb1; SD (n = 6), *P &lt; 0.05, **P &lt; 0.01, ***P &lt; 0.001, ****P &lt; 0.0001, vs. Model).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1755280-g006.tif">
<alt-text content-type="machine-generated">Experimental timeline diagram illustrates STZ injection, wound creation, and sample collection in mice models, followed by representative images of blood samples at days seven and fourteen, bar graphs of body weight, total cholesterol, triglycerides, LDL cholesterol, insulin, TNF-alpha, and IL-1beta levels, and a line graph showing blood glucose levels over time across Sham, Model, Que, and Met groups.</alt-text>
</graphic></fig>
<p><xref ref-type="fig" rid="f7"><bold>Figures&#xa0;7A-C</bold></xref> shows that, compared with that in the sham group, the wound healing process in the model group was prolonged, and the wound healing rate was lower. After treatment with Que, the wound healing rates improved within 14 days. To investigate the potential advantages of Que at different stages of chronic diabetic wound healing, we focused on detecting neovascularization within 7 days and collagen fibre deposition within 14 days. On day 7, diabetic wounds treated with Que displayed an increased relative number of of neovessels, occasional granulation tissue with new blood vessels, and collagen formation characterized by well-arranged fibroblasts. On day 14, the collagen fibres in the Que group were not only densely packed but also regularly arranged, indicating the initiation of the remodelling phase (<xref ref-type="fig" rid="f7"><bold>Figure&#xa0;7D</bold></xref>). Masson staining further confirmed that, compared with the model group, the newly synthesized collagen fibers in the Que group exhibited a significantly higher density and more ordered structure (<xref ref-type="fig" rid="f7"><bold>Figures&#xa0;7E, F</bold></xref>).</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Histological evaluation of the ability of Que to promote diabetic wound healing. <bold>(A)</bold> Representative images depicting full-thickness skin defects in diabetic rats at various time points (0, 3, 7, 10 and 14 days) following drug administration. <bold>(B)</bold> Wound healing rates in each group of diabetic rats. (All data are expressed as the mean &#xb1; SD (n = 6), * P &lt; 0.05, ** P &lt; 0.01, *** P &lt; 0.001, **** P &lt; 0.0001, vs. Model) <bold>(C)</bold> Visualization of the wounds in each group of diabetic rats. <bold>(D)</bold> Hematoxylin&#x2013;eosin-stained images of the wounds of diabetic rats in each group on the 7th and 14th days after surgery. <bold>(E)</bold> Masson-stained images of the wounds of diabetic rats in each group on the 14th day after surgery. <bold>(F)</bold> Quantitative analysis on collagen deposition in each group. [All data are expressed as the mean &#xb1; SD (n = 3)].</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1755280-g007.tif">
<alt-text content-type="machine-generated">Panel A shows a series of wound photographs over 14 days for four groups (Sham, Model, Que, Met) at five time points. Panel B presents a bar graph tracking percent wound area closure for each group over time in days. Panel C consists of four heatmap-style graphics depicting wound spatial distribution for each group. Panel D contains histological images from day 7 and day 14 stained with hematoxylin and eosin for each group. Panel E displays Masson's trichrome-stained tissue sections at day 14 for collagen analysis, each with a magnified inset below. Panel F provides a bar graph comparing collagen deposition percentage among groups.</alt-text>
</graphic></fig>
</sec>
<sec id="s3_2_2">
<label>3.2.2</label>
<title>Effects of Que on the serum metabolome of rats</title>
<p>To further interpret the changes in metabolites in the serum of the rats in the disease state, the serum of the rats in each group on day 14 was analyzed via untargeted metabolomics. Spearman&#x2019;s rank correlation coefficient (r &gt; 0.8) was obtained for all pairwise sample comparisons, indicating high methodological consistency and robust biological reproducibility (<xref ref-type="fig" rid="f8"><bold>Figure&#xa0;8A</bold></xref>). PCA revealed distinct segregation of the model group from both the sham and Que-treated groups but partial overlap with the metformin intervention group. Significant differences were observed between the Que-treated group and the model group along both the PC1 and PC2 dimensions (<xref ref-type="fig" rid="f8"><bold>Figure&#xa0;8B</bold></xref>). OPLS-DA modelling revealed that both the sham vs. model comparison and model vs. Que-treated group comparisons presented a Q2Y &gt; 0.5, with permutation tests demonstrating positive slopes in the corresponding validation regression lines. These parameters confirm the statistical validity and biological reliability of the OPLS-DA models for differential metabolites screening (<xref ref-type="fig" rid="f8"><bold>Figures&#xa0;8C-F</bold></xref>). Univariate statistical analysis of all detected metabolites was performed. As demonstrated by volcano plots, significantly differential metabolites were identified between the sham and model groups, as well as between the model and Que-treated groups, under both positive and negative ionization modes (<xref ref-type="fig" rid="f8"><bold>Figures&#xa0;8G, H</bold></xref>). In <xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Table S1</bold></xref>, metabolites with FC &#x2265; 2 or &#x2264; 0.5, VIP &#x2265; 1, and P &lt; 0.05 in the t test were selected as significantly differential metabolites. Comparative analysis among the sham, model, and Que-treated groups revealed 673 differentially abundant metabolites with significant variations in relative abundance. These included 334 metabolites detected in negative ionization mode and 339 in positive ionization mode, including 313 upregulated and 360 downregulated species.</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Effects of Que on the metabolism of diabetic wounds in rat serum. <bold>(A)</bold> Schematic diagram of the intersample correlation. <bold>(B)</bold> PCA statistical chart of samples. <bold>(C)</bold> OPLS-DA score plot of the sham group and model group. <bold>(D)</bold> OPLS-DA model permutation test plot of the sham group and model group. <bold>(E)</bold> OPLS-DA score plot of the Model group and the Que group. <bold>(F)</bold> OPLS-DA model permutation test plot of the Model group and Que group. <bold>(G)</bold> Volcano plot of the sham group and model group. <bold>(H)</bold> Volcano plot of the Model group and the Que group. (Sham group: A1&#x2013;A6; Model group: B1&#x2013;B6; Que group: C1&#x2013;C6; Met group: D1&#x2013;D6. Quality Control (QC) is a pooled mixture of equal aliquots from all experimental samples).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1755280-g008.tif">
<alt-text content-type="machine-generated">Panel A shows a clustered heatmap with labeled columns and rows representing grouped data with a blue gradient scale. Panel B displays a principal component analysis scatter plot with five distinct color-coded groups clustered separately. Panels C and E present OPLS-DA score plots comparing group differences. Panels D and F display correlation coefficient plots with red and blue data points. Panels G and H show volcano plots with differentially expressed variables highlighted, annotated with gene or compound names.</alt-text>
</graphic></fig>
</sec>
<sec id="s3_2_3">
<label>3.2.3</label>
<title>Effects of Que on the diversity of gut bacteria in rats</title>
<p>Owing to the important role of the gut bacteria in disease, the fecal samples of the rats were analyzed. A total of 1464722 CCS sequences were retrieved from 24 samples after sequencing and barcode identification (<xref ref-type="table" rid="T6"><bold>Table&#xa0;6</bold></xref>), and the alpha diversity indices were calculated via Mothur version 1.30 (<xref ref-type="table" rid="T7"><bold>Table&#xa0;7</bold></xref>). According to the results of the analysis, the sequencing depth of each sample was adequate and saturated, as shown by the Shannon and rarefaction analyses. Most of the microbial diversity information and the structure of the bacterial communities were reflected (<xref ref-type="fig" rid="f9"><bold>Figures&#xa0;9A, B</bold></xref>). The Venn diagrams constructed on the basis of distinct groupings revealed that the four-way intersection contained 797 shared features (<xref ref-type="fig" rid="f9"><bold>Figure&#xa0;9C</bold></xref>). PCA was subsequently performed on the samples, revealing distinct differences among the experimental groups. Although the Quercetin-treated group did not completely overlap with the Sham group in the PCA space, it exhibited a distinct separation from the Model group. This trajectory suggests that Quercetin intervention drives the gut microbiota towards an alternative beneficial equilibrium via structural remodeling, likely by specifically regulating key functional taxa rather than purely reversing the community structure to the naive state (<xref ref-type="fig" rid="f9"><bold>Figure&#xa0;9D</bold></xref>). Compared with the sham group, the model group presented significantly elevated levels of <italic>Clostridia</italic>, <italic>Negativicutes</italic>, and <italic>Desulfovibrionia</italic> at the class taxonomic rank (P &lt; 0.05). Notably, <italic>Clostridia</italic> and <italic>Desulfovibrionia</italic> abundances were significantly reduced following Que intervention (P &lt; 0.05) (<xref ref-type="fig" rid="f9"><bold>Figure&#xa0;9E</bold></xref>). At the genus level, the model group presented significantly greater abundances of <italic>Lactobacillus</italic>, <italic>Ruminococcus</italic>, <italic>unclassified_Lachnospiraceae</italic>, <italic>uncultured_rumen_bacterium</italic>, and <italic>unclassified_Ruminococcaceae</italic> than did the sham group (P &lt; 0.05), whereas the abundances of <italic>Romboutsia</italic>, <italic>Allobaculum</italic>, and <italic>Ligilactobacillus</italic> were significantly lower (P &lt; 0.05). Following Que intervention, a marked decrease in <italic>Romboutsia</italic>, <italic>uncultured_rumen_bacterium</italic>, and <italic>unclassified_Ruminococcaceae</italic> was observed (P &lt; 0.05), accompanied by a significant increase in <italic>Ligilactobacillus</italic> abundance (P &lt; 0.05) (<xref ref-type="fig" rid="f9"><bold>Figure&#xa0;9F</bold></xref>). Further functional prediction and annotation of the 16S rRNA sequencing data were performed via PICRUSt2. Functional prediction analysis of the microbiota revealed that Que significantly modulated multiple pathways in diabetic wound rats, including those related to bacterial infections and immune regulation. This further highlights the critical role of inflammatory responses in the disease progression (<xref ref-type="fig" rid="f9"><bold>Figures&#xa0;9G, H</bold></xref>).</p>
<table-wrap id="T6" position="float">
<label>Table&#xa0;6</label>
<caption>
<p>Statistics of the sample sequencing data processing results.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Sample ID</th>
<th valign="middle" align="center">Raw CCS</th>
<th valign="middle" align="center">Clean CCS</th>
<th valign="middle" align="center">Effective CCS</th>
<th valign="middle" align="center">AvgLen (bp)</th>
<th valign="middle" align="center">Effective (%)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="center">A1</td>
<td valign="middle" align="center">57679</td>
<td valign="middle" align="center">57619</td>
<td valign="middle" align="center">44825</td>
<td valign="middle" align="center">1458</td>
<td valign="middle" align="center">77.71</td>
</tr>
<tr>
<td valign="middle" align="center">A2</td>
<td valign="middle" align="center">59293</td>
<td valign="middle" align="center">59241</td>
<td valign="middle" align="center">45689</td>
<td valign="middle" align="center">1457</td>
<td valign="middle" align="center">77.06</td>
</tr>
<tr>
<td valign="middle" align="center">A3</td>
<td valign="middle" align="center">64600</td>
<td valign="middle" align="center">64542</td>
<td valign="middle" align="center">49693</td>
<td valign="middle" align="center">1457</td>
<td valign="middle" align="center">76.92</td>
</tr>
<tr>
<td valign="middle" align="center">A4</td>
<td valign="middle" align="center">57219</td>
<td valign="middle" align="center">57173</td>
<td valign="middle" align="center">43850</td>
<td valign="middle" align="center">1458</td>
<td valign="middle" align="center">76.64</td>
</tr>
<tr>
<td valign="middle" align="center">A5</td>
<td valign="middle" align="center">61756</td>
<td valign="middle" align="center">61709</td>
<td valign="middle" align="center">47425</td>
<td valign="middle" align="center">1458</td>
<td valign="middle" align="center">76.79</td>
</tr>
<tr>
<td valign="middle" align="center">A6</td>
<td valign="middle" align="center">60011</td>
<td valign="middle" align="center">59965</td>
<td valign="middle" align="center">46696</td>
<td valign="middle" align="center">1458</td>
<td valign="middle" align="center">77.81</td>
</tr>
<tr>
<td valign="middle" align="center">B1</td>
<td valign="middle" align="center">65409</td>
<td valign="middle" align="center">65361</td>
<td valign="middle" align="center">48244</td>
<td valign="middle" align="center">1463</td>
<td valign="middle" align="center">73.76</td>
</tr>
<tr>
<td valign="middle" align="center">B2</td>
<td valign="middle" align="center">59020</td>
<td valign="middle" align="center">59000</td>
<td valign="middle" align="center">43632</td>
<td valign="middle" align="center">1463</td>
<td valign="middle" align="center">73.93</td>
</tr>
<tr>
<td valign="middle" align="center">B3</td>
<td valign="middle" align="center">61862</td>
<td valign="middle" align="center">61811</td>
<td valign="middle" align="center">45293</td>
<td valign="middle" align="center">1463</td>
<td valign="middle" align="center">73.22</td>
</tr>
<tr>
<td valign="middle" align="center">B4</td>
<td valign="middle" align="center">61440</td>
<td valign="middle" align="center">61398</td>
<td valign="middle" align="center">45275</td>
<td valign="middle" align="center">1462</td>
<td valign="middle" align="center">73.69</td>
</tr>
<tr>
<td valign="middle" align="center">B5</td>
<td valign="middle" align="center">68177</td>
<td valign="middle" align="center">68114</td>
<td valign="middle" align="center">49605</td>
<td valign="middle" align="center">1463</td>
<td valign="middle" align="center">72.76</td>
</tr>
<tr>
<td valign="middle" align="center">B6</td>
<td valign="middle" align="center">56792</td>
<td valign="middle" align="center">56768</td>
<td valign="middle" align="center">41245</td>
<td valign="middle" align="center">1462</td>
<td valign="middle" align="center">72.62</td>
</tr>
<tr>
<td valign="middle" align="center">C1</td>
<td valign="middle" align="center">59598</td>
<td valign="middle" align="center">59558</td>
<td valign="middle" align="center">44979</td>
<td valign="middle" align="center">1464</td>
<td valign="middle" align="center">75.47</td>
</tr>
<tr>
<td valign="middle" align="center">C2</td>
<td valign="middle" align="center">54839</td>
<td valign="middle" align="center">54801</td>
<td valign="middle" align="center">41314</td>
<td valign="middle" align="center">1464</td>
<td valign="middle" align="center">75.34</td>
</tr>
<tr>
<td valign="middle" align="center">C3</td>
<td valign="middle" align="center">66519</td>
<td valign="middle" align="center">66476</td>
<td valign="middle" align="center">49336</td>
<td valign="middle" align="center">1464</td>
<td valign="middle" align="center">74.17</td>
</tr>
<tr>
<td valign="middle" align="center">C4</td>
<td valign="middle" align="center">67556</td>
<td valign="middle" align="center">67503</td>
<td valign="middle" align="center">48622</td>
<td valign="middle" align="center">1461</td>
<td valign="middle" align="center">71.97</td>
</tr>
<tr>
<td valign="middle" align="center">C5</td>
<td valign="middle" align="center">57927</td>
<td valign="middle" align="center">57881</td>
<td valign="middle" align="center">42352</td>
<td valign="middle" align="center">1461</td>
<td valign="middle" align="center">73.11</td>
</tr>
<tr>
<td valign="middle" align="center">C6</td>
<td valign="middle" align="center">63937</td>
<td valign="middle" align="center">63894</td>
<td valign="middle" align="center">47318</td>
<td valign="middle" align="center">1461</td>
<td valign="middle" align="center">74.01</td>
</tr>
<tr>
<td valign="middle" align="center">D1</td>
<td valign="middle" align="center">56354</td>
<td valign="middle" align="center">56315</td>
<td valign="middle" align="center">40351</td>
<td valign="middle" align="center">1460</td>
<td valign="middle" align="center">71.6</td>
</tr>
<tr>
<td valign="middle" align="center">D2</td>
<td valign="middle" align="center">60006</td>
<td valign="middle" align="center">59959</td>
<td valign="middle" align="center">42488</td>
<td valign="middle" align="center">1460</td>
<td valign="middle" align="center">70.81</td>
</tr>
<tr>
<td valign="middle" align="center">D3</td>
<td valign="middle" align="center">59250</td>
<td valign="middle" align="center">59182</td>
<td valign="middle" align="center">41957</td>
<td valign="middle" align="center">1460</td>
<td valign="middle" align="center">70.81</td>
</tr>
<tr>
<td valign="middle" align="center">D4</td>
<td valign="middle" align="center">58427</td>
<td valign="middle" align="center">58347</td>
<td valign="middle" align="center">43546</td>
<td valign="middle" align="center">1460</td>
<td valign="middle" align="center">74.53</td>
</tr>
<tr>
<td valign="middle" align="center">D5</td>
<td valign="middle" align="center">64882</td>
<td valign="middle" align="center">64807</td>
<td valign="middle" align="center">47711</td>
<td valign="middle" align="center">1461</td>
<td valign="middle" align="center">73.54</td>
</tr>
<tr>
<td valign="middle" align="center">D6</td>
<td valign="middle" align="center">62169</td>
<td valign="middle" align="center">62116</td>
<td valign="middle" align="center">44841</td>
<td valign="middle" align="center">1460</td>
<td valign="middle" align="center">72.13</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="T7" position="float">
<label>Table&#xa0;7</label>
<caption>
<p>Alpha diversity index statistics.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Sample ID</th>
<th valign="middle" align="center">Feature</th>
<th valign="middle" align="center">ACE</th>
<th valign="middle" align="center">Chao1</th>
<th valign="middle" align="center">Simpson</th>
<th valign="middle" align="center">Shannon</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="center">A1</td>
<td valign="middle" align="center">787</td>
<td valign="middle" align="center">948.0075</td>
<td valign="middle" align="center">947.0085</td>
<td valign="middle" align="center">0.9389</td>
<td valign="middle" align="center">5.3946</td>
</tr>
<tr>
<td valign="middle" align="center">A2</td>
<td valign="middle" align="center">807</td>
<td valign="middle" align="center">966.2308</td>
<td valign="middle" align="center">961.4</td>
<td valign="middle" align="center">0.9421</td>
<td valign="middle" align="center">5.4532</td>
</tr>
<tr>
<td valign="middle" align="center">A3</td>
<td valign="middle" align="center">830</td>
<td valign="middle" align="center">999.7341</td>
<td valign="middle" align="center">989.2</td>
<td valign="middle" align="center">0.9426</td>
<td valign="middle" align="center">5.4581</td>
</tr>
<tr>
<td valign="middle" align="center">A4</td>
<td valign="middle" align="center">810</td>
<td valign="middle" align="center">985.2959</td>
<td valign="middle" align="center">990.9076</td>
<td valign="middle" align="center">0.9554</td>
<td valign="middle" align="center">5.7955</td>
</tr>
<tr>
<td valign="middle" align="center">A5</td>
<td valign="middle" align="center">814</td>
<td valign="middle" align="center">1041.9201</td>
<td valign="middle" align="center">1043.0268</td>
<td valign="middle" align="center">0.9565</td>
<td valign="middle" align="center">5.8141</td>
</tr>
<tr>
<td valign="middle" align="center">A6</td>
<td valign="middle" align="center">776</td>
<td valign="middle" align="center">949.7853</td>
<td valign="middle" align="center">935.5537</td>
<td valign="middle" align="center">0.956</td>
<td valign="middle" align="center">5.7486</td>
</tr>
<tr>
<td valign="middle" align="center">B1</td>
<td valign="middle" align="center">879</td>
<td valign="middle" align="center">1001.6018</td>
<td valign="middle" align="center">1006.5508</td>
<td valign="middle" align="center">0.9304</td>
<td valign="middle" align="center">6.1007</td>
</tr>
<tr>
<td valign="middle" align="center">B2</td>
<td valign="middle" align="center">863</td>
<td valign="middle" align="center">1026.0558</td>
<td valign="middle" align="center">1030.6316</td>
<td valign="middle" align="center">0.9282</td>
<td valign="middle" align="center">6.0847</td>
</tr>
<tr>
<td valign="middle" align="center">B3</td>
<td valign="middle" align="center">878</td>
<td valign="middle" align="center">1077.7258</td>
<td valign="middle" align="center">1153.0333</td>
<td valign="middle" align="center">0.9298</td>
<td valign="middle" align="center">6.1068</td>
</tr>
<tr>
<td valign="middle" align="center">B4</td>
<td valign="middle" align="center">885</td>
<td valign="middle" align="center">1072.8824</td>
<td valign="middle" align="center">1086.4091</td>
<td valign="middle" align="center">0.9323</td>
<td valign="middle" align="center">6.142</td>
</tr>
<tr>
<td valign="middle" align="center">B5</td>
<td valign="middle" align="center">898</td>
<td valign="middle" align="center">1059.771</td>
<td valign="middle" align="center">1071.9279</td>
<td valign="middle" align="center">0.9364</td>
<td valign="middle" align="center">6.2162</td>
</tr>
<tr>
<td valign="middle" align="center">B6</td>
<td valign="middle" align="center">866</td>
<td valign="middle" align="center">1050.3068</td>
<td valign="middle" align="center">1098.7629</td>
<td valign="middle" align="center">0.943</td>
<td valign="middle" align="center">6.3331</td>
</tr>
<tr>
<td valign="middle" align="center">C1</td>
<td valign="middle" align="center">669</td>
<td valign="middle" align="center">842.2276</td>
<td valign="middle" align="center">850.069</td>
<td valign="middle" align="center">0.9049</td>
<td valign="middle" align="center">5.4624</td>
</tr>
<tr>
<td valign="middle" align="center">C2</td>
<td valign="middle" align="center">630</td>
<td valign="middle" align="center">783.5379</td>
<td valign="middle" align="center">763.6277</td>
<td valign="middle" align="center">0.921</td>
<td valign="middle" align="center">5.534</td>
</tr>
<tr>
<td valign="middle" align="center">C3</td>
<td valign="middle" align="center">692</td>
<td valign="middle" align="center">842.907</td>
<td valign="middle" align="center">844.6452</td>
<td valign="middle" align="center">0.9134</td>
<td valign="middle" align="center">5.5643</td>
</tr>
<tr>
<td valign="middle" align="center">C4</td>
<td valign="middle" align="center">724</td>
<td valign="middle" align="center">858.5883</td>
<td valign="middle" align="center">862.2609</td>
<td valign="middle" align="center">0.9384</td>
<td valign="middle" align="center">6.0093</td>
</tr>
<tr>
<td valign="middle" align="center">C5</td>
<td valign="middle" align="center">713</td>
<td valign="middle" align="center">858.4725</td>
<td valign="middle" align="center">852.7449</td>
<td valign="middle" align="center">0.9403</td>
<td valign="middle" align="center">6.0853</td>
</tr>
<tr>
<td valign="middle" align="center">C6</td>
<td valign="middle" align="center">736</td>
<td valign="middle" align="center">955.2406</td>
<td valign="middle" align="center">965.5109</td>
<td valign="middle" align="center">0.9405</td>
<td valign="middle" align="center">6.0585</td>
</tr>
<tr>
<td valign="middle" align="center">D1</td>
<td valign="middle" align="center">852</td>
<td valign="middle" align="center">1028.4629</td>
<td valign="middle" align="center">1039.0263</td>
<td valign="middle" align="center">0.9489</td>
<td valign="middle" align="center">6.2344</td>
</tr>
<tr>
<td valign="middle" align="center">D2</td>
<td valign="middle" align="center">843</td>
<td valign="middle" align="center">983.723</td>
<td valign="middle" align="center">1038.4045</td>
<td valign="middle" align="center">0.952</td>
<td valign="middle" align="center">6.332</td>
</tr>
<tr>
<td valign="middle" align="center">D3</td>
<td valign="middle" align="center">877</td>
<td valign="middle" align="center">1022.8276</td>
<td valign="middle" align="center">1026.9224</td>
<td valign="middle" align="center">0.9596</td>
<td valign="middle" align="center">6.5576</td>
</tr>
<tr>
<td valign="middle" align="center">D4</td>
<td valign="middle" align="center">804</td>
<td valign="middle" align="center">952.5382</td>
<td valign="middle" align="center">975.6804</td>
<td valign="middle" align="center">0.9411</td>
<td valign="middle" align="center">6.0653</td>
</tr>
<tr>
<td valign="middle" align="center">D5</td>
<td valign="middle" align="center">839</td>
<td valign="middle" align="center">999.941</td>
<td valign="middle" align="center">1048.5851</td>
<td valign="middle" align="center">0.9393</td>
<td valign="middle" align="center">5.9225</td>
</tr>
<tr>
<td valign="middle" align="center">D6</td>
<td valign="middle" align="center">866</td>
<td valign="middle" align="center">1020.7502</td>
<td valign="middle" align="center">1013.5203</td>
<td valign="middle" align="center">0.9463</td>
<td valign="middle" align="center">6.2232</td>
</tr>
</tbody>
</table>
</table-wrap>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>Effects of Que on the diversity of gut bacteria in diabetic wound-bearing rats. <bold>(A)</bold> Dilution curve of the samples. <bold>(B)</bold> Shannon curves of the samples. <bold>(C)</bold> Petal plot of the samples. <bold>(D)</bold> PCA statistical chart of samples. <bold>(E)</bold> Structural graph of samples at the class level. <bold>(F)</bold> Structural graph of samples at the species level. <bold>(G)</bold> Statistical chart of COG functional classification between the sham group (A1) and the model group (B1). <bold>(H)</bold> Statistical chart of COG functional classification between the Model group (B1) and the Que group (C1). (Sham group: A1&#x2013;A6; Model group: B1&#x2013;B6; Que group: C1&#x2013;C6; Met group: D1&#x2013;D6).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1755280-g009.tif">
<alt-text content-type="machine-generated">Panel A shows rarefaction curves comparing observed species richness across multiple samples. Panel B provides Shannon diversity curves for the same samples. Panel C contains a four-set Venn diagram illustrating the shared and distinct species among groups A, B, C, and D. Panel D displays a PCA plot that separates sample groups based on principal component analysis. Panel E presents a stacked bar chart showing the relative abundance of major bacterial phyla in different samples. Panel F depicts a stacked bar chart with the relative abundance of bacterial genera per sample. Panel G is a horizontal bar graph comparing functional pathway differences between Sham and Model groups, and panel H compares Model and Que groups, with statistical significance and confidence intervals indicated.</alt-text>
</graphic></fig>
<p>On the basis of the aforementioned results, we further conducted an integrated analysis of the microbiota and metabolome by correlating microbial taxa (at both the phylum and genus levels) with metabolomic data from holistic and differential perspectives. Therefore, the differential metabolites-differential microbes chord diagram (<xref ref-type="fig" rid="f10"><bold>Figures&#xa0;10A, B</bold></xref>) and the differential metabolites-differential microbes network diagram (<xref ref-type="fig" rid="f10"><bold>Figures&#xa0;10C, D</bold></xref>) were constructed. The results showed that after Que intervention, <italic>Anaerosporobacter</italic> was involved in regulating the abnormal metabolism of diseased rats.</p>
<fig id="f10" position="float">
<label>Figure&#xa0;10</label>
<caption>
<p>Serum metabolomics combined with microbial sequencing analysis in diabetic wound-bearing rats. <bold>(A)</bold> Chord diagram of the differential metabolites and differential microbes between the sham group and model group. <bold>(B)</bold> Chord diagram of the differential metabolites and differential microbes between the Model group and the Que group. <bold>(C)</bold> Differential metabolites&#x2013;differential microbes network diagram of the sham group and model group. <bold>(D)</bold> Differential metabolites&#x2013;differential microbes network diagram of the Model group and the Que group.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1755280-g010.tif">
<alt-text content-type="machine-generated">Figure comparing microbial and metabolite associations in different treatment groups using two circular chord diagrams (A: Sham and Model; B: Model and Que) and two network graphs (C: Sham and Model; D: Model and Que), with color-coded connections indicating relationships between microbials and metabolites and distinct interaction patterns visible for each group.</alt-text>
</graphic></fig>
</sec>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Que regulated serum inflammatory factor levels and cell migration through the intestinal flora</title>
<p>To investigate whether Que exerts its therapeutic effects on diabetic wounds through the gut microbiota, an FMT approach was further employed (<xref ref-type="fig" rid="f11"><bold>Figure&#xa0;11A</bold></xref>). The FBG level in FMQ group rats was significantly lower than that in the FM group (<xref ref-type="table" rid="T8"><bold>Table&#xa0;8</bold></xref>). As shown in <xref ref-type="fig" rid="f11"><bold>Figures&#xa0;11B-E</bold></xref>, rats in the FMQ group presented higher protein expression levels of ZO-1, Occludin, and Claudin-1 than those in the FM group did, indicating that FMT contributed to the restoration of the intestinal barrier in diabetic rats.</p>
<fig id="f11" position="float">
<label>Figure&#xa0;11</label>
<caption>
<p>Effects of FMT on intestinal permeability in diabetic rats and effects of rat serum after FMT on Raw264.7 cells. <bold>(A)</bold> Timeline of the rat experiment. <bold>(B)</bold> The expression levels of ZO-1, Claudin 1 and Occludin in rat intestinal tissue. <bold>(C)</bold> Statistical analysis of ZO-1 levels in rat intestinal tissue. <bold>(D)</bold> Statistical analysis of Claudin 1 levels in rat intestinal tissue. <bold>(E)</bold> Statistical analysis of Occludin levels in rat intestinal tissue. <bold>(F)</bold> Effects of each group of samples on the viability of RAW264.7 cells. <bold>(G)</bold> The expression level of IL-1&#x3b2; mRNA in each group of RAW264.7 cells. <bold>(H)</bold> The expression level of IL-6 mRNA in each group of RAW264.7 cells. <bold>(I)</bold> The expression level of TNF-&#x3b1; mRNA in each group of RAW264.7 cells. <bold>(J)</bold> The expression level of IL-10 mRNA in each group of RAW264.7 cells. (All data are expressed as the mean &#xb1; SD (n = 3), *P &lt; 0.05, **P &lt; 0.01, ***P &lt; 0.001, ****P &lt; 0.0001, vs. FM).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1755280-g011.tif">
<alt-text content-type="machine-generated">Panel A outlines an experimental workflow involving mice, including antibiotic treatment, STZ injection, oral gavage, wound creation, and timed sample collection. Panel B shows Western blots of ZO-1, Occludin, Claudin 1, and &#x3b2;-actin protein across four groups (FS, FM, FQ, FMQ). Panels C-E display bar graphs comparing protein expression levels of ZO-1, Occludin, and Claudin 1 normalized to &#x3b2;-actin. Panel F presents cell viability percentages by group. Panels G-J provide bar graphs for mRNA expression of IL-1&#x3b2;, IL-6, TNF-&#x3b1;, and IL-10 relative to &#x3b2;-actin.</alt-text>
</graphic></fig>
<table-wrap id="T8" position="float">
<label>Table&#xa0;8</label>
<caption>
<p>FBG levels in FMT Rats on Day 14.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Groups</th>
<th valign="middle" align="center">Number</th>
<th valign="middle" align="center">FBG (mM)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="center">FS</td>
<td valign="middle" align="center">6</td>
<td valign="middle" align="center">7.47 &#xb1; 0.57****</td>
</tr>
<tr>
<td valign="middle" align="center">FM</td>
<td valign="middle" align="center">6</td>
<td valign="middle" align="center">28.43 &#xb1; 0.81</td>
</tr>
<tr>
<td valign="middle" align="center">FQ</td>
<td valign="middle" align="center">6</td>
<td valign="middle" align="center">24.63 &#xb1; 0.33**</td>
</tr>
<tr>
<td valign="middle" align="center">FMQ</td>
<td valign="middle" align="center">6</td>
<td valign="middle" align="center">21.83 &#xb1; 1.13*</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>* P &lt; 0.05, ** P &lt; 0.01, *** P &lt; 0.001, **** P &lt; 0.0001.</p></fn>
</table-wrap-foot>
</table-wrap>
<p>To observe the effects of the FS, FM, FQ, and FMQ groups on cells, the MTT assay results revealed that, compared with the FM group, the FMQ group significantly increased the viability of RAW264.7 cells (<xref ref-type="fig" rid="f11"><bold>Figure&#xa0;11F</bold></xref>). RT&#x2013;qPCR analysis revealed that FMQ significantly upregulated IL-10 mRNA expression in RAW264.7 cells but downregulated the mRNA levels of TNF-&#x3b1;, IL-1&#x3b2;, and IL-6 (<xref ref-type="fig" rid="f11"><bold>Figures&#xa0;11G-J</bold></xref>).</p>
<p>As shown in <xref ref-type="fig" rid="f12"><bold>Figure&#xa0;12A</bold></xref>, compared with the FM group, the FMQ group significantly increased the viability of HUVECs. RT&#x2013;qPCR analysis confirmed that FMQ significantly upregulated the mRNA expression levels of HIA1&#x3b1; and VEGF in HUVECs (<xref ref-type="fig" rid="f12"><bold>Figures&#xa0;12B, C</bold></xref>). As shown in <xref ref-type="fig" rid="f12"><bold>Figures&#xa0;12D, E</bold></xref>, ROS levels were significantly increased in the FM group, whereas FMT intervention markedly reduced ROS levels in the FMQ group. The Transwell assay results of HUVECs further demonstrated that the FM group displayed a significantly lower number of migrated cells than the FS group did, whereas this migratory capacity was substantially enhanced following FMQ intervention (<xref ref-type="fig" rid="f12"><bold>Figures&#xa0;12F, G</bold></xref>). Additionally, we investigated the neovascularization mediated by FMQ in HUVECs. Compared with those in the FM group, tube formation in FMQ-treated HUVECs was significantly accelerated, manifested as an increase in the number of branches connecting cells and the formation of more tubular loops (<xref ref-type="fig" rid="f12"><bold>Figures&#xa0;12H, I</bold></xref>). Furthermore, the scratch assay results indicated that, compared with that in the FS group, the migration rate of HUVECs in the FM group was significantly lower at 12 h and 24 h. However, treatment with FMQ markedly increased the migration rate at both time points (<xref ref-type="fig" rid="f12"><bold>Figures&#xa0;12J, K</bold></xref>).</p>
<fig id="f12" position="float">
<label>Figure&#xa0;12</label>
<caption>
<p>Effects of rat serum after FMT on HUVECs. <bold>(A)</bold> Effects of each group of samples on the viability of HUVECs. <bold>(B)</bold> The expression level of VEGF mRNA in each group of HUVECs. <bold>(C)</bold> The expression level of HIF1&#x3b1; mRNA in each group of HUVECs. <bold>(D)</bold> Images of ROS generation in each group of HUVECs. DAPI (blue) was used as a nuclear marker. <bold>(E)</bold> Quantitative relative fluorescence assay of DCF in each group of HUVECs. <bold>(F)</bold> Results of the migration ability of each group of HUVECs. <bold>(G)</bold> The number of invading cells in each group of HUVECs. <bold>(H)</bold> In vitro images of tube formation in each group of HUVECs. <bold>(I)</bold> The number of nodes in each group of HUVECs. <bold>(J)</bold> Cell scratch images of each group of HUVECs at 12 h and 24 h. <bold>(K)</bold> Migration rate of each group of HUVECs. (All data are expressed as the mean &#xb1; SD (n = 3), *P &lt; 0.05, **P &lt; 0.01, ***P &lt; 0.001, ****P &lt; 0.0001, vs. FM).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1755280-g012.tif">
<alt-text content-type="machine-generated">Figure containing multiple panels showing experimental data for four groups labeled FS, FM, FQ, and FMQ. Panels A, B, C, E, G, I, and K display bar graphs with statistically significant differences, comparing cell viability, VEGF mRNA, HIF1&#x3b1; mRNA, DCF fluorescence, migration cell number, number of nodes, and migration rate. Panel D presents fluorescent microscopy images with green DCF signal and corresponding merged images for each group. Panel F includes stained cell images to assess migration. Panel H features phase-contrast images depicting tube formation. Panel J provides wound healing assay images at 0, 12, and 24 hours for each group, showing differences in gap closure over time.</alt-text>
</graphic></fig>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>Que accelerated diabetic wound healing through the intestinal flora</title>
<p>As shown in <xref ref-type="fig" rid="f13"><bold>Figures&#xa0;13A, B</bold></xref>, both the FQ and FMQ groups exhibited improved wound healing rates within 14 days after intervention, with the FMQ group demonstrating superior efficacy. On day 7, diabetic wounds treated with FMQ presented an increased relative number of newly formed blood vessels, occasional neovascularization, and a collagen fiber structure coordinated with fibroblasts. By day 14, the FMQ group displayed more complete epidermal structural repair and more orderly cell arrangement, indicating robust tissue regeneration, increased matrix density, and enhanced structural integrity (<xref ref-type="fig" rid="f13"><bold>Figure&#xa0;13C</bold></xref>). Furthermore, Masson&#x2019;s trichrome staining results revealed that the wounds in the FMQ group were filled with abundant blue-stained collagen, demonstrating that this group significantly promoted collagen deposition during the wound healing process (<xref ref-type="fig" rid="f13"><bold>Figures&#xa0;13D, E</bold></xref>). Immunohistochemical analysis revealed that CD31 expression was significantly reduced in FM, whereas treatment with FMQ markedly increased CD31 expression (<xref ref-type="fig" rid="f13"><bold>Figures&#xa0;13F, G</bold></xref>). RT&#x2013;qPCR analysis of wound tissues from the rats in each group revealed that FMQ significantly upregulated the mRNA expression levels of HIF1&#x3b1; and VEGF but downregulated the mRNA expression level of IL-6 (<xref ref-type="fig" rid="f13"><bold>Figures&#xa0;13H-J</bold></xref>). Western blotting analysis further demonstrated that the expression levels of HIF1&#x3b1; and VEGF in wound tissues of rats in the FMQ group were significantly higher than those in the FM group (<xref ref-type="fig" rid="f13"><bold>Figures&#xa0;13K-M</bold></xref>).</p>
<fig id="f13" position="float">
<label>Figure&#xa0;13</label>
<caption>
<p>Effects of FMT on wound healing in diabetic rats. <bold>(A)</bold> Representative images depicting full-thickness skin defects in diabetic rats at various time points (0, 3, 7 and 14 days) following drug administration. <bold>(B)</bold> Wound healing rates in each group of diabetic rats. (All data are expressed as the mean &#xb1; SD (n = 6), *P &lt; 0.05, **P &lt; 0.01, ***P &lt; 0.001, ****P &lt; 0.0001, vs. FM) <bold>(C)</bold> Hematoxylin&#x2013;eosin-stained images of the wounds of diabetic rats in each group on the 7th and 14th days after surgery. <bold>(D)</bold> Masson-stained images of the wounds of diabetic rats in each group on the 14th day after surgery. <bold>(E)</bold> Quantitative analysis on collagen deposition in each group. <bold>(F)</bold> Immunohistochemical detection of CD31 expression in the wounds of diabetic rats in each group on day 7. Positive CD31 staining (brown) revealed newly formed blood vessels. <bold>(G)</bold> Measurement of microvessel density in each group of rats on day 7. <bold>(H)</bold> The expression level of HIF1&#x3b1; mRNA in each group of diabetic wound tissues. <bold>(I)</bold> The expression level of VEGF mRNA in each group of diabetic wound tissues. <bold>(J)</bold> The expression level of IL-6 mRNA in each group of diabetic wound tissues. <bold>(K)</bold> The expression levels of HIF1&#x3b1; and VEGF in each group of diabetic wound tissues. <bold>(L)</bold> Statistical analysis of HIF1&#x3b1; levels in each group of diabetic wound tissues. <bold>(M)</bold> Statistical analysis of VEGF levels in each group of diabetic wound tissues. (All data are expressed as the mean &#xb1; SD (n = 3), *P &lt; 0.05, **P &lt; 0.01, ***P &lt; 0.001, ****P &lt; 0.0001, vs. FM) .</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1755280-g013.tif">
<alt-text content-type="machine-generated">Scientific figure containing multiple panels with wound healing results in four groups (FS, FM, FQ, FMQ): Panel A shows sequential photographs and diagrams of wounds over time; panel B is a bar graph of wound closure percentage over 3, 7, and 14 days; panel C displays tissue histology images at 7 and 14 days; panel D contains collagen staining images and panel E a collagen quantification bar graph; panel F shows CD31 immunostaining for vessels, with panel G quantifying vessel number; panels H-J are bar graphs of mRNA expression levels of HIF1&#x3b1;, VEGF, and IL-6; panel K contains Western blots for HIF1&#x3b1;, VEGF, and &#x3b2;-actin; panels L and M quantify protein expression levels.</alt-text>
</graphic></fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>The healing process of DFU is extremely complex and primarily involves insufficient neovascularization, neuropathy, a high risk of infection, tissue hypoxia, and nonphysiological inflammatory responses, which lead to delayed ulcer healing and the occurrence of highly proinflammatory chronic wounds (<xref ref-type="bibr" rid="B32">32</xref>, <xref ref-type="bibr" rid="B33">33</xref>). TCM, characterized by low toxicity and comprehensive multitarget regulation, has developed rapidly in recent years for the treatment of chronic noncommunicable diseases (<xref ref-type="bibr" rid="B34">34</xref>). Research has indicated that certain types of flavonoids exhibit antidiabetic properties in animal studies (<xref ref-type="bibr" rid="B35">35</xref>). Additionally, studies have confirmed that flavonoids exhibit pleiotropic effects in the treatment of DFU (<xref ref-type="bibr" rid="B36">36</xref>). However, the precise mechanisms by which these flavonoids enhance glycemic control and treat diabetic complications remain unclear (<xref ref-type="bibr" rid="B37">37</xref>). Que, a potent bioactive flavonoid and a key constituent of <italic>Evodia rutaecarpa</italic> (<xref ref-type="bibr" rid="B38">38</xref>), exhibits anti-inflammatory (<xref ref-type="bibr" rid="B39">39</xref>) and antidiabetic effects (<xref ref-type="bibr" rid="B40">40</xref>). Despite its recognized benefits in diabetes management, the specific impact of Que on diabetic wound healing remains underexplored, which constitutes the primary focus of this study. Notably, molecular docking revealed stable conformations of Que bound to 9 key targets, indicating that it may be the core active component of <italic>Evodia rutaecarpa</italic> for anti-DFU activity.</p>
<p>The selection of a single dose of Que (25 mg/kg/day) is based on previously published studies (<xref ref-type="bibr" rid="B23">23</xref>) that have demonstrated that this dose can sustainably produce stable antioxidant and anti-inflammatory activity in relevant animal models. Further <italic>in vivo</italic> experiments revealed that Que significantly ameliorated glucose and lipid metabolism disorders and systemic inflammatory responses in diabetic wound-affected rats. Metabolomic analysis revealed that Que significantly reversed the dysregulation of 673 metabolites in the serum of DFU rats while concurrently ameliorating insulin resistance. Notably, gut microbiota analysis demonstrated that DFU induced the proliferation of proinflammatory bacteria such as <italic>Desulfovibrionia</italic> and <italic>uncultured_rumen_bacterium</italic> (<xref ref-type="bibr" rid="B41">41</xref>, <xref ref-type="bibr" rid="B42">42</xref>), whereas Que specifically increased the abundance of anti-inflammatory bacteria, including <italic>Ligilactobacillus</italic> (<xref ref-type="bibr" rid="B43">43</xref>). The regulatory network constructed through integrated microbiota-metabolite analysis further confirmed that skin injury exacerbates systemic inflammation via negative regulation of the gut bacterium <italic>Anaerosporobacter</italic>. It is acknowledged that 16S rRNA sequencing limits the taxonomic resolution to the genus level compared to shotgun metagenomics. However, we integrated functional metabolomics to cross-validate the microbiome findings. The significant correlations observed between the differential gut taxa and specific circulating metabolites provide direct functional evidence supporting the &#x201c;gut-skin axis&#x201d; hypothesis, partially mitigating the limitations of amplicon-based sequencing. These findings indicate that Que may improve the local skin microenvironment by remodelling the homeostasis of the gut microbiota and metabolism and thereby inhibiting the systemic inflammatory cascade.</p>
<p>The intestinal barrier is a crucial component of the body&#x2019;s barrier system and plays a defensive role in maintaining microecological homeostasis. Occludin, claudins, and ZO proteins are major molecular constituents of intestinal tight junctions. The primary functions of these tight junction proteins include regulating paracellular permeability and cell polarity, selectively permitting the passage of ions and small soluble molecules, and restricting the translocation of large molecules and foreign pathogenic microorganisms (<xref ref-type="bibr" rid="B44">44</xref>). Studies have shown that diabetic patients exhibit impaired intestinal barrier function and increased intestinal permeability (<xref ref-type="bibr" rid="B45">45</xref>), which are closely linked to dysbiosis of the gut microbiota (<xref ref-type="bibr" rid="B46">46</xref>). It has been demonstrated that cocoa supplementation can upregulate ZO-1 levels and reduce the expression of proinflammatory cytokines in the colon of diabetic rats (<xref ref-type="bibr" rid="B47">47</xref>).</p>
<p>In the process of diabetic wound healing, the regulation of inflammation and the expression of growth factors are critical determinants. Among these, the overexpression of CLEC14A can reverse high glucose-induced impairments in angiogenic capacity and elevated inflammatory levels, thereby accelerating wound healing (<xref ref-type="bibr" rid="B48">48</xref>). As a natural compound, Que has significant efficacy in alleviating diabetic metabolic disorders. It reduces blood glucose levels and improves insulin sensitivity by modulating multiple factors and signalling pathways implicated in insulin resistance and the pathogenesis of type 2 diabetes, such as TNF-&#x3b1;, NF-&#x3ba;B, AMPK, AKT, and NRF2 (<xref ref-type="bibr" rid="B49">49</xref>). It also mitigates the persistence of inflammatory cells and enhances wound tissue quality. Furthermore, it accelerates wound closure by promoting fibroblast proliferation, collagen synthesis, and re-epithelialization (<xref ref-type="bibr" rid="B50">50</xref>). Additionally, Que facilitates wound healing through enhanced angiogenesis and collagen deposition (<xref ref-type="bibr" rid="B51">51</xref>). However, its clinical application is limited by low bioavailability, which has prompted ongoing research into combination strategies with nanotechnology to improve delivery and efficacy (<xref ref-type="bibr" rid="B52">52</xref>). It has been shown that FMT promotes diabetic wound healing by modulating the gut microbiota, enhancing IL-17A production to facilitate keratinocyte proliferation and migration&#x2014;a process mediated through the IL-17A&#x2013;mTOR&#x2013;HIF1&#x3b1; signalling axis (<xref ref-type="bibr" rid="B53">53</xref>). Our findings indicate that serum derived from FM group rats inhibits the viability of both RAW 264.7 cells and HUVECs, underscoring the influence of intestinal microbiota on the inflammatory wound environment. Moreover, the FMQ group rats displayed enhanced collagen deposition, increased neovascularization, and reduced inflammatory responses in wound tissues, further demonstrating that Que facilitates diabetic wound healing via regulation of the gut microbiota.</p>
</sec>
<sec id="s5" sec-type="conclusions">
<label>5</label>
<title>Conclusion</title>
<p>This study demonstrated that Que, the core active ingredient of <italic>Evodia rutaecarpa</italic>, significantly promotes diabetic wound healing by modulating inflammatory responses and enhancing angiogenesis through key targets identified via bioinformatics analysis. Furthermore, Que restored gut microbiota homeostasis and regulated serum metabolic profiles, confirming its role in ameliorating diabetic wounds via the &#x201c;gut microbiota&#x2013;inflammation&#x2013;skin axis&#x201d;. FMT and drug-containing serum experiments confirmed that Que-mediated gut microbiota remodelling contributes to reduced systemic inflammation, improved endothelial function, and accelerated wound repair. Future research will focus on identifying the specific microbial metabolites regulated by Que and elucidating their precise mechanisms in influencing downstream signaling communication between immune and reparative cells. Our findings further indicated that Chinese medicine represents a valuable resource for investigating this emerging therapeutic axis. This underscores the translational potential of targeting the &#x201c;gut&#x2013;skin axis&#x201d; in diabetic wound management and offers new mechanistic perspectives on the treatment of DFU.</p>
</sec>
</body>
<back>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are publicly available. This data can be found here: <uri xlink:href="https://figshare.com/s/2f4e2715a2ab00c48104">https://figshare.com/s/2f4e2715a2ab00c48104</uri>.</p></sec>
<sec id="s7" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The animal study was approved by the Laboratory Animal Ethics Committee of the Jiangxi Health Industry Institute of Traditional Chinese Medicine. The study was conducted in accordance with the local legislation and institutional requirements.</p></sec>
<sec id="s8" sec-type="author-contributions">
<title>Author contributions</title>
<p>ZH: Funding acquisition, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing, Conceptualization, Investigation. JL: Writing &#x2013; review &amp; editing, Formal analysis, Validation. XZ: Data curation, Methodology, Writing &#x2013; original draft. XG: Writing &#x2013; original draft, Formal analysis, Validation. JT: Writing &#x2013; original draft, Data curation, Methodology. YA: Data curation, Writing &#x2013; review &amp; editing. HL: Writing &#x2013; review &amp; editing, Project administration. DZ: Project administration, Writing &#x2013; review &amp; editing, Funding acquisition, Supervision, Writing &#x2013; original draft.</p></sec>
<sec id="s10" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p></sec>
<sec id="s11" sec-type="ai-statement">
<title>Generative AI statement</title>
<p>The author(s) declared that generative AI was not used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p></sec>
<sec id="s12" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors&#xa0;and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p></sec>
<sec id="s13" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fimmu.2026.1755280/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fimmu.2026.1755280/full#supplementary-material</ext-link></p>
<supplementary-material xlink:href="Table1.docx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/></sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Cornelis</surname> <given-names>MC</given-names></name>
<name><surname>Hu</surname> <given-names>FB</given-names></name>
</person-group>. 
<article-title>Gene-environment interactions in the development of type 2 diabetes: recent progress and continuing challenges</article-title>. <source>Annu Rev Nutr</source>. (<year>2012</year>) <volume>32</volume>:<page-range>245&#x2013;59</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1146/annurev-nutr-071811-150648</pub-id>, PMID: <pub-id pub-id-type="pmid">22540253</pub-id>
</mixed-citation>
</ref>
<ref id="B2">
<label>2</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Alexander</surname> <given-names>M</given-names></name>
<name><surname>Cho</surname> <given-names>E</given-names></name>
<name><surname>Gliozheni</surname> <given-names>E</given-names></name>
<name><surname>Salem</surname> <given-names>Y</given-names></name>
<name><surname>Cheung</surname> <given-names>J</given-names></name>
<name><surname>Ichii</surname> <given-names>H</given-names></name>
</person-group>. 
<article-title>Pathology of diabetes-induced immune dysfunction</article-title>. <source>Int J Mol Sci</source>. (<year>2024</year>) <volume>25</volume>(<issue>13</issue>):<elocation-id>7105</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms25137105</pub-id>, PMID: <pub-id pub-id-type="pmid">39000211</pub-id>
</mixed-citation>
</ref>
<ref id="B3">
<label>3</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Aldana</surname> <given-names>PC</given-names></name>
<name><surname>Cartron</surname> <given-names>AM</given-names></name>
<name><surname>Khachemoune</surname> <given-names>A</given-names></name>
</person-group>. 
<article-title>Reappraising diabetic foot ulcers: A focus on mechanisms of ulceration and clinical evaluation</article-title>. <source>Int J Low Extrem Wounds</source>. (<year>2022</year>) <volume>21</volume>:<fpage>294</fpage>&#x2013;<lpage>302</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1177/1534734620944514</pub-id>, PMID: <pub-id pub-id-type="pmid">32734837</pub-id>
</mixed-citation>
</ref>
<ref id="B4">
<label>4</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Hartmann</surname> <given-names>B</given-names></name>
<name><surname>Fottner</surname> <given-names>C</given-names></name>
<name><surname>Herrmann</surname> <given-names>K</given-names></name>
<name><surname>Limbourg</surname> <given-names>T</given-names></name>
<name><surname>Weber</surname> <given-names>MM</given-names></name>
<name><surname>Beckh</surname> <given-names>K</given-names></name>
</person-group>. 
<article-title>Interdisciplinary treatment of diabetic foot wounds in the elderly: Low risk of amputations and mortality and good chance of being mobile with good quality of life</article-title>. <source>Diabetes Vasc Dis Res</source>. (<year>2017</year>) <volume>14</volume>:<page-range>55&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1177/1479164116666477</pub-id>, PMID: <pub-id pub-id-type="pmid">27941057</pub-id>
</mixed-citation>
</ref>
<ref id="B5">
<label>5</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Needell</surname> <given-names>JC</given-names></name>
<name><surname>Zipris</surname> <given-names>D</given-names></name>
</person-group>. 
<article-title>The role of the intestinal microbiome in type 1 diabetes pathogenesis</article-title>. <source>Curr Diabetes Rep</source>. (<year>2016</year>) <volume>16</volume>:<elocation-id>89</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11892-016-0781-z</pub-id>, PMID: <pub-id pub-id-type="pmid">27523648</pub-id>
</mixed-citation>
</ref>
<ref id="B6">
<label>6</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Hara</surname> <given-names>N</given-names></name>
<name><surname>Alkanani</surname> <given-names>AK</given-names></name>
<name><surname>Ir</surname> <given-names>D</given-names></name>
<name><surname>Robertson</surname> <given-names>CE</given-names></name>
<name><surname>Wagner</surname> <given-names>BD</given-names></name>
<name><surname>Frank</surname> <given-names>DN</given-names></name>
<etal/>
</person-group>. 
<article-title>The role of the intestinal microbiota in type 1 diabetes</article-title>. <source>Clin Immunol</source>. (<year>2013</year>) <volume>146</volume>:<page-range>112&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.clim.2012.12.001</pub-id>, PMID: <pub-id pub-id-type="pmid">23314185</pub-id>
</mixed-citation>
</ref>
<ref id="B7">
<label>7</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Jimenez-Sanchez</surname> <given-names>M</given-names></name>
<name><surname>Celiberto</surname> <given-names>LS</given-names></name>
<name><surname>Yang</surname> <given-names>H</given-names></name>
<name><surname>Sham</surname> <given-names>HP</given-names></name>
<name><surname>Vallance</surname> <given-names>BA</given-names></name>
</person-group>. 
<article-title>The gut-skin axis: a bi-directional, microbiota-driven relationship with therapeutic potential</article-title>. <source>Gut Microbes</source>. (<year>2025</year>) <volume>17</volume>:<elocation-id>2473524</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/19490976.2025.2473524</pub-id>, PMID: <pub-id pub-id-type="pmid">40050613</pub-id>
</mixed-citation>
</ref>
<ref id="B8">
<label>8</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Chen</surname> <given-names>M</given-names></name>
<name><surname>Wang</surname> <given-names>R</given-names></name>
<name><surname>Wang</surname> <given-names>T</given-names></name>
</person-group>. 
<article-title>Gut microbiota and skin pathologies: Mechanism of the gut-skin axis in atopic dermatitis and psoriasis</article-title>. <source>Int Immunopharmacol</source>. (<year>2024</year>) <volume>141</volume>:<elocation-id>112658</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.intimp.2024.112658</pub-id>, PMID: <pub-id pub-id-type="pmid">39137625</pub-id>
</mixed-citation>
</ref>
<ref id="B9">
<label>9</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Dokoshi</surname> <given-names>T</given-names></name>
<name><surname>Chen</surname> <given-names>Y</given-names></name>
<name><surname>Cavagnero</surname> <given-names>KJ</given-names></name>
<name><surname>Rahman</surname> <given-names>G</given-names></name>
<name><surname>Hakim</surname> <given-names>D</given-names></name>
<name><surname>Brinton</surname> <given-names>S</given-names></name>
<etal/>
</person-group>. 
<article-title>Dermal injury drives a skin to gut axis that disrupts the intestinal microbiome and intestinal immune homeostasis in mice</article-title>. <source>Nat Commun</source>. (<year>2024</year>) <volume>15</volume>:<fpage>3009</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-024-47072-3</pub-id>, PMID: <pub-id pub-id-type="pmid">38589392</pub-id>
</mixed-citation>
</ref>
<ref id="B10">
<label>10</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Jiang</surname> <given-names>P</given-names></name>
<name><surname>Di</surname> <given-names>Z</given-names></name>
<name><surname>Huang</surname> <given-names>W</given-names></name>
<name><surname>Xie</surname> <given-names>L</given-names></name>
</person-group>. 
<article-title>Modulating the gut microbiota and metabolites with traditional Chinese medicines: an emerging therapy for type 2 diabetes mellitus and its complications</article-title>. <source>Molecules</source>. (<year>2024</year>) <volume>29</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/molecules29122747</pub-id>, PMID: <pub-id pub-id-type="pmid">38930814</pub-id>
</mixed-citation>
</ref>
<ref id="B11">
<label>11</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Liao</surname> <given-names>JF</given-names></name>
<name><surname>Chiou</surname> <given-names>WF</given-names></name>
<name><surname>Shen</surname> <given-names>YC</given-names></name>
<name><surname>Wang</surname> <given-names>GJ</given-names></name>
<name><surname>Chen</surname> <given-names>CF</given-names></name>
</person-group>. 
<article-title>Anti-inflammatory and anti-infectious effects of Evodia rutaecarpa (Wuzhuyu) and its major bioactive components</article-title>. <source>Chin Med</source>. (<year>2011</year>) <volume>6</volume>:<elocation-id>6</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1749-8546-6-6</pub-id>, PMID: <pub-id pub-id-type="pmid">21320305</pub-id>
</mixed-citation>
</ref>
<ref id="B12">
<label>12</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Luo</surname> <given-names>ZY</given-names></name>
<name><surname>Hu</surname> <given-names>YX</given-names></name>
<name><surname>Qiu</surname> <given-names>CW</given-names></name>
<name><surname>Chen</surname> <given-names>WC</given-names></name>
<name><surname>Li</surname> <given-names>L</given-names></name>
<name><surname>Chen</surname> <given-names>FL</given-names></name>
<etal/>
</person-group>. 
<article-title>Coptidis Rhizoma processed with Evodia Rutaecarpa improves the effect on ulcerative colitis by increasing intestinal energy metabolites alpha-ketoglutarate and Lactobacillus reuteri</article-title>. <source>Phytomedicine</source>. (<year>2023</year>) <volume>121</volume>:<elocation-id>155115</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.phymed.2023.155115</pub-id>, PMID: <pub-id pub-id-type="pmid">37801896</pub-id>
</mixed-citation>
</ref>
<ref id="B13">
<label>13</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Matsuda</surname> <given-names>H</given-names></name>
<name><surname>Yoshikawa</surname> <given-names>M</given-names></name>
<name><surname>Ido</surname> <given-names>Y</given-names></name>
<name><surname>Amemiya</surname> <given-names>T</given-names></name>
<name><surname>Kubo</surname> <given-names>M</given-names></name>
</person-group>. 
<article-title>Augmenting Effect of Evodiae Fructus on Antiinflammatory and Antinociceptive Activities of Indomethacin Ointment</article-title>. <source>Natural Medicines</source>. (<year>2001</year>) <volume>55</volume>(<issue>5</issue>):<page-range>235&#x2013;42</page-range>. <uri xlink:href="https://mol.medicalonline.jp/en/archive/search?jo=cg5yakso&amp;vo=55&amp;issue=5">https://mol.medicalonline.jp/en/archive/search?jo=cg5yakso&amp;vo=55&amp;issue=5</uri>
</mixed-citation>
</ref>
<ref id="B14">
<label>14</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Ru</surname> <given-names>J</given-names></name>
<name><surname>Li</surname> <given-names>P</given-names></name>
<name><surname>Wang</surname> <given-names>J</given-names></name>
<name><surname>Zhou</surname> <given-names>W</given-names></name>
<name><surname>Li</surname> <given-names>B</given-names></name>
<name><surname>Huang</surname> <given-names>C</given-names></name>
<etal/>
</person-group>. 
<article-title>TCMSP: a database of systems pharmacology for drug discovery from herbal medicines</article-title>. <source>J Cheminform</source>. (<year>2014</year>) <volume>6</volume>:<elocation-id>13</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1758-2946-6-13</pub-id>, PMID: <pub-id pub-id-type="pmid">24735618</pub-id>
</mixed-citation>
</ref>
<ref id="B15">
<label>15</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Feramisco</surname> <given-names>JD</given-names></name>
<name><surname>Sadreyev</surname> <given-names>RI</given-names></name>
<name><surname>Murray</surname> <given-names>ML</given-names></name>
<name><surname>Grishin</surname> <given-names>NV</given-names></name>
<name><surname>Tsao</surname> <given-names>H</given-names></name>
</person-group>. 
<article-title>Phenotypic and genotypic analyses of genetic skin disease through the Online Mendelian Inheritance in Man (OMIM) database</article-title>. <source>J Invest Dermatol</source>. (<year>2009</year>) <volume>129</volume>:<page-range>2628&#x2013;36</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/jid.2009.108</pub-id>, PMID: <pub-id pub-id-type="pmid">19536140</pub-id>
</mixed-citation>
</ref>
<ref id="B16">
<label>16</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Lin</surname> <given-names>Y</given-names></name>
<name><surname>Hu</surname> <given-names>Z</given-names></name>
</person-group>. 
<article-title>Bioinformatics analysis of candidate genes involved in ethanol-induced microtia pathogenesis based on a human genome database: GeneCards</article-title>. <source>Int J Pediatr Otorhinolaryngol</source>. (<year>2021</year>) <volume>142</volume>:<elocation-id>110595</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ijporl.2020.110595</pub-id>, PMID: <pub-id pub-id-type="pmid">33418206</pub-id>
</mixed-citation>
</ref>
<ref id="B17">
<label>17</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Shi</surname> <given-names>C</given-names></name>
<name><surname>Ou</surname> <given-names>X</given-names></name>
<name><surname>Huang</surname> <given-names>L</given-names></name>
<name><surname>Lei</surname> <given-names>X</given-names></name>
<name><surname>Xu</surname> <given-names>S</given-names></name>
<name><surname>Ou</surname> <given-names>M</given-names></name>
<etal/>
</person-group>. 
<article-title>Integrating GEO database, mendelian randomization, and molecular docking to identify HLA-C as a potential therapeutic target for periodontitis</article-title>. <source>Mediators Inflamm</source>. (<year>2025</year>) <volume>2025</volume>:<elocation-id>9163431</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1155/mi/9163431</pub-id>, PMID: <pub-id pub-id-type="pmid">40692979</pub-id>
</mixed-citation>
</ref>
<ref id="B18">
<label>18</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Jiang</surname> <given-names>K</given-names></name>
<name><surname>Mai</surname> <given-names>S</given-names></name>
<name><surname>Li</surname> <given-names>J</given-names></name>
<name><surname>Zhou</surname> <given-names>H</given-names></name>
<name><surname>Chen</surname> <given-names>Y</given-names></name>
<name><surname>Zou</surname> <given-names>L</given-names></name>
<etal/>
</person-group>. 
<article-title>Exploring the molecular mechanisms of lactylation-related biological functions and immune regulation in sepsis-associated acute kidney injury</article-title>. <source>Clin Exp Med</source>. (<year>2025</year>) <volume>25</volume>:<fpage>200</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10238-025-01745-5</pub-id>, PMID: <pub-id pub-id-type="pmid">40504273</pub-id>
</mixed-citation>
</ref>
<ref id="B19">
<label>19</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Mo</surname> <given-names>Q</given-names></name>
<name><surname>Mo</surname> <given-names>Q</given-names></name>
<name><surname>Mo</surname> <given-names>F</given-names></name>
</person-group>. 
<article-title>Single-cell RNA sequencing and transcriptomic analysis reveal key genes and regulatory mechanisms in sepsis</article-title>. <source>Biotechnol Genet Eng Rev</source>. (<year>2024</year>) <volume>40</volume>:<page-range>1636&#x2013;58</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/02648725.2023.2196475</pub-id>, PMID: <pub-id pub-id-type="pmid">37017187</pub-id>
</mixed-citation>
</ref>
<ref id="B20">
<label>20</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Li</surname> <given-names>K</given-names></name>
<name><surname>Wu</surname> <given-names>L</given-names></name>
<name><surname>Jiang</surname> <given-names>J</given-names></name>
</person-group>. 
<article-title>Apigenin accelerates wound healing in diabetic mice by promoting macrophage M2-type polarization via increasing miR-21 expression</article-title>. <source>Mol Cell Biochem</source>. (<year>2024</year>) <volume>479</volume>:<page-range>3119&#x2013;27</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11010-023-04885-y</pub-id>, PMID: <pub-id pub-id-type="pmid">38261238</pub-id>
</mixed-citation>
</ref>
<ref id="B21">
<label>21</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Huang</surname> <given-names>Z</given-names></name>
<name><surname>Liu</surname> <given-names>J</given-names></name>
<name><surname>Li</surname> <given-names>H</given-names></name>
<name><surname>Ai</surname> <given-names>Y</given-names></name>
<name><surname>Zhou</surname> <given-names>D</given-names></name>
</person-group>. 
<article-title>Network pharmacology-based prediction and &#x201c;gut microbiota-inflammation-brain axis&#x201d; validation of the active ingredients and potential mechanisms of Plantagins Herba for treating diabetes-related cognitive dysfunction</article-title>. <source>Front Pharmacol</source>. (<year>2025</year>) <volume>16</volume>:<elocation-id>1601689</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fphar.2025.1601689</pub-id>, PMID: <pub-id pub-id-type="pmid">40626305</pub-id>
</mixed-citation>
</ref>
<ref id="B22">
<label>22</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Jung</surname> <given-names>JS</given-names></name>
<name><surname>Jo</surname> <given-names>HY</given-names></name>
<name><surname>Hwang</surname> <given-names>J</given-names></name>
<name><surname>Kim</surname> <given-names>D</given-names></name>
<name><surname>Kwon</surname> <given-names>M</given-names></name>
<name><surname>Yong</surname> <given-names>J</given-names></name>
<etal/>
</person-group>. 
<article-title>Efficacy of subconjunctivally applied everolimus- and sirolimus-pretreated MSCs in preventing diabetic retinopathy</article-title>. <source>Transl Vis Sci Technol</source>. (<year>2025</year>) <volume>14</volume>:<elocation-id>19</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1167/tvst.14.9.19</pub-id>, PMID: <pub-id pub-id-type="pmid">40952054</pub-id>
</mixed-citation>
</ref>
<ref id="B23">
<label>23</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Maciel</surname> <given-names>RM</given-names></name>
<name><surname>Costa</surname> <given-names>MM</given-names></name>
<name><surname>Martins</surname> <given-names>DB</given-names></name>
<name><surname>Fran&#xe7;a</surname> <given-names>RT</given-names></name>
<name><surname>Schmatz</surname> <given-names>R</given-names></name>
<name><surname>Gra&#xe7;a</surname> <given-names>DL</given-names></name>
<etal/>
</person-group>. 
<article-title>Antioxidant and anti-inflammatory effects of quercetin in functional and morphological alterations in streptozotocin-induced diabetic rats</article-title>. <source>Res Vet Sci</source>. (<year>2013</year>) <volume>95</volume>:<page-range>389&#x2013;97</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.rvsc.2013.04.028</pub-id>, PMID: <pub-id pub-id-type="pmid">23706762</pub-id>
</mixed-citation>
</ref>
<ref id="B24">
<label>24</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Zhang</surname> <given-names>P</given-names></name>
<name><surname>Wei</surname> <given-names>W</given-names></name>
<name><surname>Zhang</surname> <given-names>X</given-names></name>
<name><surname>Wen</surname> <given-names>C</given-names></name>
<name><surname>Ovatlarnporn</surname> <given-names>C</given-names></name>
<name><surname>Olatunji</surname> <given-names>OJ</given-names></name>
</person-group>. 
<article-title>Antidiabetic and antioxidant activities of Mitragyna speciosa (kratom) leaf extract in type 2 diabetic rats</article-title>. <source>BioMed Pharmacother</source>. (<year>2023</year>) <volume>162</volume>:<elocation-id>114689</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.biopha.2023.114689</pub-id>, PMID: <pub-id pub-id-type="pmid">37058820</pub-id>
</mixed-citation>
</ref>
<ref id="B25">
<label>25</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Siqueira</surname> <given-names>BS</given-names></name>
<name><surname>D&#xed;az Urrutia</surname> <given-names>MA</given-names></name>
<name><surname>Ceglarek</surname> <given-names>VM</given-names></name>
<name><surname>Moreira</surname> <given-names>DC</given-names></name>
<name><surname>Brasil Kuzniewski</surname> <given-names>FT</given-names></name>
<name><surname>Roberto de Souza de Almeida Leite</surname> <given-names>J</given-names></name>
<etal/>
</person-group>. 
<article-title>A novel bombesin-related peptide modulates glucose tolerance and insulin secretion in non-obese and hypothalamic-obese rats</article-title>. <source>Toxicon</source>. (<year>2025</year>) <volume>255</volume>:<elocation-id>108230</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.toxicon.2025.108230</pub-id>, PMID: <pub-id pub-id-type="pmid">39788326</pub-id>
</mixed-citation>
</ref>
<ref id="B26">
<label>26</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Pang</surname> <given-names>J</given-names></name>
<name><surname>Maienschein-Cline</surname> <given-names>M</given-names></name>
<name><surname>Koh</surname> <given-names>TJ</given-names></name>
</person-group>. 
<article-title>Enhanced proliferation of Ly6C(+) monocytes/macrophages contributes to chronic inflammation in skin wounds of diabetic mice</article-title>. <source>J Immunol</source>. (<year>2021</year>) <volume>206</volume>:<page-range>621&#x2013;30</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.4049/jimmunol.2000935</pub-id>, PMID: <pub-id pub-id-type="pmid">33443065</pub-id>
</mixed-citation>
</ref>
<ref id="B27">
<label>27</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Chen</surname> <given-names>Q</given-names></name>
<name><surname>Mushtaq</surname> <given-names>W</given-names></name>
<name><surname>Wang</surname> <given-names>X</given-names></name>
<name><surname>Liao</surname> <given-names>Z</given-names></name>
<name><surname>Li</surname> <given-names>J</given-names></name>
<name><surname>Xiao</surname> <given-names>S</given-names></name>
<etal/>
</person-group>. 
<article-title>Crop rotation alleviates continuous cropping obstacles in Chrysanthemum morifolium production by regulating rhizosphere soil microbial communities and metabolites</article-title>. <source>Environ Microbiome</source>. (<year>2025</year>) <volume>20</volume>:<fpage>90</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s40793-025-00754-x</pub-id>, PMID: <pub-id pub-id-type="pmid">40676696</pub-id>
</mixed-citation>
</ref>
<ref id="B28">
<label>28</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Chen</surname> <given-names>M</given-names></name>
<name><surname>Wang</surname> <given-names>Z</given-names></name>
<name><surname>He</surname> <given-names>H</given-names></name>
<name><surname>He</surname> <given-names>W</given-names></name>
<name><surname>Zhang</surname> <given-names>Z</given-names></name>
<name><surname>Sun</surname> <given-names>S</given-names></name>
<etal/>
</person-group>. 
<article-title>Multi-Omics Analysis Reveals the Regulatory Mechanism of Different Probiotics on Growth Performance and Intestinal Health of Salmo trutta (S. trutta)</article-title>. <source>Microorganisms</source>. (<year>2024</year>) <volume>12</volume>(<issue>7</issue>):<elocation-id>1410</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/microorganisms12071410</pub-id>, PMID: <pub-id pub-id-type="pmid">39065178</pub-id>
</mixed-citation>
</ref>
<ref id="B29">
<label>29</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Chen</surname> <given-names>R</given-names></name>
<name><surname>Xu</surname> <given-names>Y</given-names></name>
<name><surname>Wu</surname> <given-names>P</given-names></name>
<name><surname>Zhou</surname> <given-names>H</given-names></name>
<name><surname>Lasanajak</surname> <given-names>Y</given-names></name>
<name><surname>Fang</surname> <given-names>Y</given-names></name>
<etal/>
</person-group>. 
<article-title>Transplantation of fecal microbiota rich in short chain fatty acids and butyric acid treat cerebral ischemic stroke by regulating gut microbiota</article-title>. <source>Pharmacol Res</source>. (<year>2019</year>) <volume>148</volume>:<elocation-id>104403</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.phrs.2019.104403</pub-id>, PMID: <pub-id pub-id-type="pmid">31425750</pub-id>
</mixed-citation>
</ref>
<ref id="B30">
<label>30</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Liu</surname> <given-names>J</given-names></name>
<name><surname>Liu</surname> <given-names>J</given-names></name>
<name><surname>Tong</surname> <given-names>X</given-names></name>
<name><surname>Peng</surname> <given-names>W</given-names></name>
<name><surname>Wei</surname> <given-names>S</given-names></name>
<name><surname>Sun</surname> <given-names>T</given-names></name>
<etal/>
</person-group>. 
<article-title>Network pharmacology prediction and molecular docking-based strategy to discover the potential pharmacological mechanism of Huai Hua San against ulcerative colitis</article-title>. <source>Drug Des Devel Ther</source>. (<year>2021</year>) <volume>15</volume>:<page-range>3255&#x2013;76</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.2147/dddt.S319786</pub-id>, PMID: <pub-id pub-id-type="pmid">34349502</pub-id>
</mixed-citation>
</ref>
<ref id="B31">
<label>31</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Clayton</surname> <given-names>SM</given-names></name>
<name><surname>Shafikhani</surname> <given-names>SH</given-names></name>
<name><surname>Soulika</surname> <given-names>AM</given-names></name>
</person-group>. 
<article-title>Macrophage and neutrophil dysfunction in diabetic wounds</article-title>. <source>Adv Wound Care (New Rochelle)</source>. (<year>2024</year>) <volume>13</volume>:<page-range>463&#x2013;84</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1089/wound.2023.0149</pub-id>, PMID: <pub-id pub-id-type="pmid">38695109</pub-id>
</mixed-citation>
</ref>
<ref id="B32">
<label>32</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Huang</surname> <given-names>F</given-names></name>
<name><surname>Lu</surname> <given-names>X</given-names></name>
<name><surname>Yang</surname> <given-names>Y</given-names></name>
<name><surname>Yang</surname> <given-names>Y</given-names></name>
<name><surname>Li</surname> <given-names>Y</given-names></name>
<name><surname>Kuai</surname> <given-names>L</given-names></name>
<etal/>
</person-group>. 
<article-title>Microenvironment-based diabetic foot ulcer nanomedicine</article-title>. <source>Adv Sci (Weinh)</source>. (<year>2023</year>) <volume>10</volume>:<elocation-id>e2203308</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/advs.202203308</pub-id>, PMID: <pub-id pub-id-type="pmid">36424137</pub-id>
</mixed-citation>
</ref>
<ref id="B33">
<label>33</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Xiao</surname> <given-names>S</given-names></name>
<name><surname>Zhang</surname> <given-names>D</given-names></name>
<name><surname>Liu</surname> <given-names>Z</given-names></name>
<name><surname>Jin</surname> <given-names>W</given-names></name>
<name><surname>Huang</surname> <given-names>G</given-names></name>
<name><surname>Wei</surname> <given-names>Z</given-names></name>
<etal/>
</person-group>. 
<article-title>Diabetes-induced glucolipotoxicity impairs wound healing ability of adipose-derived stem cells-through the miR-1248/CITED2/HIF-1&#x3b1; pathway</article-title>. <source>Aging (Albany NY)</source>. (<year>2020</year>) <volume>12</volume>:<page-range>6947&#x2013;65</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.18632/aging.103053</pub-id>, PMID: <pub-id pub-id-type="pmid">32294623</pub-id>
</mixed-citation>
</ref>
<ref id="B34">
<label>34</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Liu</surname> <given-names>FS</given-names></name>
<name><surname>Li</surname> <given-names>Y</given-names></name>
<name><surname>Guo</surname> <given-names>XS</given-names></name>
<name><surname>Liu</surname> <given-names>RC</given-names></name>
<name><surname>Zhang</surname> <given-names>HY</given-names></name>
<name><surname>Li</surname> <given-names>Z</given-names></name>
</person-group>. 
<article-title>Advances in traditional Chinese medicine as adjuvant therapy for diabetic foot</article-title>. <source>World J Diabetes</source>. (<year>2022</year>) <volume>13</volume>:<page-range>851&#x2013;60</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.4239/wjd.v13.i10.851</pub-id>, PMID: <pub-id pub-id-type="pmid">36312004</pub-id>
</mixed-citation>
</ref>
<ref id="B35">
<label>35</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Tong</surname> <given-names>XL</given-names></name>
<name><surname>Dong</surname> <given-names>L</given-names></name>
<name><surname>Chen</surname> <given-names>L</given-names></name>
<name><surname>Zhen</surname> <given-names>Z</given-names></name>
</person-group>. 
<article-title>Treatment of diabetes using traditional Chinese medicine: past, present and future</article-title>. <source>Am J Chin Med</source>. (<year>2012</year>) <volume>40</volume>:<page-range>877&#x2013;86</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1142/s0192415x12500656</pub-id>, PMID: <pub-id pub-id-type="pmid">22928822</pub-id>
</mixed-citation>
</ref>
<ref id="B36">
<label>36</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Miraj</surname> <given-names>SS</given-names></name>
<name><surname>Kurian</surname> <given-names>SJ</given-names></name>
<name><surname>Rodrigues</surname> <given-names>GS</given-names></name>
<name><surname>Saravu</surname> <given-names>K</given-names></name>
<name><surname>Rao</surname> <given-names>M</given-names></name>
<name><surname>Raychaudhuri</surname> <given-names>SP</given-names></name>
<etal/>
</person-group>. 
<article-title>Phytotherapy in diabetic foot ulcers: A promising strategy for effective wound healing</article-title>. <source>J Am Nutr Assoc</source>. (<year>2023</year>) <volume>42</volume>:<fpage>295</fpage>&#x2013;<lpage>310</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/07315724.2022.2034069</pub-id>, PMID: <pub-id pub-id-type="pmid">35512780</pub-id>
</mixed-citation>
</ref>
<ref id="B37">
<label>37</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Xu</surname> <given-names>N</given-names></name>
<name><surname>Zhang</surname> <given-names>L</given-names></name>
<name><surname>Dong</surname> <given-names>J</given-names></name>
<name><surname>Zhang</surname> <given-names>X</given-names></name>
<name><surname>Chen</surname> <given-names>YG</given-names></name>
<name><surname>Bao</surname> <given-names>B</given-names></name>
<etal/>
</person-group>. 
<article-title>Low-dose diet supplement of a natural flavonoid, luteolin, ameliorates diet-induced obesity and insulin resistance in mice</article-title>. <source>Mol Nutr Food Res</source>. (<year>2014</year>) <volume>58</volume>:<page-range>1258&#x2013;68</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/mnfr.201300830</pub-id>, PMID: <pub-id pub-id-type="pmid">24668788</pub-id>
</mixed-citation>
</ref>
<ref id="B38">
<label>38</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Dabeek</surname> <given-names>WM</given-names></name>
<name><surname>Marra</surname> <given-names>MV</given-names></name>
</person-group>. 
<article-title>Dietary quercetin and kaempferol: bioavailability and potential cardiovascular-related bioactivity in humans</article-title>. <source>Nutrients</source>. (<year>2019</year>) <volume>11</volume>(<issue>10</issue>):<elocation-id>2288</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/nu11102288</pub-id>, PMID: <pub-id pub-id-type="pmid">31557798</pub-id>
</mixed-citation>
</ref>
<ref id="B39">
<label>39</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Xie</surname> <given-names>R</given-names></name>
<name><surname>Xu</surname> <given-names>T</given-names></name>
<name><surname>Yin</surname> <given-names>Y</given-names></name>
<name><surname>Liu</surname> <given-names>M</given-names></name>
<name><surname>Huang</surname> <given-names>C</given-names></name>
<name><surname>Zhang</surname> <given-names>W</given-names></name>
<etal/>
</person-group>. 
<article-title>Quercetin attenuates DEHP-induced pyroptosis and programmed necrosis in chicken duodenum through regulation of the TLR4/MyD88/NF-&#x3ba;B pathway</article-title>. <source>Environ pollut</source>. (<year>2025</year>) <volume>372</volume>:<elocation-id>126016</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.envpol.2025.126016</pub-id>, PMID: <pub-id pub-id-type="pmid">40057166</pub-id>
</mixed-citation>
</ref>
<ref id="B40">
<label>40</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Farhadi</surname> <given-names>F</given-names></name>
<name><surname>Sharififar</surname> <given-names>F</given-names></name>
<name><surname>Jafari</surname> <given-names>M</given-names></name>
<name><surname>Rahimi</surname> <given-names>VB</given-names></name>
<name><surname>Askari</surname> <given-names>N</given-names></name>
<name><surname>Askari</surname> <given-names>VR</given-names></name>
</person-group>. 
<article-title>Hallmarks of quercetin benefits as a functional supplementary in the management of diabetes mellitus-related maladies: from basic to clinical applications</article-title>. <source>Curr Drug Metab</source>. (<year>2025</year>) <volume>25</volume>(<issue>9</issue>):<page-range>653&#x2013;69</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.2174/0113892002339410250108031621</pub-id>, PMID: <pub-id pub-id-type="pmid">39878112</pub-id>
</mixed-citation>
</ref>
<ref id="B41">
<label>41</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Cunha</surname> <given-names>MI</given-names></name>
<name><surname>Su</surname> <given-names>M</given-names></name>
<name><surname>Cantuti-Castelvetri</surname> <given-names>L</given-names></name>
<name><surname>M&#xfc;ller</surname> <given-names>SA</given-names></name>
<name><surname>Schifferer</surname> <given-names>M</given-names></name>
<name><surname>Djannatian</surname> <given-names>M</given-names></name>
<etal/>
</person-group>. 
<article-title>Pro-inflammatory activation following demyelination is required for myelin clearance and oligodendrogenesis</article-title>. <source>J Exp Med</source>. (<year>2020</year>) <volume>217</volume>(<issue>5</issue>):<elocation-id>e20191390</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1084/jem.20191390</pub-id>, PMID: <pub-id pub-id-type="pmid">32078678</pub-id>
</mixed-citation>
</ref>
<ref id="B42">
<label>42</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Zhong</surname> <given-names>Y</given-names></name>
<name><surname>Xue</surname> <given-names>MY</given-names></name>
<name><surname>Sun</surname> <given-names>HZ</given-names></name>
<name><surname>Valencak</surname> <given-names>TG</given-names></name>
<name><surname>Guan</surname> <given-names>LL</given-names></name>
<name><surname>Liu</surname> <given-names>J</given-names></name>
</person-group>. 
<article-title>Rumen and hindgut bacteria are potential indicators for mastitis of mid-lactating Holstein dairy cows</article-title>. <source>Microorganisms</source>. (<year>2020</year>) <volume>8</volume>(<issue>12</issue>):<elocation-id>2042</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/microorganisms8122042</pub-id>, PMID: <pub-id pub-id-type="pmid">33419337</pub-id>
</mixed-citation>
</ref>
<ref id="B43">
<label>43</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Rieu</surname> <given-names>A</given-names></name>
<name><surname>Aoudia</surname> <given-names>N</given-names></name>
<name><surname>Jego</surname> <given-names>G</given-names></name>
<name><surname>Chluba</surname> <given-names>J</given-names></name>
<name><surname>Yousfi</surname> <given-names>N</given-names></name>
<name><surname>Briandet</surname> <given-names>R</given-names></name>
<etal/>
</person-group>. 
<article-title>The biofilm mode of life boosts the anti-inflammatory properties of Lactobacillus</article-title>. <source>Cell Microbiol</source>. (<year>2014</year>) <volume>16</volume>:<page-range>1836&#x2013;53</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/cmi.12331</pub-id>, PMID: <pub-id pub-id-type="pmid">25052472</pub-id>
</mixed-citation>
</ref>
<ref id="B44">
<label>44</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Stewart</surname> <given-names>AS</given-names></name>
<name><surname>Pratt-Phillips</surname> <given-names>S</given-names></name>
<name><surname>Gonzalez</surname> <given-names>LM</given-names></name>
</person-group>. 
<article-title>Alterations in intestinal permeability: the role of the &#x201c;Leaky gut&#x201d; in health and disease</article-title>. <source>J Equine Vet Sci</source>. (<year>2017</year>) <volume>52</volume>:<fpage>10</fpage>&#x2013;<lpage>22</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jevs.2017.02.009</pub-id>, PMID: <pub-id pub-id-type="pmid">31000910</pub-id>
</mixed-citation>
</ref>
<ref id="B45">
<label>45</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Zhao</surname> <given-names>L</given-names></name>
<name><surname>Lou</surname> <given-names>H</given-names></name>
<name><surname>Peng</surname> <given-names>Y</given-names></name>
<name><surname>Chen</surname> <given-names>S</given-names></name>
<name><surname>Fan</surname> <given-names>L</given-names></name>
<name><surname>Li</surname> <given-names>X</given-names></name>
</person-group>. 
<article-title>Elevated levels of circulating short-chain fatty acids and bile acids in type 2 diabetes are linked to gut barrier disruption and disordered gut microbiota</article-title>. <source>Diabetes Res Clin Pract</source>. (<year>2020</year>) <volume>169</volume>:<elocation-id>108418</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.diabres.2020.108418</pub-id>, PMID: <pub-id pub-id-type="pmid">32891692</pub-id>
</mixed-citation>
</ref>
<ref id="B46">
<label>46</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Zhou</surname> <given-names>W</given-names></name>
<name><surname>Yang</surname> <given-names>T</given-names></name>
<name><surname>Xu</surname> <given-names>W</given-names></name>
<name><surname>Huang</surname> <given-names>Y</given-names></name>
<name><surname>Ran</surname> <given-names>L</given-names></name>
<name><surname>Yan</surname> <given-names>Y</given-names></name>
<etal/>
</person-group>. 
<article-title>The polysaccharides from the fruits of Lycium barbarum L. confer anti-diabetic effect by regulating gut microbiota and intestinal barrier</article-title>. <source>Carbohydr Polym</source>. (<year>2022</year>) <volume>291</volume>:<elocation-id>119626</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.carbpol.2022.119626</pub-id>, PMID: <pub-id pub-id-type="pmid">35698418</pub-id>
</mixed-citation>
</ref>
<ref id="B47">
<label>47</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>&#xc1;lvarez-Cilleros</surname> <given-names>D</given-names></name>
<name><surname>Ramos</surname> <given-names>S</given-names></name>
<name><surname>L&#xf3;pez-Oliva</surname> <given-names>ME</given-names></name>
<name><surname>Escriv&#xe1;</surname> <given-names>F</given-names></name>
<name><surname>&#xc1;lvarez</surname> <given-names>C</given-names></name>
<name><surname>Fern&#xe1;ndez-Mill&#xe1;n</surname> <given-names>E</given-names></name>
<etal/>
</person-group>. 
<article-title>Cocoa diet modulates gut microbiota composition and improves intestinal health in Zucker diabetic rats</article-title>. <source>Food Res Int</source>. (<year>2020</year>) <volume>132</volume>:<elocation-id>109058</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.foodres.2020.109058</pub-id>, PMID: <pub-id pub-id-type="pmid">32331673</pub-id>
</mixed-citation>
</ref>
<ref id="B48">
<label>48</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Liao</surname> <given-names>Y</given-names></name>
<name><surname>Wu</surname> <given-names>N</given-names></name>
<name><surname>Guo</surname> <given-names>L</given-names></name>
<name><surname>Yang</surname> <given-names>D</given-names></name>
</person-group>. 
<article-title>CLEC14A facilitates angiogenesis and alleviates inflammation in diabetic wound healing</article-title>. <source>Life Sci</source>. (<year>2024</year>) <volume>358</volume>:<elocation-id>123176</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.lfs.2024.123176</pub-id>, PMID: <pub-id pub-id-type="pmid">39454994</pub-id>
</mixed-citation>
</ref>
<ref id="B49">
<label>49</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Yan</surname> <given-names>L</given-names></name>
<name><surname>Vaghari-Tabari</surname> <given-names>M</given-names></name>
<name><surname>Malakoti</surname> <given-names>F</given-names></name>
<name><surname>Moein</surname> <given-names>S</given-names></name>
<name><surname>Qujeq</surname> <given-names>D</given-names></name>
<name><surname>Yousefi</surname> <given-names>B</given-names></name>
<etal/>
</person-group>. 
<article-title>Quercetin: an effective polyphenol in alleviating diabetes and diabetic complications</article-title>. <source>Crit Rev Food Sci Nutr</source>. (<year>2023</year>) <volume>63</volume>:<page-range>9163&#x2013;86</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/10408398.2022.2067825</pub-id>, PMID: <pub-id pub-id-type="pmid">35468007</pub-id>
</mixed-citation>
</ref>
<ref id="B50">
<label>50</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Kant</surname> <given-names>V</given-names></name>
<name><surname>Jangir</surname> <given-names>BL</given-names></name>
<name><surname>Sharma</surname> <given-names>M</given-names></name>
<name><surname>Kumar</surname> <given-names>V</given-names></name>
<name><surname>Joshi</surname> <given-names>VG</given-names></name>
</person-group>. 
<article-title>Topical application of quercetin improves wound repair and regeneration in diabetic rats</article-title>. <source>Immunopharmacol Immunotoxicol</source>. (<year>2021</year>) <volume>43</volume>:<page-range>536&#x2013;53</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/08923973.2021.1950758</pub-id>, PMID: <pub-id pub-id-type="pmid">34278923</pub-id>
</mixed-citation>
</ref>
<ref id="B51">
<label>51</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Wang</surname> <given-names>C</given-names></name>
<name><surname>Chen</surname> <given-names>H</given-names></name>
<name><surname>Wang</surname> <given-names>W</given-names></name>
<name><surname>Yan</surname> <given-names>G</given-names></name>
<name><surname>Zheng</surname> <given-names>S</given-names></name>
<name><surname>Wang</surname> <given-names>C</given-names></name>
<etal/>
</person-group>. 
<article-title>Facile strategy for gelatin-based hydrogel with multifunctionalities to remodel wound microenvironment and accelerate healing of acute and diabetic wounds</article-title>. <source>Int J Biol Macromol</source>. (<year>2024</year>) <volume>256</volume>:<elocation-id>128372</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ijbiomac.2023.128372</pub-id>, PMID: <pub-id pub-id-type="pmid">38000588</pub-id>
</mixed-citation>
</ref>
<ref id="B52">
<label>52</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Panthi</surname> <given-names>VK</given-names></name>
<name><surname>Imran</surname> <given-names>M</given-names></name>
<name><surname>Chaudhary</surname> <given-names>A</given-names></name>
<name><surname>Paudel</surname> <given-names>KR</given-names></name>
<name><surname>Mohammed</surname> <given-names>Y</given-names></name>
</person-group>. 
<article-title>The significance of quercetin-loaded advanced nanoformulations for the management of diabetic wounds</article-title>. <source>Nanomedicine (Lond)</source>. (<year>2023</year>) <volume>18</volume>:<fpage>391</fpage>&#x2013;<lpage>411</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.2217/nnm-2022-0281</pub-id>, PMID: <pub-id pub-id-type="pmid">37140389</pub-id>
</mixed-citation>
</ref>
<ref id="B53">
<label>53</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Peng</surname> <given-names>C</given-names></name>
<name><surname>Lei</surname> <given-names>P</given-names></name>
<name><surname>Qi</surname> <given-names>H</given-names></name>
<name><surname>Zhu</surname> <given-names>Q</given-names></name>
<name><surname>Huang</surname> <given-names>C</given-names></name>
<name><surname>Fu</surname> <given-names>J</given-names></name>
<etal/>
</person-group>. 
<article-title>Effect of fecal microbiota transplantation on diabetic wound healing through the IL-17A-mTOR-HIF1&#x3b1; signaling axis</article-title>. <source>Appl Environ Microbiol</source>. (<year>2025</year>) <volume>91</volume>:<elocation-id>e0201924</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/aem.02019-24</pub-id>, PMID: <pub-id pub-id-type="pmid">40019272</pub-id>
</mixed-citation>
</ref>
</ref-list><glossary>
<title>Glossary</title><def-list><def-item><term>CD31</term><def>
<p>cluster of differentiation 31</p></def></def-item><def-item><term>DCFH-DA</term><def>
<p>2&#x2019;,7&#x2019;-dichlorodihydrofluorescein diacetate</p></def></def-item><def-item><term>DFU</term><def>
<p>diabetic foot ulcer</p></def></def-item><def-item><term>DMSO</term><def>
<p>dimethyl sulfoxide</p></def></def-item><def-item><term>FBS</term><def>
<p>fetal bovine serum</p></def></def-item><def-item><term>FC</term><def>
<p>fold change</p></def></def-item><def-item><term>FM</term><def>
<p>faux aseptic model</p></def></def-item><def-item><term>FMQ</term><def>
<p>faux aseptic fecal microbiota transplantation quercetin</p></def></def-item><def-item><term>FMT</term><def>
<p>fecal microbiota transplantation</p></def></def-item><def-item><term>FQ</term><def>
<p>faux aseptic quercetin</p></def></def-item><def-item><term>FS</term><def>
<p>faux aseptic sham</p></def></def-item><def-item><term>GSEA</term><def>
<p>gene set enrichment analysis</p></def></def-item><def-item><term>HIF1&#x3b1;</term><def>
<p>hypoxia inducible factor-1 &#x3b1;</p></def></def-item><def-item><term>HUVECs</term><def>
<p>human umbilical vein endothelial cells</p></def></def-item><def-item><term>IL-1&#x3b2;</term><def>
<p>interleukin-1&#x3b2;</p></def></def-item><def-item><term>IL-6</term><def>
<p>interleukin-6</p></def></def-item><def-item><term>IL-10</term><def>
<p>interleukin-10</p></def></def-item><def-item><term>INS</term><def>
<p>insulin</p></def></def-item><def-item><term>KEGG</term><def>
<p>Kyoto Encyclopedia of Genes and Genomes</p></def></def-item><def-item><term>LDL-C</term><def>
<p>low-density lipoprotein cholesterol</p></def></def-item><def-item><term>LC&#x2013;MS</term><def>
<p>liquid chromatography&#x2013;mass spectrometry</p></def></def-item><def-item><term>MTT</term><def>
<p>3-(4,5)-dimethylthiahiazo(-z-y1)-2,5-diphenytetrazoliumromide</p></def></def-item><def-item><term>OPLS-DA</term><def>
<p>orthogonal partial least squares-discriminant analysis</p></def></def-item><def-item><term>PBS</term><def>
<p>phosphate buffer solution</p></def></def-item><def-item><term>PCA</term><def>
<p>principal component analysis</p></def></def-item><def-item><term>Que</term><def>
<p>quercetin</p></def></def-item><def-item><term>RT&#x2013;qPCR</term><def>
<p>real-time quantitative polymerase chain reaction</p></def></def-item><def-item><term>T-CHO</term><def>
<p>total cholesterol</p></def></def-item><def-item><term>TCM</term><def>
<p>traditional Chinese medicine</p></def></def-item><def-item><term>TG</term><def>
<p>triglyceride</p></def></def-item><def-item><term>TNF-&#x3b1;</term><def>
<p>tumor necrosis factor &#x3b1;</p></def></def-item><def-item><term>VEGF</term><def>
<p>vascular endothelial growth factor</p></def></def-item><def-item><term>VIP</term><def>
<p>variable importance in projection</p></def></def-item></def-list></glossary>
<fn-group>
<fn id="n1" fn-type="custom" custom-type="edited-by">
<p>Edited by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1671913">Feng Zhu</ext-link>, Tongji University, China</p></fn>
<fn id="n2" fn-type="custom" custom-type="reviewed-by">
<p>Reviewed by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1851282">Jun-Lin Yin</ext-link>, Yunnan Minzu University, China</p>
<p><ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/3161439">Yuting Lu</ext-link>, Guangxi University of Technology, China</p></fn>
</fn-group>
</back>
</article>