<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.3 20210610//EN" "JATS-journalpublishing1-3-mathml3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="1.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title-group>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
</journal-title-group>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2026.1624883</article-id>
<article-version article-version-type="Version of Record" vocab="NISO-RP-8-2008"/>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Original Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Integration of single-cell sequencing, transcriptome sequencing, and machine learning for constructing and validating histone acetylation-related prognostic risk models in hepatocellular carcinoma</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name><surname>Qi</surname><given-names>Yajie</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/3129320/overview"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="software" vocab-term-identifier="https://credit.niso.org/contributor-roles/software/">Software</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Wang</surname><given-names>Fulin</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Ren</surname><given-names>Wenchao</given-names></name>
<xref ref-type="aff" rid="aff3"><sup>3</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Cai</surname><given-names>Chuanxu</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization/">Visualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Zhou</surname><given-names>Yichen</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Zhu</surname><given-names>Pengpeng</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/2879083/overview"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
</contrib>
<contrib contrib-type="author" corresp="yes" equal-contrib="yes">
<name><surname>He</surname><given-names>Puyi</given-names></name>
<xref ref-type="aff" rid="aff4"><sup>4</sup></xref>
<xref ref-type="corresp" rid="c001"><sup>*</sup></xref>
<xref ref-type="author-notes" rid="fn003"><sup>&#x2020;</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project-administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration/">Project administration</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
<contrib contrib-type="author" corresp="yes" equal-contrib="yes">
<name><surname>Wang</surname><given-names>Qian</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="corresp" rid="c001"><sup>*</sup></xref>
<xref ref-type="author-notes" rid="fn003"><sup>&#x2020;</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/3059389/overview"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/conceptualization/">Conceptualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition/">Funding acquisition</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
</contrib-group>
<aff id="aff1"><label>1</label><institution>National and Local Joint Engineering Research Center of Biodiagnosis and Biotherapy, The Second Affiliated Hospital of Xi&#x2019;an Jiaotong University</institution>, <city>Xi&#x2019;an</city>,&#xa0;<country country="cn">China</country></aff>
<aff id="aff2"><label>2</label><institution>Tumor and Immunology Center of Precision Medicine Institute, Xi&#x2019;an Jiaotong University</institution>, <city>Xi&#x2019;an</city>,&#xa0;<country country="cn">China</country></aff>
<aff id="aff3"><label>3</label><institution>General Surgery, The Second Affiliated Hospital of Dalian Medical University</institution>, <city>Dalian</city>,&#xa0;<country country="cn">China</country></aff>
<aff id="aff4"><label>4</label><institution>General Surgery, The Second Hospital of Lanzhou University</institution>, <city>Lanzhou</city>,&#xa0;<country country="cn">China</country></aff>
<author-notes>
<corresp id="c001"><label>*</label>Correspondence: Qian Wang, <email xlink:href="mailto:wangqian9797@xjtu.edu.cn">wangqian9797@xjtu.edu.cn</email>; Puyi He, <email xlink:href="mailto:hepy2023@lzu.edu.cn">hepy2023@lzu.edu.cn</email></corresp>
<fn fn-type="equal" id="fn003">
<label>&#x2020;</label>
<p>These authors have contributed equally to this work</p></fn>
</author-notes>
<pub-date publication-format="electronic" date-type="pub" iso-8601-date="2026-01-23">
<day>23</day>
<month>01</month>
<year>2026</year>
</pub-date>
<pub-date publication-format="electronic" date-type="collection">
<year>2026</year>
</pub-date>
<volume>17</volume>
<elocation-id>1624883</elocation-id>
<history>
<date date-type="received">
<day>08</day>
<month>05</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>06</day>
<month>01</month>
<year>2026</year>
</date>
<date date-type="rev-recd">
<day>28</day>
<month>12</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2026 Qi, Wang, Ren, Cai, Zhou, Zhu, He and Wang.</copyright-statement>
<copyright-year>2026</copyright-year>
<copyright-holder>Qi, Wang, Ren, Cai, Zhou, Zhu, He and Wang</copyright-holder>
<license>
<ali:license_ref start_date="2026-01-23">https://creativecommons.org/licenses/by/4.0/</ali:license_ref>
<license-p>This is an open-access article distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License (CC BY)</ext-link>. The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</license-p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>Liver hepatocellular carcinoma (LIHC), a prevalent gastrointestinal malignancy, continues to demonstrate poor prognosis despite therapeutic advances improving clinical outcomes. Histone acetylation, a key epigenetic modification, regulates critical processes including chromatin remodeling, gene expression and drives tumor progression in multiple cancers (e.g., lung, gastric) yet its systemic role in LIHC remains unclear.</p>
</sec>
<sec>
<title>Methods</title>
<p>This study integrated LIHC single-cell/RNA-seq data and histone acetylation-related gene sets to construct a LIHC risk prediction model based on histone acetylation-related genes using 101 machine learning combinatorial algorithms. The model&#x2019;s comprehensive value was evaluated through prognostic analysis, pathway enrichment analysis, immune landscape analysis, chemosensitivity analysis, mutation analysis, ferroptosis, and m6A methylation analysis. NEU1&#x2019;s functional role was investigated via cell communication networks and molecular docking. Experimental validation included <italic>in vitro</italic> assays (Cell Counting Kit-8, migration, invasion), and clinical sample verification (quantitative real-time PCR (qRT-PCR) and Western Blot (WB)); these were performed to validate the key findings.</p>
</sec>
<sec>
<title>Results</title>
<p>Using 101 machine learning combinations, we constructed an 11-gene LIHC risk model (HLA-B, HEXB, CDK4, ACAT1, NAA10, B2M, HSPD1, NPM1, PON1, NEU1, CFB) demonstrating robust prognostic accuracy across training/validation cohorts and 10 LIHC subtypes. Immune landscape analysis revealed that the high-risk group exhibited higher tumor purity and lower immune infiltration, with better responses to PD-L1 and PD-L2 treatment. Chemosensitivity analysis showed that the high-risk group had increased sensitivity to four drugs, including Axitinib, but decreased sensitivity to 21 drugs, including Cisplatin. The risk model score significantly correlated with the expression levels of ferroptosis-related genes such as GPX4 and m6A methylation-related genes such as METTL3. NEU1 was identified as a key risk factor in this model, with the NEU1 high-expression group showing of intercellular communication in endothelial cells and other cell types. Pseudotime analysis suggested that NEU1 may promote LIHC progression by blocking normal differentiation of endothelial cells. Molecular docking revealed that five compounds, including Oseltamivir, could bind directly to NEU1. Knockdown of NEU1 significantly reduced proliferation, migration, and invasion of LIHC cells, and slowed LIHC tumor growth.</p>
</sec>
<sec>
<title>Conclusions</title>
<p>We constructed a histone acetylation-based risk model for LIHC diagnosis, prognosis, and therapy, identifying NEU1 as a key biomarker and potential therapeutic target.</p>
</sec>
</abstract>
<kwd-group>
<kwd>histone acetylation</kwd>
<kwd>immune microenvironment</kwd>
<kwd>LIHC</kwd>
<kwd>machine learning</kwd>
<kwd>NEU1</kwd>
</kwd-group>
<funding-group>
<funding-statement>The author(s) declared that financial support was received for this work and/or its publication. This work was funded by the Natural Science Foundation of Shaanxi Province (no.2025JC-YBQN-322 to Qian Wang).</funding-statement>
</funding-group>
<counts>
<fig-count count="14"/>
<table-count count="0"/>
<equation-count count="0"/>
<ref-count count="49"/>
<page-count count="25"/>
<word-count count="11601"/>
</counts>
<custom-meta-group>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Cancer Immunity and Immunotherapy</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Primary liver cancer is the sixth most common cancer and the third leading cause of cancer-related mortality worldwide, with hepatocellular carcinoma (LIHC) accounting for 75&#x2013;90% of cases. It is characterized by complex etiology, insidious early symptoms, and limited therapeutic options, which imposes a substantial burden on global healthcare systems (<xref ref-type="bibr" rid="B1">1</xref>&#x2013;<xref ref-type="bibr" rid="B3">3</xref>). Current LIHC risk stratification relies heavily on clinical staging (e.g., BCLC system) and genomic features (e.g., TP53 mutations), yet these models exhibit limited accuracy in predicting immunotherapy response and chemosensitivity (<xref ref-type="bibr" rid="B4">4</xref>, <xref ref-type="bibr" rid="B5">5</xref>).</p>
<p>Recent advances in omics technologies&#x2014;particularly single-cell RNA sequencing (scRNA-seq) and bulk transcriptome sequencing&#x2014;have revolutionized cancer research. scRNA-seq resolves cellular heterogeneity within the tumor microenvironment with unprecedented resolution, enabling identification of rare cell populations and dysregulated intercellular communication networks (<xref ref-type="bibr" rid="B6">6</xref>&#x2013;<xref ref-type="bibr" rid="B8">8</xref>). Bulk RNA-seq, in contrast, provides a holistic view of transcriptomic alterations driving tumor progression (<xref ref-type="bibr" rid="B9">9</xref>). Despite their utility, few LIHC studies have integrated these approaches with epigenetic mechanisms such as histone acetylation.</p>
<p>Histone Acetylation (HAA) is an important chemical modification in epigenetics, that regulates can regulate the expression of relevant genes by affecting chromatin remodeling, transcription factor activity, and metabolic enzyme activity. It thus plays an important role in biological processes such as embryonic development, immune cell activation, maintenance of hepatocyte function, DNA damage repair, and metabolic regulation (<xref ref-type="bibr" rid="B10">10</xref>&#x2013;<xref ref-type="bibr" rid="B13">13</xref>). In recent years, numerous of studies have shown that histone acetylation plays an important role in the development of malignant tumors such as breast cancer and gliomas; for example, Kim JJ et&#xa0;al. found that in breast cancer, the <italic>in vitro</italic> replication ability of breast cancer cells was reduced after histone H4K8 was acetylated by KAT2B, and that the reduction in the level of KAT2B might enhance resistance to PARP inhibitors (<xref ref-type="bibr" rid="B14">14</xref>). In gliomas, Histone acetyltransferases (HATs) also promotes cancer progression by reprogramming the tumor immune microenvironment to suppress anti-tumor immune responses. Chen P et&#xa0;al. found that KAT13D is highly expressed in glioblastoma stem-like cells and promotes microglial cell infiltration and its polarization towards an immunosuppressive phenotype by regulating HIF1&#x3b1; signaling and the transcription of chemokines OLFML3 and LGMN, thereby promoting glioma progression (<xref ref-type="bibr" rid="B15">15</xref>). Guo X et&#xa0;al. showed that a risk model consisting of histone acetylation-related genes HDAC6, CREB3, KLF13, GOLGA2, RPS6KA1, and ZMIZ2 in acute myeloid leukemia exhibits strong diagnostic and prognostic predictive power (<xref ref-type="bibr" rid="B16">16</xref>). However, despite its established roles in other cancers, the systematic impact of histone acetylation-related genes on LIHC prognosis and therapy resistance remains poorly characterized. Given the limited therapeutic options and high mortality of LIHC, there is an urgent need to identify novel epigenetic biomarkers for risk stratification and targeted interventions. This study aims to bridge this gap by integrating multi-omics data to construct the first histone acetylation-based prognostic model for LIHC, thereby uncovering potential therapeutic targets (e.g., NEU1) and providing a foundation for precision oncology.</p>
<p>In this study, we integrated single-cell RNA sequencing data from LIHC, RNA sequencing data, and histone acetylation-related gene sets to construct a model containing 11 histone acetylation-related genes (HLA-B, HEXB, CDK4, ACAT1, NAA10, B2M, HSPD1, NPM1, PON1, NEU1, and CFB) using 101 machine learning algorithms to construct a prognostic risk model. We comprehensively evaluated the function of the model in terms of LIHC diagnosis, prognosis, potential pathways, immune infiltration, and chemotherapy, identified NEU1 as a key risk factor of the model, and further explored its value in cell communication and pseudotime analysis. In addition, we validated the expression of these 11 genes in clinical samples and the effect of NEU1 on the malignant behavior of LIHC cells. Our study suggests that the prognostic risk model based on histone acetylation-related genes has potential clinical applications in LIHC.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Data acquisition and processing</title>
<p>The RNA sequencing data and corresponding clinical information for LIHC were obtained from the TCGA database (<ext-link ext-link-type="uri" xlink:href="https://portal.gdc.cancer.gov/">https://portal.gdc.cancer.gov/</ext-link>) (356 samples). Data for 212 samples from the International Cancer Genome Consortium Liver Cancer (ICGC-LIHC) cohort were sourced from the LIHCDB V2.0 database (<ext-link ext-link-type="uri" xlink:href="http://lifeome.net:809/#/home">http://lifeome.net:809/#/home</ext-link>), and data for another 206 samples from an ICGC-LIHC cohort were downloaded from the GEO database (<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/geo/">https://www.ncbi.nlm.nih.gov/geo/</ext-link>). Specifically, the dataset GSE124751, comprising 206 samples, was retrieved from GEO. The &#x201c;limma&#x201d; package was used to correct for batch effects between data sets. After excluding patients with incomplete survival data, a total of 781 tumor samples were retained for subsequent analysis (<xref ref-type="bibr" rid="B9">9</xref>).</p>
<p>To identify genes significantly associated with histone acetylation, we utilized the GeneCards database (<ext-link ext-link-type="uri" xlink:href="https://www.genecards.org/">https://www.genecards.org/</ext-link>), a comprehensive and integrative database of human genes. We performed a search using the keyword &#x201c;Histone Acetylation.&#x201d; GeneCards calculates a Relevance Score for each gene, representing the strength of the association between the gene and the search term based on weighted evidence from diverse sources, including experimental data, genetic pathways, and literature text mining. To ensure the reliability and specificity of the retrieved gene set, we applied a filtering threshold to exclude genes with weak associations. Only genes with a Relevance Score greater than 30 were retained. This rigorous screening process resulted in a final set of 588 histone acetylation-related genes for subsequent analysis.</p>
<p>The full single-cell RNA sequencing (scRNA-seq) datasets GSE149614 (<xref ref-type="bibr" rid="B6">6</xref>) and GSE166635 (<xref ref-type="bibr" rid="B7">7</xref>) were acquired in the GEO database. The Seurat package (<xref ref-type="bibr" rid="B8">8</xref>) was used for quality control and downstream analysis of scRNA-seq data. We excluded cells expressing fewer than 200 genes and genes detected in fewer than 5 cells and retained cells with a gene count between 300 and 5000. To ensure adequate sequencing depth while removing technical outliers, the total RNA count per cell (nCount_RNA) was kept above 1000 but below the 97th percentile of the dataset&#x2019;s count distribution. The PercentageFeatureSet function was used to calculate the percentage of mitochondrial gene expression in each cell, excluding cells with &gt;20% mitochondrial gene expression or&#xa0;&gt;5% hemoglobin gene expression. The final curated dataset contains 86,409 cells in 23 samples.</p>
<p>The &#x201c;RunHarmony&#x201d; function was used to correct batch effects in the scRNA-seq data. The optimal number of principal components (PCs) for downstream analysis was determined by the &#x201c;ElbowPlot&#x201d; function. Cell clustering was performed using the &#x201c;FindClusters&#x201d; function, followed by dimensionality reduction visualization using &#x201c;RunUMAP&#x201d; (dims=1:10). Cell populations were manually annotated based on classical cell type markers reported in the literature.</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Sources of patient and tissue samples</title>
<p>Frozen tissues and corresponding non-tumor tissues from five patients diagnosed with liver malignancies were collected from the Second Affiliated Hospital of Xi&#x2019;an Jiaotong University. All patients had a pathological diagnosis of hepatocellular carcinoma (LIHC) after surgical resection. Samples were used for WB and qRT-PCR experiments. All participants provided informed consent before the commencement of the study, which received approval from the Ethics Committee of the Second Affiliated Hospital of Xi&#x2019;an Jiaotong University.</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Cell culture</title>
<p>MHCC-97H, Hep3B, and LO2 cells were purchased from the Cell Bank of the Chinese Academy of Sciences and cultured in Dulbecco&#x2019;s modified Eagle&#x2019;s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 &#x3bc;g/ml streptomycin in a cell culture incubator at 37&#xb0;C, 5% CO2.</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Survival validation in independent cohorts</title>
<p>The Kaplan-Meier method was used to plot the overall survival (OS) and disease-free survival (DFS) curves, and the log-rank test was performed to compare the survival differences between the high-risk and low-risk groups (P &lt; 0.05 was considered statistically significant). In the ICGC-LIRI-JP cohort, subgroup analyses were stratified by age (&#x2264;60 years/&gt;60 years), gender, viral etiology (HBV/HCV), TNM stage (III/III-IV), and fibrosis stage (F0-F2/F3-F4). In the GSE124751 cohort, subgroups were stratified by age (&#x2264;60 years/&gt;60 years) and tumor mutational burden (TMB, divided into high/low TMB groups using the median as the cutoff). The prognostic value of the risk model was validated in each subgroup. All survival analyses were performed using the &#x201c;survival&#x201d; package in R software (version 4.2.1), and Kaplan-Meier curves were plotted using the &#x201c;survminer&#x201d; package.</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Disease risk modeling and validation</title>
<p>The &#x201c;FindMarkers&#x201d; function of the Seurat package (<xref ref-type="bibr" rid="B8">8</xref>) was applied to identify differentially expressed genes (DEGs) in cancer and normal tissues. Statistical significance was determined using the Wilcoxon test (threshold |logFC|&gt;0.5 and corrected p-value &lt;0.05, default for remaining parameters). The DEGs of cancer and normal tissue cells were intersected with histone acetylation-related genes to obtain 66 genes and further intersected with all genes of TCGA-LIHC, ICGC-LIHC, and GSE124751 tumor samples to obtain 65 genes, defined as histone acetylation-related differentially expressed genes (HAc-related DEGs).</p>
<p>To build a robust prognostic signature, we conducted a systematic and unbiased exploration to identify the optimal modeling strategy. The entire cohort (n=781) was first randomly partitioned into a training set (70% of patients) and an independent test set (30% of patients). Using the Mime R package, we then constructed 101 distinct prognostic models based on the 11 core prognostic genes. These models were generated by creating unique combinations of 10 machine learning algorithms: Lasso, Ridge, Stepwise Cox (stepCox), CoxBoost, Random Survival Forest (RSF), Elastic Net (Enet), Partial Least Squares Regression for Cox (plsRcox), Supervised Principal Components (SuperPC), Generalized Boosted Models (GBM), and Survival Support Vector Machine (survival-SVM).</p>
<p>Each of the 101 combinations represented a distinct pipeline for feature selection and/or model training. All models were developed and tuned exclusively on the training set. For algorithms requiring hyperparameter tuning (e.g., RSF), a 10-fold cross validation was performed only within the training set to identify the optimal parameters. The final selection of the best-performing model was based purely on its predictive accuracy on the unseen independent test set, as measured by the Concordance Index (C-index). The C-index is a key metric for evaluating survival models, quantifying the concordance between the predicted risk order of patients and their actual survival time order. It is the accepted standard for clinical prognostic studies as it effectively handles the censored data common in survival analysis. This data-driven approach ensures that the chosen model has the best-demonstrated generalizability, free from researcher bias.</p>
<p>Patients in the training and test sets were categorized into high-risk and low-risk groups based on their risk scores. The &#x201c;subplot&#x201d; function of the &#x201c;Mime1&#x201d; package (<xref ref-type="bibr" rid="B17">17</xref>) was used to analyze the differences in overall survival (OS) between risk groups (log-rank test, p &lt; 0.05). The diagnostic potential of the histone acetylation-related DEGs was assessed using the &#x201c;timeROC&#x201d; (<xref ref-type="bibr" rid="B18">18</xref>) and &#x201c;pROC&#x201d; packages (<xref ref-type="bibr" rid="B19">19</xref>) for analyzing receiver operating characteristic (ROC) curves. Risk score distributions were analyzed and visualized using boxplots.</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Prognostic analysis of risk models in different subtypes of LIHC</title>
<p>To further explore the prognostic value of the model, the prognostic ability of the model was assessed using OS in different subgroups. All analyses were done in the &#x201c;survival&#x201d; package, and the results were visualized using the &#x201c;ggplot2&#x201d; package.</p>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Analysis of differentially expressed genes and enrichment pathways of risk models in LIHC</title>
<p>Differentially expressed genes (DEGs) with corrected p-value &lt; 0.05 and |logFC| &gt; 0.5 were screened based on RNA-seq data. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was performed using the &#x201c;clusterProfiler&#x201d; package (<xref ref-type="bibr" rid="B20">20</xref>). Based on the logFC-ranked DEGs, the gene set of the MSigDB database (v7.5.1) was used for Gene Set Enrichment Analysis (GSEA). The pathways ranked in the top 10 by normalized enrichment score (NES) were visualized, and correlations between the risk model and core genes within these pathways were analyzed. All visualizations were generated using the &#x201c;enrichplot&#x201d; and &#x201c;ggplot2&#x201d; packages.</p>
</sec>
<sec id="s2_8">
<label>2.8</label>
<title>Immune landscape analysis of risk models in LIHC</title>
<p>The &#x201c;ESTIMATE&#x201d; package (<xref ref-type="bibr" rid="B21">21</xref>) was used to calculate the immunity score, stroma score, and tumor purity for all tumor samples (n=781) and to compare the differences between groups. The relative proportion of immune cells was estimated using the &#x201c;CIBERSORT&#x201d; package (<xref ref-type="bibr" rid="B22">22</xref>). Immune cell activity was assessed by the &#x201c;xCell&#x201d; package (<xref ref-type="bibr" rid="B23">23</xref>), and immune cell expression levels were assessed. The correlation of prognostic genes with the immune score, stroma score, and tumor purity was visualized using the &#x201c;corrplot&#x201d; package. In addition, risk models were analyzed for correlation with immune checkpoint-related genes, chemokines, chemokine receptors, and immune checkpoint blockade therapy (ICB).</p>
</sec>
<sec id="s2_9">
<label>2.9</label>
<title>Risk modeling for chemotherapy drug sensitivity analysis in LIHC</title>
<p>Drug sensitivity prediction was performed using the &#x201c;OncoPredict&#x201d; package (<xref ref-type="bibr" rid="B24">24</xref>). The model was trained based on the GDSC2 dataset, and IC50 values were calculated for the samples. The Wilcoxon test was used to compare the drug sensitivity differences between groups.</p>
</sec>
<sec id="s2_10">
<label>2.10</label>
<title>Mutational analysis of risk models in LIHC</title>
<p>Based on the somatic mutation data from the TCGA dataset, we used the &#x201c;maftools&#x201d; package (<xref ref-type="bibr" rid="B25">25</xref>) for mutation analysis. We also analyzed the tumor mutation load (TMB) between the two groups. The frequency of mutations and their distribution in specific genes were analyzed by &#x201c;maftools&#x201d; package.</p>
</sec>
<sec id="s2_11">
<label>2.11</label>
<title>Cross-cohort comparative analysis of mutational landscapes</title>
<p>Molecular data from three hepatocellular carcinoma (HCC) cohorts (TCGA-LIHC, MSK 2024, and CLCA 2024) were obtained from the cBioPortal database (<ext-link ext-link-type="uri" xlink:href="https://www.cbioportal.org/">https://www.cbioportal.org/</ext-link>). Mutation types (including point mutations, insertions/deletions) and copy number alterations (CNAs, such as amplifications, deep deletions, shallow deletions) of key genes in the risk model (e.g., HLA-B, NEU1, CDK4) were extracted. The &#x201c;maftools&#x201d; package in R software was used to generate an Oncoprint plot visualizing the gene alteration profiles of individual patients across cohorts. A stacked bar plot was created using the &#x201c;ggplot2&#x201d; package to compare the overall frequencies of major alteration types (amplification, deep deletion, mutation) among the three cohorts. For the NEU1 gene in the MSK-IMPACT cohort, the Kruskal-Wallis test was performed to compare the distribution of mutation counts across different CNA types (amplification, gain, diploid, shallow deletion; <italic>p</italic>&#xa0;&lt;&#xa0;0.05 was considered statistically significant).</p>
</sec>
<sec id="s2_12">
<label>2.12</label>
<title>Correlation analysis of risk models with ferroptosis and m6A methylation-related genes in LIHC</title>
<p>Ferroptosis refers to impaired intracellular lipid peroxide metabolism and toxic lipid production, which induces cell death. m6A is a methylation of RNA, i.e., on the 6th nitrogen atom of adenine (A) in RNA, which affects mRNA stability, translational efficiency, alternative splicing, and localization. We analyzed the prognostic risk model to correlate with ferroptosis and m6A-related genes in LIHC. Ferroptosis-related genes were derived from Ze-Xian Liu et&#xa0;al. Systematic analysis of the abnormalities and functions of ferroptosis in cancer (<xref ref-type="bibr" rid="B26">26</xref>). m6A-related genes were derived from Juan Xu et&#xa0;al. on the molecular characterization and clinical significance of m6A regulators across 33 cancer types (<xref ref-type="bibr" rid="B27">27</xref>). Statistical significance (<italic>p</italic> &lt;&#xa0;0.05) was estimated using an independent t-test for normally distributed variables.</p>
</sec>
<sec id="s2_13">
<label>2.13</label>
<title>NEU1-based analysis of cellular communication</title>
<p>Intercellular communication networks are systematically analyzed and resolved at the cellular level using the &#x201c;CellChat&#x201d; (<xref ref-type="bibr" rid="B28">28</xref>) package. The method is based on a database of ligand-receptor interactions that quantifies and predicts major cellular communication pathways. A probabilistic statistical framework is used to infer cell type-specific ligand-receptor pair communication probabilities and quantify the strength of communication and the number of receptor-ligand pairs between different cell types. Identify key cellular communication patterns in the tumor microenvironment, with special attention to signaling pathways associated with NEU1 and differences between groups with high and low NEU1 expression.</p>
</sec>
<sec id="s2_14">
<label>2.14</label>
<title>Pseudotime analysis based on NEU1</title>
<p>The &#x201c;CytoTRACE&#x201d; (<xref ref-type="bibr" rid="B29">29</xref>) algorithm was used to assess the developmental potential of single cells, and the CytoTRACE score was calculated based on the number of genes detected in each cell, with higher scores indicating cells with higher differentiation potential. The distribution of CytoTRACE scores was compared between tumor epithelial cells and normal epithelial cells to assess the effect of cancer on the differentiation status of cells. In cancer epithelial cell populations, the CytoTRACE scores of high and low NEU1 expression groups were compared to explore the correlation between NEU1 expression levels and cell differentiation potential. The endothelial cell differentiation trajectories were constructed by applying the &#x201c;Monocle3&#x201d; package (<xref ref-type="bibr" rid="B30">30</xref>), and the cell distribution was visualized by the UMAP downscaling method and the master map was calculated to infer the cell differentiation trajectories. Along the inferred differentiation trajectory, the dynamic changes in the expression of NEU1 and its related genes were analyzed. Combining the proposed temporal information with differential expression analysis, the potential regulatory role of NEU1 in endothelial cell differentiation was revealed.</p>
</sec>
<sec id="s2_15">
<label>2.15</label>
<title>Molecular docking based on NEU1</title>
<p>The NEU1 gene was mapped by the Coremine Medical Ontology Information Retrieval Platform (<ext-link ext-link-type="uri" xlink:href="http://www.coremine.com/medical/">www.coremine.com/medical/</ext-link>) to screen its top 10 potential regulatory molecules. Download NEU1 structure files from the PDB database (<ext-link ext-link-type="uri" xlink:href="https://www.rcsb.org/">https://www.rcsb.org/</ext-link>) to obtain target protein result files. Obtain the structure files of active compounds from PubChem database (<ext-link ext-link-type="uri" xlink:href="https://pubchem.ncbi.nlm.nih.gov/">https://pubchem.ncbi.nlm.nih.gov/</ext-link>), CB-Dock2 platform (<xref ref-type="bibr" rid="B31">31</xref>&#x2013;<xref ref-type="bibr" rid="B33">33</xref>) to optimize the structure (removing water molecules, ligands), and molecular docking simulation to evaluate the binding role of receptor proteins to small-molecule ligands after hydrogenation and balancing the charge on receptor proteins.</p>
</sec>
<sec id="s2_16">
<label>2.16</label>
<title>RNA preparation and quantitative real-time PCR</title>
<p>Total RNA was extracted from tissues using TRIZOL reagent (Invitrogen), and the process was performed according to the instructions. RNA was reversed to cDNA using the PrimeScript RT kit (Takara). qRT-PCR experiments were completed using the Takara SYBR Premix Ex Taq II kit, and the process was performed according to the instructions. The final results were corrected for the expression of GAPDH.</p>
<p>The primer sequences used in this study were as follows:</p>
<list list-type="simple">
<list-item>
<p>GAPDH-forward: TGTGGGCATCAATGGATTTGG</p></list-item>
<list-item>
<p>GAPDH-reverse: ACACCATGTATTCCGGGTCAAT</p></list-item>
<list-item>
<p>HLA-B-forward: TCCTAGCAGTTGTGGTCATC</p></list-item>
<list-item>
<p>HLA-B-reverse:TCAAGCTGTGAGAGACACAT</p></list-item>
<list-item>
<p>HEXB-forward: GATGTTGGCGCTGCTGACTC</p></list-item>
<list-item>
<p>HEXB-reverse: GGGCTGTGGCTGATGTAGAA</p></list-item>
<list-item>
<p>CDK4-forward: AATGTTGTACGGCTGATGGA</p></list-item>
<list-item>
<p>CDK4-reverse: AGAAACTGACGCATTAGATCCT</p></list-item>
<list-item>
<p>ACAT1-forward: CTGGGTGCAGGCTTACCTAT</p></list-item>
<list-item>
<p>ACAT1-reverse: ACATGCTCTCCATTCCACCTG</p></list-item>
<list-item>
<p>NAA10-forward: ATGAACATCCGCAATGCGAG</p></list-item>
<list-item>
<p>NAA10-reverse: CTAGGAGGCTGAGTCGGAGG</p></list-item>
<list-item>
<p>B2M-forward: TGCTGTCTCCATGTTTGATGTATCT</p></list-item>
<list-item>
<p>B2M-reverse: TCTCTGCTCCCCACCTCTAAGT</p></list-item>
<list-item>
<p>HSPD1-forward: TTGACTGCCACAACCTGAAG</p></list-item>
<list-item>
<p>HSPD1-reverse: CACCGTAAGCCTTTGGTCAT</p></list-item>
<list-item>
<p>NPM1-forward: GGAGGTGGTAGCAAGGTTCC</p></list-item>
<list-item>
<p>NPM1-reverse: TTCACTGGCGCTTTTTCTTCA</p></list-item>
<list-item>
<p>PON1-forward: CTGCTGATTGGCACAGTGTT</p></list-item>
<list-item>
<p>PON1-reverse: GGGTCAGCATTCATTGTTCA</p></list-item>
<list-item>
<p>NEU1-forward: TGAAGTGTTTGCCCCTGGAC</p></list-item>
<list-item>
<p>NEU1-reverse: AGGCACCATGATCATCGCTG</p></list-item>
<list-item>
<p>CFB-forward: GGAAGGGAATGTGACCAGG</p></list-item>
<list-item>
<p>CFB-reverse: AAGGCAGGAGAGAAGCTGG</p></list-item>
</list>
</sec>
<sec id="s2_17">
<label>2.17</label>
<title>Western blotting</title>
<p>Frozen tissues were lysed using RIPA buffer (Beyotime, China) containing a protease inhibitor mixture. Protein concentration was detected using the BCA Protein Quantification Kit (Beyotime, China). Protein samples were separated on 8% SDS-PAGE gels and transferred to PVDF membranes blocked with 5% non-fat powdered milk at low temperature for 2&#xa0;h. The PVDF membranes were incubated with diluted primary antibodies and incubated overnight at 4&#xb0;C (NEU1: 1:2000, proteintech, USA; GAPDH: 1:1000, CST, USA).</p>
<p>On the following day, after three washes with TBST, the PVDF membranes were incubated with HRP-conjugated secondary antibody (1:2000) for 2 hours. After three washes with TBST, protein bands were visualized using an ECL detection kit (Thermo Fisher, USA; 32106) and imaged with a Bio-Rad ChemiDoc Imaging System. Band intensity was quantified using ImageJ software.</p>
</sec>
<sec id="s2_18">
<label>2.18</label>
<title>NEU1 knockdown and validation</title>
<p>NEU1-specific siRNA (Santa Cruz Biotechnology, sc-106297) was transfected into Hep3B and MHCC-97H cell lines using Lipofectamine&#x2122; 3000 (Thermo Fisher Scientific, L3000008) to knock down NEU1 expression. Knockdown efficiency was assessed by RT-qPCR and Western blotting.</p>
<p>For RT-qPCR analysis, cells were seeded in 12-well plates and transfected with 40 pmol siRNA per well. Total RNA was isolated 24&#xa0;h post-transfection using TRIzol reagent (Invitrogen) and reverse-transcribed into cDNA with a PrimeScript RT kit (TaKaRa, RR036A). qPCR amplification was performed in 10 &#x3bc;L reactions using SYBR Green PCR Master Mix (TaKaRa, RR420B). Melting curve analysis confirmed primer specificity. The relative mRNA expression levels were normalized to GAPDH and calculated using the 2&#x2212;&#x394;&#x394;Ct method. All primer sequences were synthesized by Sangon Biotech (Shanghai, China).</p>
<p>For Western blotting, cells were harvested 48&#xa0;h after transfection. Total protein was extracted using RIPA lysis buffer (Beyotime, China; P0013B) supplemented with a protease inhibitor cocktail (Roche, Switzerland; 4693116001; 1 mg/mL). Protein concentrations were quantified using a BCA assay kit (Beyotime; P0010), and 20-30 &#x3bc;g of protein per sample was separated on 8% SDS-PAGE gels. Proteins were transferred to PVDF membranes (Millipore, USA), followed by blocking with 5% non-fat powdered milk for 2&#xa0;h at room temperature. Membranes were incubated overnight at 4&#xb0;C with primary antibodies against NEU1 (Proteintech, 67032-1-Ig; 1:1000) and GAPDH (Proteintech; 60004-1-Ig; 1:3000), followed by incubation with HRP-conjugated goat anti-rabbit secondary antibodies for 2&#xa0;h at room temperature. Protein bands were visualized using an ECL detection kit (Thermo Fisher, USA; 32106) and imaged with a Bio-Rad ChemiDoc Imaging System. Band intensity was quantified using ImageJ software.</p>
</sec>
<sec id="s2_19">
<label>2.19</label>
<title>CCK-8 assay</title>
<p>Transfected Hep3B and MHCC-97H cells were plated in 96-well culture plates at a density of 2&#xd7;10&#xb3; cells per well. Following incubation under standard culture conditions (37&#xb0;C, 5% CO<sub>2</sub>) for 12, 24, and 36 hours, the culture medium was replaced with 100 &#x3bc;L of DMEM containing CCK-8 reagent (Beyotime Biotechnology, China; C0038) at a 1:10 (v/v) dilution. After 1 hour of additional incubation, optical density measurements were performed using a microplate reader at a wavelength of 450 nm.</p>
</sec>
<sec id="s2_20">
<label>2.20</label>
<title>Colony formation assay</title>
<p>Transfected Hep3B and MHCC-97H cells (1000&#x2013;2000 cells/well) were plated in 6-well plates and cultured in a complete medium for 14 days. Colonies were fixed with 4% paraformaldehyde for 20&#xa0;min, stained with 1% (w/v) crystal violet (Beyotime, China; C0121) for 20&#xa0;min, and washed three times with deionized water. Colonies containing more than 50 cells were counted using an inverted microscope.</p>
</sec>
<sec id="s2_21">
<label>2.21</label>
<title>Wound healing assays</title>
<p>The ibidi Culture-Insert 2 Well (ibidi GmbH, Germany, 80209) was placed in a 60-mm Petri dish. Transfected Hep3B and MHCC-97H cells were seeded into the left and right chambers of the insert at a density of 2.5&#xd7;10<sup>5</sup> cells/well, respectively. After 12 hours of incubation in a serum-free medium, the culture insert was carefully removed. Cell migration patterns were documented at 0&#xa0;h and 24&#xa0;h using an inverted microscope.</p>
</sec>
<sec id="s2_22">
<label>2.22</label>
<title>Cell invasion assays</title>
<p>Transwell inserts (Corning, USA; 3422) were coated with Matrigel matrix (Beyotime, China; Cat# C0376-5ml) diluted in DMEM at a 1:8 ratio (v/v). After 12 hours of serum starvation, cells were trypsinized and resuspended in a serum-free medium. Subsequently, 5&#xd7;10<sup>4</sup> cells per well were seeded in the upper chamber, while the lower chamber was filled with 600 &#x3bc;L of complete medium. Following 36 hours of incubation, cells were fixed with 4% paraformaldehyde for 20 minutes and stained with 1% crystal violet (Beyotime, China; C0121) for 20 minutes. After being washed three times with deionized water, non-invading cells on the upper membrane surface were gently removed using cotton swabs. Migrated cells were imaged with an inverted microscope, and five random fields per well were analyzed.</p>
</sec>
<sec id="s2_23">
<label>2.23</label>
<title>Statistical analysis</title>
<p>All statistical analyses and visualizations were done by RStudio (version 4.3.3) and GraphPad Prism 8.0. Comparisons of normally distributed continuous variables between two groups were performed using the independent samples t-test, and non-normally distributed variables were tested using the Wilcoxon rank sum test. The Welch one-way ANOVA was used to evaluate comparisons between several groups. Each experiment was repeated three times, and all <italic>in vivo</italic> experiments were performed with at least five animals per group. Data are expressed as mean &#xb1; standard error of the mean (SEM), with <italic>p</italic>&#xa0;&lt;&#xa0;0.05 considered statistically significant.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Result</title>
<sec id="s3_1">
<label>3.1</label>
<title>Acquisition and processing of single-cell datasets</title>
<p><xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1</bold></xref> summarizes the overall workflow of this study. We first performed quality control and downstream analysis on two datasets, GSE166635 and GSE149614, from the Gene Expression Omnibus (GEO) database, and filtered the data to obtain a total of 86,409 cells, which were categorized into three groups of G1, G2M, and S phases, respectively (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2A</bold></xref>). Subsequently, the &#x201c;RunHarmony&#x201d; function was applied for batch removal, and principal component analysis (PCA) was used for dimensionality reduction, which successfully removed the batch effect while preserving the differences in the data (<xref ref-type="fig" rid="f2"><bold>Figures&#xa0;2B, C</bold></xref>). We further analyzed the highly variable genes in the samples, and the results showed that 15 genes, including IGHG1 and IGKC, were significantly enriched in the high-expression-high-variation region (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2D</bold></xref>). Using the &#x201c;ElbowPlot&#x201d; function, we found that the standard deviation curve flattened out after the harmony dimension was about 10, indicating that the contribution of additional dimensions to the variation of the data gradually decreased. Therefore, we chose the first 10 harmony dimensions for downstream clustering and dimensionality reduction visualization analysis, balancing the trade-off between dimensionality reduction and computational complexity (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2E</bold></xref>). Following unsupervised clustering of the scRNA-seq data, we employed UMAP dimensionality reduction for visualization. This process partitioned the cells into seven distinct clusters, which were subsequently annotated based on canonical marker genes as: B cells, Endothelial cells, Fibroblast/Mesenchymal cells, Hepatocytes, Macrophages/Monocytes, Plasma cells, and T/NK cells. To demonstrate the effectiveness of our cross-platform normalization for the bulk transcriptomic data, we performed UMAP on the integrated patient samples. The resulting plot shows a homogenous mixture of samples from all cohorts, confirming that batch effects were successfully removed. Finally, analysis of cellular composition revealed that Hepatocytes, Macrophages/Monocytes, and T/NK cells were the most abundant populations in LIHC samples, whereas T/NK cells and Macrophages/Monocytes were the dominant populations in normal liver tissue (<xref ref-type="fig" rid="f2"><bold>Figures&#xa0;2F-H</bold></xref>, <xref ref-type="supplementary-material" rid="SF1"><bold>Supplementary Figure&#xa0;1</bold></xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Systematic workflow.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1624883-g001.tif">
<alt-text content-type="machine-generated">Flowchart detailing a research process involving single-cell and bulk-RNA sequencing from databases like GEO, TCGA, and ICGC. Steps include quality control, differential analysis, machine learning, and experiment validation. Methods used are qRT-PCR, Western blot, and survival analysis, focusing on histone acetylation-related genes and prognostic modeling. The chart highlights expression and functional validation, cell communication, and pseudotime analysis for gene prognostics and medicine prediction.</alt-text>
</graphic></fig>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Acquisition of LIHC single-cell datasets. <bold>(A)</bold> Cell cycle visualization; <bold>(B)</bold> Harmony batch-corrected pre-decimation plots; <bold>(C)</bold> Harmony batch-corrected post-decimation plots; <bold>(D)</bold> the top 15 highly variable signature genes; <bold>(E)</bold> Harmony post-decimation principal component ANOVA contribution analysis plots; <bold>(F)</bold> the cellular compositions in the normal tissues and hepatocellular carcinoma tissues; <bold>(G)</bold> the cellularly annotated t-SNE plots; <bold>(H)</bold> the cellularly annotated UMAP plot; <bold>(I)</bold> Heatmap of the first 5 genes of each cell cluster in normal and hepatocellular carcinoma tissue.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1624883-g002.tif">
<alt-text content-type="machine-generated">Nine-panel image showing various data visualizations. Panel A is a scatter plot of cell cycle phases with three colored clusters. Panels B and C are scatter plots showing orig.ident in a PC_1 vs PC_2 and harmony dimensions. Panel D is a volcano plot of gene expression highlighting specific genes. Panel E shows a line plot of standard deviation versus harmony. Panel F displays stacked bar charts comparing cell types between normal and cancer samples. Panels G and H are UMAP plots visualizing different cell types. Panel I is a heatmap showing expression levels across cell types and groups.</alt-text>
</graphic></fig>
<p>In addition, to leverage the high resolution of single-cell RNA sequencing, we performed a cell-type-specific differential expression analysis. Specifically, within each annotated cell type (e.g., T cells, hepatocytes), we compared cells originating from LIHC tumor tissue with those from adjacent normal tissue. The lists of differentially expressed genes from each cell-type comparison were then merged and deduplicated, yielding a final set of 1,625 unique DEGs for subsequent analysis (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2I</bold></xref>, <xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Table&#xa0;1</bold></xref>).</p>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Constructing and validating histone acetylation-related risk models with 101 machine learning combinations in LIHC</title>
<p>To identify a set of candidate prognostic genes for subsequent analysis, we implemented a multi-step filtering process. We began with a list of 588 genes highly associated with histone acetylation, obtained from the GeneCards database (<xref ref-type="fig" rid="f3"><bold>Figure&#xa0;3A</bold></xref>, <xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Table&#xa0;2</bold></xref>). Next, to ensure these genes were not only biologically relevant and actively dysregulated in the liver cancer microenvironment, but also measurably present in our study cohorts, we performed a crucial intersection. We intersected these 588 genes with both (1) a list of 1,625 differentially expressed genes (DEGs) identified from single-cell analysis, and (2) the set of all genes available in our combined transcriptomic dataset (TCGA, ICGC, and GSE). This rigorous process yielded a final set of 65 genes, which were defined as histone acetylation-related differentially expressed genes (Hac-DEGs) and were carried forward for all subsequent prognostic model development (<xref ref-type="fig" rid="f3"><bold>Figure&#xa0;3B</bold></xref>, <xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Table&#xa0;3</bold></xref>).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Construction and validation of a histone acetylation-associated risk model for LIHC by 101 machine learning combinations. <bold>(A)</bold> Acquisition of histone acetylation gene sets from GeneCards; <bold>(B)</bold> Acquisition of 65 Histone acetylation-related DEGs; <bold>(C)</bold> 101 combinations of machine learning algorithms and their average C-indexes; <bold>(D)</bold> C-indexes of models constructed by the combination of StepCox[forward] + RSF in the training and validation sets; <bold>(E)</bold> C index; <bold>(E)</bold> 11 risk genes (HLA-B, HEXB, CDK4, ACAT1, NAA10, B2M, HSPD1, NPM1, PON1, NEU1, and CFB) included in the models constructed by the StepCox[forward] +RSF combination; <bold>(F, G)</bold> prognostic value of the risk models in the training and validation sets; <bold>(H, I)</bold> Time-dependent ROC of the risk model in the training and validation sets; <bold>(J, K)</bold> Risk factor maps of the risk model in the training and validation sets.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1624883-g003.tif">
<alt-text content-type="machine-generated">A composite of scientific data visualizations includes: (A) a table from GeneCards listing gene symbols and associated data, (B) a Venn diagram comparing gene sets, (C) a heatmap illustrating C-index values across cohorts, (D) a bar chart comparing C-index for two datasets, (E) a dot plot showing the frequency of top selected genes, (F) and (G) Kaplan-Meier survival curves for risk cohorts, (H) and (I) ROC curves for model performance, and (J) and (K) scatter plots depicting patient risk scores and survival status. Each visualization contributes to an analysis of gene significance and model validation.</alt-text>
</graphic></fig>
<p>Next, we went through 101 machine-learning combinations and obtained the C-index of each combination in all training and validation sets. The results showed that the StepCox[forward]+RSF combination had the highest C-index, which was 0.95 and 0.62 in the training and validation sets, respectively, suggesting that it had the best performance in predicting the prognosis of LIHC (<xref ref-type="fig" rid="f3"><bold>Figures&#xa0;3C, D</bold></xref>). As a result, a histone acetylation-associated risk model containing 11 genes (HLA-B, HEXB, CDK4, ACAT1, NAA10, B2M, HSPD1, NPM1, PON1, NEU1, and CFB) was constructed (<xref ref-type="fig" rid="f3"><bold>Figure&#xa0;3E</bold></xref>). We evaluated the expression of these 11 genes in the TCGA-LIHC dataset (<xref ref-type="supplementary-material" rid="SF2"><bold>Supplementary Figure&#xa0;2</bold></xref>) and their respective roles in assessing the overall survival (OS), disease-specific survival (DSS), progression-free interval (Progression Free Interval (PFI), and Disease-free-survival (DFS) (<xref ref-type="supplementary-material" rid="SF3"><bold>Supplementary Figure&#xa0;3</bold></xref>).</p>
<p>A risk score was assigned to each patient using the model, and all patients were included in either the high-risk or low-risk group based on the score. The OS of patients in different subgroups was analyzed in the training set using KM curves, and the results showed that patients in the high-risk group had a significantly worse prognosis (p&lt;0.001, 95% CI:17.36-34.27); this result was also confirmed in the validation set (p=0.014, 95% CI:1.27-3.71), which suggests that the model demonstrates robust performance in evaluating the overall survival of LIHC patients. (<xref ref-type="fig" rid="f3"><bold>Figures&#xa0;3F, G</bold></xref>). In addition, time-dependent ROC analysis showed that the model also had high value in predicting the overall survival of LIHC patients at 1, 3, and 5 years in both the training and validation sets (AUC: 0.948, 0.953, and 0.930 for the training set; AUC: 0.644, 0.628, and 0.605 for the validation set) (<xref ref-type="fig" rid="f3"><bold>Figures&#xa0;3H, I</bold></xref>). We depicted the risk factor plots of the model in the training and validation sets, respectively, to demonstrate the relationship between the model score and the survival status of the LIHC patients, where green dots indicate the survival status and red dots indicate the death status. In both the training and validation sets, the number of red points increased as the risk score increased, indicating that patients with high scores on the model had a higher risk of death (<xref ref-type="fig" rid="f3"><bold>Figures&#xa0;3J, K</bold></xref>).</p>
<p>Moreover, we incorporated an additional independent validation cohort, OEP000321, to verify the generalization ability of the models. In this rigorous external validation, the StepCox[forward] + RSF model achieved an AUC of 0.74, demonstrating the highest predictive accuracy among candidate models (<xref ref-type="supplementary-material" rid="SF4"><bold>Supplementary Figures&#xa0;4A, B</bold></xref>).</p>
<p>Instead of relying on a single metric, we evaluated the stability of the models over time. We calculated the average time-dependent AUC across all three datasets (training set, testing set, and the new OEP000321 validation set) for the 101 machine learning combinations. At the 1-year horizon, the StepCox[forward] + RSF model ranked 2nd among all combinations (<xref ref-type="supplementary-material" rid="SF4"><bold>Supplementary Figure&#xa0;4C</bold></xref>). At the 3-year horizon, the model ranked 1st, demonstrating superior mid-term predictive power (<xref ref-type="supplementary-material" rid="SF4"><bold>Supplementary Figure&#xa0;4D</bold></xref>). At the 5-year horizon, the model also ranked 1st, further confirming its long-term robustness (<xref ref-type="supplementary-material" rid="SF4"><bold>Supplementary Figure&#xa0;4E</bold></xref>).</p>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Prognostic analysis of risk models in different subtypes of LIHC</title>
<p>We evaluated the prognostic value of the risk model in different subgroups of TCGA-LIHC using R software. The results showed that the model had strong prognostic significance across ten distinct subgroups stratified by age (&gt;60 or &#x2264;60 years), sex (female or male), pathologic stage (I, II, or III/IV), and T stage (T1, T2, or T3) (all <italic>p</italic>&#xa0;&lt;&#xa0;0.001; <xref ref-type="fig" rid="f4"><bold>Figure&#xa0;4</bold></xref>). We then performed survival analysis across clinical subgroups within the entire ICGC-LIRI-JP cohort (<xref ref-type="supplementary-material" rid="SF5"><bold>Supplementary Figure&#xa0;5</bold></xref>) and validated the prognostic performance in the clinical subgroups of the entire GSE124751 cohort (<xref ref-type="supplementary-material" rid="SF6"><bold>Supplementary Figure&#xa0;6</bold></xref>). These findings suggest that this model has strong prognostic value in LIHC and is expected to be another new model for predicting the prognosis of LIHC patients.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Prognostic value of the histone acetylation-related risk model in different subgroups of LIHCPrognostic value of histone acetylation-associated risk model in <bold>(A)</bold> age &gt;60; <bold>(B)</bold> age &#x2264;60; <bold>(C)</bold> female; <bold>(D)</bold> male; <bold>(E)</bold> Stage I; <bold>(F)</bold> Stage II; <bold>(G)</bold> Stage III/IV; <bold>(H)</bold> T1; <bold>(I)</bold> T2; <bold>(J)</bold> T3.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1624883-g004.tif">
<alt-text content-type="machine-generated">Kaplan-Meier survival curves, displayed in ten panels (A-J), compare low and high-risk groups for variables: age (A, B), sex (C, D), cancer stages (E-G), and tumor size (H-J). Curves show survival probability over months, highlighting significant differences with P-values less than 0.001. Each panel includes a &#x201c;Number at risk&#x201d; table beneath the graph.</alt-text>
</graphic></fig>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>Analysis of differentially expressed genes and enrichment pathways of risk models in LIHC</title>
<p>We divided 781 LIHC patients into high-risk and low-risk groups based on the scoring of the risk model, compared the differential genes between the two groups in R software, and screened a total of 768 differential genes, including 367 up-regulated genes and 401 down-regulated genes (<xref ref-type="fig" rid="f5"><bold>Figure&#xa0;5A</bold></xref>). To understand the potential enrichment pathways of these genes, we performed GO and KEGG enrichment analyses. The results of GO analysis showed that these differential genes were mainly enriched in the small molecule catabolic process, response to xenobiotic stimulus, and collagen-containing extracellular matrix (<xref ref-type="fig" rid="f5"><bold>Figure&#xa0;5B</bold></xref>). KEGG analysis showed that these differential genes were mainly enriched in Complement and coagulation cascades, Cell cycle, and Retinol metabolism pathways (<xref ref-type="fig" rid="f5"><bold>Figure&#xa0;5C</bold></xref>). GSEA enrichment analysis showed that the model was significantly associated with some pathways in LIHC, e.g., ADIPOGENESIS (NES&#xa0;=&#xa0;1.836, <italic>p</italic>&#xa0;&lt;&#xa0;0.001), CHOLESTEROL HOMEOSTASIS (NES&#xa0;=&#xa0;1.83, <italic>p</italic>&#xa0;&lt;&#xa0;0.001), COAGULATION (NES&#xa0;=&#xa0;1.979, <italic>p</italic>&#xa0;&lt;&#xa0;0.001), FATTY ACID METABOLISM (NES&#xa0;=&#xa0;1.918, <italic>p</italic>&#xa0;&lt;&#xa0;0.001), MTORC1_SIGNALING (NES&#xa0;=&#xa0;1.791, <italic>p</italic>&#xa0;&lt;&#xa0;0.001), MYC_TARGETS_V1 (NES&#xa0;=&#xa0;2.208, <italic>p</italic>&#xa0;&lt;&#xa0;0.001), OXIDATIVE PHOSPHORYLATION (NES&#xa0;=&#xa0;2.225, <italic>p</italic>&#xa0;&lt;&#xa0;0.001), PEROXISOME (NES&#xa0;=&#xa0;1.769, <italic>p</italic>&#xa0;&lt;&#xa0;0.001), PROTEIN SECRETION (NES&#xa0;=&#xa0;1.75, <italic>p</italic>&#xa0;&lt;&#xa0;0.001), XENOBIOTIC METABOLISM (NES&#xa0;=&#xa0;1.936, <italic>p</italic>&#xa0;&lt;&#xa0;0.001), and the model scores were significantly correlated with the core genes of the above pathways (ALDH2: rho = -0.376, <italic>p</italic>&#xa0;&lt;&#xa0;0.001; ADH4: rho = -0.397, <italic>p</italic>&#xa0;&lt;&#xa0;0.001; SERPING1: rho = -0.383, <italic>p</italic>&#xa0;&lt;&#xa0;0.001; SMS: rho=0.399, <italic>p</italic>&#xa0;&lt;&#xa0;0.001; EIF2S2: rho=0.401, <italic>p</italic>&#xa0;&lt;&#xa0;0.001; PA2G4: rho=0.433, <italic>p</italic>&#xa0;&lt;&#xa0;0.001; ACAT1: rho=-0.398, <italic>p</italic>&#xa0;&lt;&#xa0;0.001; TOP2A: rho=0.344, <italic>p</italic>&#xa0;&lt;&#xa0;0.001; CLTA: rho=0.41, <italic>p</italic>&#xa0;&lt;&#xa0;0.001; F11: rho=-0.392, <italic>p</italic>&#xa0;&lt;&#xa0;0.001) (<xref ref-type="fig" rid="f5"><bold>Figures&#xa0;5D&#x2013;M</bold></xref>). These results suggest that the modulation of downstream pathways by this model may be by targeting these molecules to produce positive or negative effects, providing new targets for subsequent anti-LIHC drug development.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Differential gene and enrichment pathway analysis of histone acetylation-related risk model in LIHC. <bold>(A)</bold> Differential gene volcano maps of histone acetylation-associated risk models; <bold>(B)</bold> GO analysis of differential genes; <bold>(C)</bold> KEGG analysis of heterozygotes; <bold>(D&#x2013;M)</bold> GSEA analysis of differential genes and correlation analysis of histone acetylation-associated risk model scores with core genes of each pathway.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1624883-g005.tif">
<alt-text content-type="machine-generated">Graphs and charts depict various gene expression analyses. Panel A shows a volcano plot with differentially expressed genes, marked as upregulated, downregulated, or unchanged. Panels B and C display dot plots with enriched pathways based on gene ratios and adjusted p-values. Panels D to M present GSEA plots alongside scatter plots correlating enrichment scores and rank metrics for different hallmark pathways, such as adipogenesis, cholesterol homeostasis, and coagulation. Each panel includes multiple plots for detailed comparison and analysis.</alt-text>
</graphic></fig>
</sec>
<sec id="s3_5">
<label>3.5</label>
<title>Immune landscape analysis of risk models in LIHC</title>
<p>We first analyzed the composition of immune cells in all samples using the CIBERSORT algorithm with R software. The results showed that the immune cells in the samples were predominantly T cells and macrophages, with the highest percentage of M0-type macrophages and the smallest percentage of neutrophils (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6A</bold></xref>). Analysis of the correlation between immune cells in the microenvironment revealed a significant positive correlation between CD4 memory activated T cells and CD8 T cells (Cor=0.36), as well as a significant negative correlation between CD4 follicular helper T cells and CD4 memory resting T cells (Cor=-0.41) (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6B</bold></xref>). Examination of the correlation between each gene in the model and tumor stroma score, immune score, ESTIMATEScore, and tumor purity demonstrated a strong correlation between HLA-B and B2M with the tumor stroma score, immune score, ESTIMATEScore, and tumor purity (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6C</bold></xref>). Further analysis indicated that a higher model score corresponded to greater tumor purity and lower tumor stroma score, immune score, and ESTIMATEScore (<italic>p</italic>&#xa0;&lt;&#xa0;0.01) (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6D</bold></xref>).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Analysis of immune infiltration in LIHC by the histone acetylation-related risk model. <bold>(A)</bold> Compositional analysis of immune cells in all samples; <bold>(B)</bold> Correlation analysis between immune cells in all samples; <bold>(C)</bold> Correlation analysis between the expression of each of the 11 risk genes and stromal score, immune score, ESTIMATEScore, and tumor purity; <bold>(D)</bold> Scoring of the histone acetylation-associated risk model with a stromal score, immune score, ESTIMATEScore, and tumor purity; <bold>(E)</bold> correlation analysis with immune cell infiltration; <bold>(F)</bold> correlation analysis with immune checkpoints; <bold>(G)</bold> correlation analysis with chemokines; <bold>(H)</bold> correlation analysis with chemokine receptors; and <bold>(I)</bold> assessment of immunotherapeutic response based on the TIDE algorithm.(*<italic>p</italic>&#xa0;&lt;&#xa0;0.05; **<italic>p</italic>&#xa0;&lt;&#xa0;0.01; ***<italic>p</italic>&#xa0;&lt;&#xa0;0.001; ****<italic>p</italic>&#xa0;&lt;&#xa0;0.0001).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1624883-g006.tif">
<alt-text content-type="machine-generated">Multiple visualizations display biological and statistical data. Panel A shows a stacked bar plot of immune cell composition across samples. Panel B is a correlation matrix. Panel C presents a heatmap of scores related to gene expression and tumor characteristics. Panel D is a series of box plots comparing gene expression in different groups. Panel E shows a dot plot of gene expression across various categories. Panel F features box plots for gene expression in two clusters. Panels G and H are heatmaps of chemokine and chemokine receptor gene expressions. Panel I is a box plot comparing expression in groups for specific genes.</alt-text>
</graphic></fig>
<p>We analyzed the correlation between the risk model score and immune cell infiltration, immune checkpoint-related gene expression, chemokine and chemokine receptor infiltration with R software, and the results showed that the infiltration level of many kinds of immune cells in the microenvironment changed significantly with the higher risk score of the model, the expression level of immune checkpoint-related genes, such as MYD1, TNFRSF4, and other immune checkpoint-related genes, were significantly up-regulated. The infiltration levels of chemokines such as CXCL5, CXCL9, CXCL10, CXCL13, CXCL14, and chemokine receptors such as CCR2, CCR4, CCR5, CCR7, CCR9, CCR10, CXCR3, CXCR6, XCR1, etc., also changed significantly (<italic>p</italic>&#xa0;&lt;&#xa0;0.05) (<xref ref-type="fig" rid="f6"><bold>Figures&#xa0;6E&#x2013;H</bold></xref>).</p>
<p>To assess the clinical potential of risk models in immunotherapy, we analyzed the ICI responses of the high-risk and low-risk groups using the Tumor Immune Dysfunction and Exclusion (TIDE) algorithm with R software. The results showed that the ICB scores for CD274 and PDCD1LG2 were lower in the high-risk group, indicating that the high-risk group had a better response to targeted CD274 and PDCD1LG2 therapy (<italic>p</italic>&#xa0;&lt;&#xa0;0.001) (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6I</bold></xref>).</p>
</sec>
<sec id="s3_6">
<label>3.6</label>
<title>Risk modeling for chemotherapy drug sensitivity analysis in LIHC</title>
<p>We analyzed the correlation between risk model scores and sensitivity to 25 clinically used chemotherapeutic drugs based on the GDSC2 database. The results demonstrated that the higher the risk model score, the lower the IC50 of Axitinib, Paclitaxel, Telomerase Inhibitor IX, and Vinblastine, indicating greater sensitivity to these drugs. Conversely, for Camptothecin, Carmustine, Cisplatin, Cyclophosphamide, Cytarabine, Dactinomycin, Entinostat, Erlotinib, Fludarabine, Foretinib, Gefitinib, Gemcitabine, Irinotecan, Niraparib, Oxaliplatin, Palbociclib, Pyridostatin, Rapamycin, Savolitinib, Talazoparib, and Venetoclax, higher IC50 values correlated with an increased susceptibility to develop resistance to these drugs (<italic>p</italic>&#xa0;&lt;&#xa0;0.05) (<xref ref-type="fig" rid="f7"><bold>Figure&#xa0;7</bold></xref>). These findings suggest that risk model scores are instructive for personalized therapeutic drug selection in patients with LIHC.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Histone acetylation-related risk model for correlation with chemotherapeutic drug sensitivity in LIHC (*<italic>p</italic>&#xa0;&lt;&#xa0;0.05; **<italic>p</italic>&#xa0;&lt;&#xa0;0.01; ***<italic>p</italic>&#xa0;&lt;&#xa0;0.001; ****<italic>p</italic>&#xa0;&lt;&#xa0;0.0001).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1624883-g007.tif">
<alt-text content-type="machine-generated">Boxplot grid comparing the distribution of values for different drugs across two groups, labeled &#x201c;low&#x201d; and &#x201c;high,&#x201d; in blue and yellow respectively. Each boxplot represents a drug and displays variations in median and range between the two groups. Statistical significance is indicated above each plot with asterisks, with more stars denoting higher significance.</alt-text>
</graphic></fig>
</sec>
<sec id="s3_7">
<label>3.7</label>
<title>Mutational analysis of risk models in LIHC</title>
<p>Based on the somatic mutation data from the TCGA-LIHC dataset, we analyzed the mutational profiles associated with the risk model using R software. The results showed that missense mutation was the most common type of alteration (<xref ref-type="fig" rid="f8"><bold>Figure&#xa0;8A</bold></xref>). The top 30 most frequently mutated genes in the entire cohort, the low-risk group (n = 149), and the high-risk group (n = 206) are presented in <xref ref-type="fig" rid="f8"><bold>Figures&#xa0;8B&#x2013;D</bold></xref>, respectively.</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Mutation analysis of histone acetylation-related risk models in LIHC <bold>(A)</bold> Analysis of mutation types; <bold>(B)</bold> Top 30 genes with the highest mutation frequency in all samples; <bold>(C)</bold> Top 30 genes with the highest mutation frequency in samples from the high-risk group; <bold>(D)</bold> Top 30 genes with the highest mutation frequency in samples from the low-risk group; <bold>(E)</bold> TMB analysis between the high-risk and low-risk groups. (*<italic>p</italic>&#xa0;&lt;&#xa0;0.05).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1624883-g008.tif">
<alt-text content-type="machine-generated">A series of graphs and charts displaying genetic mutation data related to variant classification, type, and specific gene mutations. Panel A illustrates variants per sample and top mutated genes via bar charts and box plots. Panel B shows an OncoPrint for top gene mutations with color-coded alteration types. Panel C presents top mutations for a high-risk group, and panel D for a low-risk group, both with similar formats. Panel E is a box plot comparing mutation burdens between low and high groups, highlighting distribution differences.</alt-text>
</graphic></fig>
<p>Tumor mutation burden (TMB) was defined as the total number of somatic gene coding errors, base substitutions, gene insertion or deletion errors detected per million bases. We analyzed the TMB scores between the high-risk and low-risk groups of the risk model and showed that the high-risk group had higher TMB scores (<italic>p</italic> &lt;&#xa0;0.05) (<xref ref-type="fig" rid="f8"><bold>Figure&#xa0;8E</bold></xref>).</p>
<p>To systematically investigate the mutation frequency and spectrum of key genes in our model across diverse molecular contexts, we performed a direct comparison using cBioPortal between the model&#x2019;s development cohort (TCGA-LIHC) and two other large-scale HCC studies (MSK 2024 and CLCA 2024). This comparative analysis revealed distinct molecular architectures among the three cohorts. The TCGA cohort was characterized by a high frequency of Copy Number Alterations (CNAs), predominantly gene amplifications. In contrast, the MSK 2024&#xa0;cohort exhibited a mutation-driven profile, featuring specific&#xa0;alterations such as truncating mutations in HLA-B. The CLCA 2024 cohort displayed a relatively genomically inactive background with the lowest overall frequency of CNAs (<xref ref-type="supplementary-material" rid="SF7"><bold>Supplementary Figure&#xa0;7</bold></xref>).</p>
</sec>
<sec id="s3_8">
<label>3.8</label>
<title>Correlation analysis of risk models with ferroptosis and m6A methylation-related genes in LIHC</title>
<p>We analyzed the correlation between the risk model score and ferroptosis-related genes, and the results showed that the higher the risk model score, the higher the expression levels of GPX4, AIFM2, SLC7A11, GSS, ACSL4, TMEM164, TFRC, FTH1, DHCR7, SLC3A2, SLC1A5, SLC39A7, HSPB1, PCBP2 were upregulated, while the expression levels of NFE2L2 and SLC40A1 were downregulated (<italic>p</italic>&#xa0;&lt;&#xa0;0 05), suggesting that the risk model may promote or inhibit ferroptosis by influencing the expression of these genes (<italic>p</italic>&#xa0;&lt;&#xa0;0 05). were also correspondingly up-regulated, while the expression levels of NFE2L2 and SLC40A1 were correspondingly down-regulated (<italic>p</italic>&#xa0;&lt;&#xa0;0.05), suggesting that the risk model may promote or inhibit ferroptosis by affecting the expression of these genes (<xref ref-type="fig" rid="f9"><bold>Figure&#xa0;9A</bold></xref>).</p>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>Correlation analysis of histone acetylation-associated risk model with iron death and m6A methylation in LIHC <bold>(A)</bold> Heatmap of correlation between risk model score and iron death-related genes; <bold>(B)</bold> Heatmap of correlation between risk model score and m6A methylation-related genes.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1624883-g009.tif">
<alt-text content-type="machine-generated">Heatmaps comparing gene expression. Panel A shows ferroptosis genes with expression levels ranging from low (blue) to high (red). Panel B illustrates m6A-related gene expression, also with low to high range. Each panel includes labeled genes and a color key for expression intensity.</alt-text>
</graphic></fig>
<p>We performed a correlation analysis between risk model scores and m6A methylation-related genes, and the results showed that the higher the risk model scores, the expression levels of METTL3, HNRNPC, RBM15, COPS5, DSN1, HNRNPA2B1, YTHDF2, IGF2BP2 and FABP5 were correspondingly up-regulated, whereas the expression levels of GMP6A, and ZC3H13 were correspondingly down-regulated (<italic>p</italic>&#xa0;&lt;&#xa0;0.05), suggesting that the risk model may promote or inhibit m6A methylation by affecting the expression of these genes (<xref ref-type="fig" rid="f9"><bold>Figure&#xa0;9B</bold></xref>).</p>
</sec>
<sec id="s3_9">
<label>3.9</label>
<title>NEU1-based analysis of cellular communication</title>
<p>After analyzing the expression of 11 genes in the risk model in TCGA-LIHC, eight genes, HLA-B, HEXB, CDK4, NAA10, B2M, HSPD1, NPM1, and NEU1, were found to be highly expressed in the tumor tissues of TCGA-LIHC (<xref ref-type="supplementary-material" rid="SF2"><bold>Supplementary Figure&#xa0;2</bold></xref>). Analysis of the differential genes between the two groups, the high-risk group and the low-risk group, revealed that the upregulation of NEU1 was the most significant (<xref ref-type="fig" rid="f5"><bold>Figure&#xa0;5A</bold></xref>), and prognostic analyses of these 11 genes in TCGA-LIHC revealed that NEU1 had a good prognostic function (<xref ref-type="supplementary-material" rid="SF3"><bold>Supplementary Figure&#xa0;3</bold></xref>). Therefore, we concluded that NEU1 may be a key risk factor in this model.</p>
<p>To clarify the role of NEU1 in cellular communication, we first analyzed its expression at the single-cell level using R. NEU1 was expressed in B cells, endothelial cells, fibroblasts, mesenchymal stromal cells, hepatocytes, monocytes/macrophages, plasma cells, and T/NK cells. Compared with non-tumor tissues, NEU1 expression levels in these cell types were significantly higher in LIHC tissues (<italic>p</italic>&#xa0;&lt;&#xa0;0.05) (<xref ref-type="fig" rid="f10"><bold>Figures&#xa0;10A&#x2013;C</bold></xref>). In LIHC tissues, the NEU1 high-expression group had a higher frequency and intensity of interactions compared to the NEU1 low-expression group (<xref ref-type="fig" rid="f10"><bold>Figure&#xa0;10D</bold></xref>). Changes in the expression level of NEU1 could lead to alterations in the intensity of communication between a variety of cells, with the highest frequency of communication between endothelial cells (<xref ref-type="fig" rid="f10"><bold>Figure&#xa0;10E</bold></xref>). <xref ref-type="fig" rid="f10"><bold>Figure&#xa0;10F</bold></xref> demonstrates the potential mechanisms of communication, including ligand-receptor interactions and direction of communication, between different cells in the NEU1 high-expression and NEU1 low-expression groups. For example, in the NEU1 high-expression group, monocytes/macrophages may regulate changes in fibroblast/mesenchymal cell function or phenotype through SPP1 binding to CD44 or integrins (ITGAV+ITGB1).</p>
<fig id="f10" position="float">
<label>Figure&#xa0;10</label>
<caption>
<p>The cellular communication network of NEU1 <bold>(A)</bold> Expression of NEU1 on different cell clusters; <bold>(B, C)</bold> Comparison of NEU1 expression in tumor tissues and non-tumor tissues; <bold>(D)</bold> Comparison of the frequency and strength of cellular interactions in the high and low expression groups of NEU1; <bold>(E)</bold> Impact of changes in the expression level of NEU1 on the strength of inter-cellular communication; <bold>(F)</bold> Ligand-receptor interactions between different cells in the high and low expression groups of NEU1; <bold>(G)</bold> Intensity of histone acetylation-related pathway in different cells in the NEU1 high and low expression groups; <bold>(H)</bold> Comparison of the intensity of histone acetylation-related pathway interactions in different cells in the NEU1 high and low expression groups. (*<italic>p</italic>&#xa0;&lt;&#xa0;0.05; ***<italic>p</italic>&#xa0;&lt;&#xa0;0.001);.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1624883-g010.tif">
<alt-text content-type="machine-generated">A collage of multiple charts and graphs showing NEU1 expression and related data. Panel A depicts violin plots of NEU1 expression across various cell types. Panel B shows dot plots comparing NEU1 levels between cancer and normal conditions. Panel C contains two UMAP plots visualizing cellular distributions in cancer and normal samples. Panel D presents bar graphs comparing the number of significant interactions and interaction strengths between NEU1-High and NEU1-Low. Panel E is a heatmap of signaling patterns for NEU1-High versus NEU1-Low. Panel F contains dot plots of significant signaling interactions. Panel G illustrates overall signaling patterns with bar graphs. Panel H shows dot plots of histone acetylation-related pathways, comparing NEU1-High and NEU1-Low.</alt-text>
</graphic></fig>
<p>NOTCH signaling pathway, TNF signaling pathway, VEGF signaling pathway, and PDGF signaling pathway are common histone acetylation-related pathways, and our study showed that these four pathways were most significant in endothelial cells in both NEU1 high- and low-expression groups (<xref ref-type="fig" rid="f10"><bold>Figure&#xa0;10G</bold></xref>). Analysis of the interaction strength of histone acetylation-related pathways in different cells revealed that the interaction strength was highest in endothelial cells and low in fibroblasts/mesenchymal stromal cells when NEU1 was highly expressed, and it remained highest in endothelial cells and increased in fibroblasts/mesenchymal stromal cells when NEU1 was low-expression (<xref ref-type="fig" rid="f10"><bold>Figure&#xa0;10H</bold></xref>).</p>
</sec>
<sec id="s3_10">
<label>3.10</label>
<title>NEU1-based pseudo-timing analysis</title>
<p>We used the &#x201c;CytoTRACE&#x201d; package to quantify cell differentiation potential and compared the CytoTRACE scores of LIHC endothelial cells with those of normal endothelial cells. The results showed that the differentiation degree of LIHC endothelial cells was lower than that of normal endothelial cells (<xref ref-type="fig" rid="f11"><bold>Figures&#xa0;11A, B</bold></xref>). Further analysis revealed that the expression level of NEU1 was significantly up-regulated in endothelial cells of LIHC tissues (<xref ref-type="fig" rid="f11"><bold>Figure&#xa0;11C</bold></xref>) and that the endothelial cells of LIHC had a higher differentiation potential (<xref ref-type="fig" rid="f11"><bold>Figure&#xa0;11D</bold></xref>). Among the endothelial cell subpopulations of LIHC, the expression level of NEU1 was significantly upregulated in low-differentiated endothelial cells of LIHC, which often had higher differentiation potential, which may be an important reason why the high expression of NEU1 suggests a poor prognosis for patients with LIHC (<xref ref-type="fig" rid="f11"><bold>Figures&#xa0;11E&#x2013;H</bold></xref>).</p>
<fig id="f11" position="float">
<label>Figure&#xa0;11</label>
<caption>
<p>Pseudo-timing analysis of NEU1. <bold>(A, B)</bold> LIHC endothelial cells were less differentiated than normal endothelial cells; <bold>(C)</bold> NEU1 expression levels were significantly up-regulated in endothelial cells of LIHC tissues; <bold>(D)</bold> Endothelial cells of LIHC had higher differentiation potential.; <bold>(E&#x2013;G)</bold> NEU1 expression levels were significantly upregulated in low-differentiated LIHC endothelial cells; <bold>(H)</bold> endothelial cells with high NEU1 expression have higher differentiation potential; <bold>(I)</bold> Monocle3 clustering analysis of heterogeneity of normal vs. LIHC endothelial cells; <bold>(J)</bold> Distribution of NEU1 expression in normal vs. LIHC endothelial cells; <bold>(K)</bold> Pseudo-temporal analysis of endothelial cell differentiation trajectories; <bold>(L)</bold> Dynamic changes of NEU1 expression on endothelial cell differentiation trajectories.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1624883-g011.tif">
<alt-text content-type="machine-generated">Panel A shows a scatter plot of endothelial cells colored by CytoTRACE prediction. Panel B indicates different cell phenotypes with red for cancer and blue for normal. Panel C displays NEU1 gene expression. Panel D presents box plots of predicted ordering by CytoTRACE for cancerous versus normal cells. Panel E repeats CytoTRACE with a different dataset. Panel F highlights high and low phenotype differences. Panel G shows NEU1 gene expression again. Panel H compares high and low CytoTRACE prediction orders. Panels I to L show UMAP plots with various color codings representing cell type, gene expression, pseudotime, and NEU1 value.</alt-text>
</graphic></fig>
<p>To reveal the trajectory of endothelial cell differentiation and the potential role of NEU1 in this process, we used Monocle3 to perform the proposed time-series analysis. The analysis showed that normal endothelial cells formed highly aggregated cell clusters and exhibited high stability, whereas endothelial cells of LIHC exhibited heterogeneity that was significantly different from that of normal endothelial cells (<xref ref-type="fig" rid="f11"><bold>Figure&#xa0;11I</bold></xref>). Further analysis revealed that the expression level of NEU1 was significantly up-regulated mainly in endothelial cells of LIHC and some normal endothelial cells, whereas it was low-expressed in most normal endothelial cells (<xref ref-type="fig" rid="f11"><bold>Figure&#xa0;11J</bold></xref>).</p>
<p>Pseudo-temporal trajectory analysis revealed a stable differentiation pathway of endothelial cells along the left-to-right direction, demonstrating a sequential process of transformation of normal endothelial cells to LIHC endothelial cells (<xref ref-type="fig" rid="f11"><bold>Figure&#xa0;11K</bold></xref>). Notably, NEU1 expression levels showed progressive up-regulation on this differentiation trajectory, suggesting that NEU1 may play a key role in the transformation of normal endothelial cells to a malignant phenotype (<xref ref-type="fig" rid="f11"><bold>Figure&#xa0;11L</bold></xref>).</p>
</sec>
<sec id="s3_11">
<label>3.11</label>
<title>NEU1-based molecular docking analysis</title>
<p>Ten drugs highly related to NEU1 were screened through the&#xa0;Coremine database, from which the active compounds with structural information available in PubChem were selected and subsequently analyzed by molecular docking in the CB-Dock2 platform. The results showed that a variety of compounds exhibited good binding activities (<xref ref-type="fig" rid="f12"><bold>Figure&#xa0;12A</bold></xref>), among which 2&#x2019;-(4-methylumbelliferyl)-&#x3b1;-D-N-acetylneuraminic acid, N-Acetylneuraminic acid, N acetylneuraminolactose, 2-deoxy-2,3-dehydro-N-acetylneuraminic acid, and Oseltamivir all showed&#xa0;binding energy values below -5 kcal/mol, suggesting that these compounds have superior binding ability to NEU1 (<xref ref-type="fig" rid="f12"><bold>Figures&#xa0;12B&#x2013;F</bold></xref>).</p>
<fig id="f12" position="float">
<label>Figure&#xa0;12</label>
<caption>
<p>Molecular docking of NEU1 Molecular docking analysis of NEU1-targeted drugs. <bold>(A&#x2013;E)</bold> 2&#x2019;-(4-methylumbelliferyl)-&#x3b1;-D-N-acetylneuraminic acid, N-Acetylneuraminic acid, N-acetylneuraminolactose, 2-deoxy-2,3-dehydro-N-acetylneuraminic acid and Oseltamivir. <bold>(F)</bold> The results of the molecular docking analysis performed by the CB-Dock2 platform.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1624883-g012.tif">
<alt-text content-type="machine-generated">Chart and molecular graphics depicting NEU1 receptor protein interactions with various compounds.   Panel A: Table listing compounds with PubChem CID, names, receptor protein (NEU1), PDB ID, and binding ability scores.  Panels B-F: Molecular surface representations highlighting binding sites in NEU1. Enlarged insets show close-ups of interactions with compounds, identified by residue labels and highlighted regions in yellow and magenta.</alt-text>
</graphic></fig>
</sec>
<sec id="s3_12">
<label>3.12</label>
<title>Validation of the expression of 11 genes in the risk model in LIHC samples</title>
<p>We analyzed the expression of the aforementioned 11 genes in LIHC in clinical specimens using qRT-PCR. Compared with adjacent non-tumor tissues, mRNA levels of HLA-B, HEXB, NAA10, B2M, NPM1, and NEU1 were significantly upregulated in tumor tissues, while PON1 and ACAT1 were downregulated. No differential expression was observed for CFB, consistent with database analyses (<xref ref-type="fig" rid="f13"><bold>Figures&#xa0;13A&#x2013;I</bold></xref>). However, there was no statistically significant difference between CDK4 and HSPD1 in our sample (<xref ref-type="supplementary-material" rid="SF8"><bold>Supplementary Figure&#xa0;8</bold></xref>). Based on machine learning models and qPCR validation, NEU1 was selected for further investigation. Western blot analysis of LIHC in clinical specimens showed significantly elevated NEU1 protein expression in tumor tissues compared with paired adjacent non-tumor tissues (<xref ref-type="fig" rid="f13"><bold>Figures&#xa0;13J, K</bold></xref>).</p>
<fig id="f13" position="float">
<label>Figure&#xa0;13</label>
<caption>
<p>Expression of Acetylation-Associated Genes in LIHC. <bold>(A&#x2013;I)</bold> mRNA expression of acetylation-associated genes in LIHC. n = 3; <bold>(J, K)</bold> NEU1 protein was detected in LIHC. n = 5, Data are presented as mean &#xb1; SEM (*<italic>p</italic>&#xa0;&lt;&#xa0;0.05; **<italic>p</italic>&#xa0;&lt;&#xa0;0.01).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1624883-g013.tif">
<alt-text content-type="machine-generated">Graphs A to I show the relative mRNA expression levels of different genes (HLA-A, HEXB, NMT1, B2M, NPM1, NEU1, PON1, ACAT1, CFB) in normal versus tumor samples, with tumor samples generally showing higher expression. Image J is a Western blot comparing NEU1 and GAPDH protein levels in tumor (T) and normal (N) samples from five patients (P1-P5), showing increased NEU1 in tumors. Graph K displays the relative expression of NEU1, indicating higher levels in tumors than normal tissues. Asterisks denote statistical significance.</alt-text>
</graphic></fig>
</sec>
<sec id="s3_13">
<label>3.13</label>
<title>NEU1 knockdown inhibits proliferation, migration, and invasion of LIHC cells</title>
<p>Similarly, NEU1 mRNA levels were significantly higher in LIHC cell lines (Hep3B and MHCC-97H) than in the normal hepatocyte line LO2 (<xref ref-type="fig" rid="f14"><bold>Figure&#xa0;14A</bold></xref>). To investigate the functional role of NEU1, we transfected Hep3B and MHCC-97H cells with specific siRNA targeting NEU1. We found that the si-NEU1&#x2013;3 fragment exhibited robust knockdown efficacy at both the mRNA and protein levels (<xref ref-type="fig" rid="f14"><bold>Figures&#xa0;14B&#x2013;E</bold></xref>) and was therefore selected for subsequent experiments. CCK-8 assays (<xref ref-type="fig" rid="f14"><bold>Figure&#xa0;14F</bold></xref>), clone formation assays (<xref ref-type="fig" rid="f14"><bold>Figures&#xa0;14G, H</bold></xref>), wound healing assays(<xref ref-type="fig" rid="f14"><bold>Figures&#xa0;14I, J</bold></xref>), and Transwell invasion assays(<xref ref-type="fig" rid="f14"><bold>Figures&#xa0;14K, L</bold></xref>) demonstrated that NEU1 knockdown significantly suppressed proliferation, migration, and invasion in Hep3B and MHCC-97H cells.</p>
<fig id="f14" position="float">
<label>Figure&#xa0;14</label>
<caption>
<p><italic>In Vitro</italic> Validation of the Biological functions of NEU1 in LIHC <bold>(A)</bold> The mRNA expression of NEU1 in Hep3B and MHCC97H vs. LO2 cell lines; <bold>(B-E)</bold> Verification of knockdown efficiency of NEU1 in Hep3B and MHCC97H cell lines; The biological functions of NEU1 on glioma cell lines were verified by CCK-8 <bold>(F)</bold>, colony formation <bold>(G, H)</bold>, wound healing <bold>(I, J)</bold> and Transwell <bold>(K, L)</bold> experiments. (n=3, Scale Bar = 20 &#x3bc;m). Data are presented as mean &#xb1; SEM. (*<italic>p</italic>&#xa0;&lt;&#xa0;0.05; **<italic>p</italic>&#xa0;&lt;&#xa0;0.01; ***<italic>p</italic>&#xa0;&lt;&#xa0;0.001).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-17-1624883-g014.tif">
<alt-text content-type="machine-generated">A series of graphs and images present data on NEU1 expression and its effects. Panels A and B depict bar graphs showing relative mRNA expression of NEU1 in different cell lines with statistical significance indicated by asterisks. Panels C and D show Western blot images of NEU1 and GAPDH protein levels in Hep 3B and 97H cells, respectively. Panel E presents graphs of relative NEU1 expression across different siRNA treatments. Panel F features line graphs comparing OD values over time for two cell lines. Panels G and H display images of cell colonies with corresponding bar graphs of colony counts. Panels I and J compare migration rates of cells with respective bar graphs. Panels K and L show cell invasion assays with bar graphs indicating cell numbers, highlighting changes between NC and si-NEU1 conditions.</alt-text>
</graphic></fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>In this study, we successfully constructed a predictive model of LIHC risk based on histone acetylation-related genes by integrating single-cell RNA sequencing data analysis, multivariate machine learning strategy, and experimental validation, and deeply elucidated the potential molecular mechanism of NEU1 in the development of LIHC.</p>
<p>The study firstly, at the level of single-cell analysis, investigated the precise classification and annotation of cell populations into subpopulations of B cells, endothelial cells, fibroblasts/mesenchymal stromal cells, hepatocytes, macrophages/monocytes, plasma cells, and T/NK cells. By comparing the gene expression profiles of each cell subpopulation in normal and LIHC tissues, differentially expressed genes were identified and cross-tabulated with RNA expression profiles and histone acetylation-related genes to accurately screen out the set of histone acetylation-related differentially expressed genes. Subsequently, 101 combinations of machine learning algorithms were applied to systematically evaluate these candidate genes, and a risk prediction model consisting of 11 key genes (HLA-B, HEXB, CDK4, ACAT1, NAA10, B2M, HSPD1, NPM1, PON1, NEU1, and CFB) was finally constructed. The model demonstrated excellent predictive performance with an average C-index of 0.785, the best among all 101 machine learning algorithms, and consistently high accuracy in both the training and validation sets, which was further confirmed by Kaplan-Meier survival analysis and ROC curve analysis. Particularly noteworthy is that the model was comprehensively validated for 10 different molecular subtypes of LIHC, and showed stable prognostic predictive ability in all subtypes, which fully demonstrated its broad applicability and robustness for clinical applications.</p>
<p>GO and KEGG enrichment analyses of the differential genes in this model indicated that the promotion of LIHC may be achieved through key pathways such as the Small-Molecule catabolic process and Xenobiotic metabolism. In a previous study, HuiSu et&#xa0;al. showed that the expression level of coagulation factor F11 was significantly correlated with the infiltration of related factors and drug sensitivity in the immune environment of hepatocellular carcinoma (<xref ref-type="bibr" rid="B34">34</xref>). In our study, it was found that the complement and coagulation cascade response pathways may be regulated by this model, which is consistent with the findings of previous studies and further confirms the complexity of immune regulation in the microenvironment of hepatocellular carcinoma. More studies have confirmed that the lipid metabolism pathway, mTOR signaling pathway, mitochondrial oxidative phosphorylation pathway, and extracellular matrix-associated pathway play important roles in the development of LIHC (<xref ref-type="bibr" rid="B35">35</xref>&#x2013;<xref ref-type="bibr" rid="B37">37</xref>).</p>
<p>Sun et&#xa0;al. showed that PA2G4 was associated with LIHC metastasis (<xref ref-type="bibr" rid="B38">38</xref>), and downregulation of ALDH2 expression level not only attenuated hepatic detoxification capacity but also significantly correlated with hepatic LIHC resistance to drugs and prognosis (<xref ref-type="bibr" rid="B39">39</xref>, <xref ref-type="bibr" rid="B40">40</xref>). In the present study, GSEA analysis showed that the model may have a strong regulatory effect on the above pathways, and the scores of the model were significantly correlated with the expression levels of the core genes of these pathways (ALDH2, ADH4, SERPING1, SMS, EIF2S2, PA2G4, ACAT1, TOP2A, CLTA, and F11), further confirmed that it may promote the progression of LIHC by regulating the expression levels of these core genes, which in turn activate/inactivate the relevant pathways.</p>
<p>To further investigate the value of the risk model in modulating immune infiltration, the study was subjected to immunoscape analysis. Immune cell correlation showed that activated memory CD4+ T cells were positively correlated with CD8+ T cells, suggesting adaptive immune synergy, while the negative correlation between Tfh and resting memory CD4+ T cells reflected the complex regulation among immune subpopulations. The model genes HLA-B and B2M were significantly correlated with the immunity score and ESTIMATEScore, consistent with their central role as MHC-I class I molecules in antigen presentation (<xref ref-type="bibr" rid="B41">41</xref>). Notably, high-risk scores were associated with higher tumor purity and lower immune/stroma scores, suggesting an &#x201c;immunosuppressed&#x201d; or &#x201c;immuno-depleted&#x201d; microenvironmental phenotype, which is usually indicative of poor prognosis (<xref ref-type="bibr" rid="B42">42</xref>). Further analysis confirmed that the risk score correlated with the level of multiple immune cell infiltration, immune checkpoint gene expression, and key chemokines/receptors, suggesting that the risk model is capable of capturing the complex changes in immune cell recruitment, localization, and potential functional status. To evaluate the potential of clinical application, the TIDE algorithm was used to predict immune checkpoint inhibitor (ICI) responses. The results showed that the high-risk group had lower predictive scores for treatments targeting CD274 (PD-L1) and PDCD1LG2 (PD-L2), suggesting that they may be better able to benefit from anti-PD-1/PD-L1/PD-L2 therapy (<xref ref-type="bibr" rid="B43">43</xref>).</p>
<p>Based on the GDSC2 database, the study analyzed the correlation between risk scores and sensitivity to 25 clinically used chemotherapeutic agents. Patients in the high-risk group showed higher sensitivity (lower IC50 values) to Axitinib, Paclitaxel, TelomeraseInhibitorIX, and Vinblastine, which are multi-targeted tyrosine kinase inhibitors that inhibit angiogenesis, while Paclitaxel and Vinblastine, which are microtubule inhibitors, may be more effective in high-risk tumors with high proliferative properties. as microtubule inhibitors, may be more effective in high-risk tumors with high proliferative properties. This is consistent with the poor prognosis of the high-risk group (<xref ref-type="bibr" rid="B44">44</xref>). On the contrary, the high-risk group showed potential resistance to a variety of drugs, including DNA-damaging drugs, topoisomerase inhibitors, targeted therapeutics, and PARP inhibitors. This resistance pattern may be related to altered DNA repair mechanisms or suppression of the immune microenvironment. Notably, resistance to the mTOR inhibitor Rapamycin in the high-risk group is consistent with the association of mTOR signaling pathway activation with poor prognosis in LIHC (<xref ref-type="bibr" rid="B45">45</xref>). Resistance to Entinostat may reflect disturbances in epigenetic regulation in high-risk tumors. These findings provide a basis for individualized drug selection based on risk scores.</p>
<p>TMB analysis significantly revealed that the high-risk group exhibited a higher tumor mutational load (TMB). The high TMB may stem from the functional deficiencies of DNA repair genes, which may also explain the resistance to DNA-damaging drugs in the high-risk group. The relevant gene mutations in the low-risk group may activate pathways that favor anti-tumor immunity, while the relevant gene mutations in the high-risk group may activate pathways that promote immune escape.</p>
<p>The synergistic role of ferroptosis and m6A methylation abnormalities in LIHC may be an important molecular basis for the poor prognosis of high-risk patients. For example, m6A modifications may affect the expression of key genes for ferroptosis, forming a complex regulatory network (<xref ref-type="bibr" rid="B46">46</xref>). In our study, we found that the risk model score was significantly correlated with the expression of most ferroptosis and m6A methylation-related genes, suggesting that it may play an important role in promoting the progression of LIHC through the regulation of ferroptosis and m6A methylation. However, the specific mechanism needs to be further explored.</p>
<p>Cell communication analysis is an analytical method to study how different cell types communicate and regulate each other through signaling molecules such as ligands and receptors. It is important in revealing the mechanisms of cellular interactions and understanding how tissues and organs function in a coordinated manner (<xref ref-type="bibr" rid="B47">47</xref>).</p>
<p>The cellular communication analysis in this study indicated that high NEU1 expression may promote the activation of multiple inflammatory factors and matrix remodeling in LIHC by enhancing SPP1-mediated communication between monocytes/macrophages and fibroblasts/mesenchymal stromal cells. This mechanism may be a key factor in the formation of the immunosuppressive microenvironment in LIHC.</p>
<p>Quantification of cell differentiation potential based on the CytoTRACE algorithm suggested that NEU1 may promote tumor neovascularization and progression by maintaining the low differentiation state of endothelial cells.Monocle3 algorithm proposed temporal sequential analysis revealed the differentiation pathway of endothelial cells along a specific direction, demonstrating a sequential process of the transformation of normal endothelial cells to LIHC endothelial cells, and the expression level of NEU1 The expression level of NEU1 was progressively up-regulated on this differentiation trajectory, suggesting that NEU1 may play a key driving role in the transformation of normal endothelial cells to malignant phenotype. This may be an important mechanism by which high expression of NEU1 contributes to the poor prognosis of LIHC patients. Future studies will focus on verifying the causal relationship between NEU1 in endothelial cell differentiation and malignant transformation and exploring its potential as an anti-angiogenic target. Meanwhile, abnormal endothelial cell differentiation may also provide new ideas for early diagnosis and prognosis of LIHC.</p>
<p>Our study identifies NEU1 as a pivotal node linking sialometabolism to histone acetylation. As a lysosomal sialidase, NEU1 hydrolysis of sialoglycoconjugates modulates cellular pools of free sialic acid and UDP-GlcNAc, which are precursors for nucleotide sugar biosynthesis (<xref ref-type="bibr" rid="B48">48</xref>). This process indirectly regulates the availability of acetyl-CoA&#x2014;a central metabolite and essential cofactor for histone acetyltransferases (HATs). The observed NEU1-driven activation of histone acetylation-related pathways (e.g., NOTCH, VEGF) may thus stem from its ability to fuel epigenetic machinery via metabolic rewiring. Notably, the NEU1 inhibitor Oseltamivir (identified by molecular docking) has been repurposed for cancer therapy in recent studies targeting sialylation-dependent immune evasion (<xref ref-type="bibr" rid="B49">49</xref>). This further underscores NEU1&#x2019;s druggability in modulating the epigenetic landscape of LIHC.</p>
<p>To further corroborate the value of the histone acetylation-related risk model in LIHC, we first validated the expression of 11 genes in the risk model in LIHC clinical samples using qRT-PCR experiments and the expression of NEU1 using WB experiments. The results showed that, consistent with our previous analysis, six genes, including NEU1, were up-regulated and ACAT1 and PON1 were down-regulated in LIHC tissues. Compared with normal tissues, there was no difference in the expression of CDK4 and HSPD1 in LIHC tissues, which might be the reason that the sample size was too small, and we will further expand the sample size for validation in the follow-up study. We performed relevant experiments <italic>in vitro</italic> and <italic>in vivo</italic> to clarify the role of NEU1 in LIHC progression, respectively. The proliferation, invasion, and migration of Hep3B and MHCC-97H cells were attenuated after NEU1 knockdown. These results confirmed the promotional role of NEU1 as a key factor in histone acetylation-associated risk models for LIHC development.</p>
<p>This study clarifies the important role of the histone acetylation-associated risk model in LIHC based on multi-omics data, clinical samples, and experiments, which has the potential to become yet another novel diagnostic and prognostic model, providing a new target for precision treatment of LIHC.</p>
<p>Despite the progress of our study, there are still some shortcomings, such as the downstream molecules and signaling pathways of the risk model are not fully understood, and more experimental basis is needed for the regulatory role of NEU1 on LIHC progression. We will explore this more deeply in subsequent studies.</p>
</sec>
</body>
<back>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/<xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Material</bold></xref>.</p></sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The studies involving humans were approved by The Second Affiliated Hospital of Xi&#x2019;an Jiaotong University. The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study. The animal study was approved by The Second Affiliated Hospital of Xi&#x2019;an Jiaotong University. The study was conducted in accordance with the local legislation and institutional requirements.</p></sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>YQ: Data curation, Software, Writing &#x2013; original draft. FW: Data curation, Investigation, Writing &#x2013; original draft. WR: Data curation, Methodology, Writing &#x2013; original draft. CC: Investigation, Visualization, Writing &#x2013; original draft. YZ: Validation, Writing &#x2013; original draft. PZ: Investigation, Validation, Writing &#x2013; original draft. PH: Project administration, Writing &#x2013; review &amp; editing. QW: Conceptualization, Funding acquisition, Writing &#x2013; review &amp; editing.</p></sec>
<ack>
<title>Acknowledgments</title>
<p>We thank all individuals who participated in this research.</p>
</ack>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p></sec>
<sec id="s10" sec-type="ai-statement">
<title>Generative AI statement</title>
<p>The author(s) declared that Generative AI was not used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p></sec>
<sec id="s11" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p></sec>
<sec id="s12" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fimmu.2026.1624883/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fimmu.2026.1624883/full#supplementary-material</ext-link></p>
<supplementary-material xlink:href="Image1.jpg" id="SF1" mimetype="image/jpeg"><label>Supplementary Figure&#xa0;1</label>
<caption>
<p>Basis for cell type annotation.</p>
</caption></supplementary-material>
<supplementary-material xlink:href="Image2.jpg" id="SF2" mimetype="image/jpeg"><label>Supplementary Figure&#xa0;2</label>
<caption>
<p>Expression of 11 genes in the histone acetylation-related risk model in TCGA-LIHC.</p>
</caption></supplementary-material>
<supplementary-material xlink:href="Image3.jpg" id="SF3" mimetype="image/jpeg"><label>Supplementary Figure&#xa0;3</label>
<caption>
<p>Prognostic value of 11 genes in the histone acetylation-related risk model in TCGA-LIHC <bold>(A)</bold> ACAT1; <bold>(B)</bold> B2M; <bold>(C)</bold> CDK4; <bold>(D)</bold> CFB; <bold>(E)</bold> HEXB; <bold>(F)</bold> HLA &#x2013; B; <bold>(G)</bold> HSPD1; <bold>(H)</bold> NAA10; <bold>(I)</bold> NEU1; <bold>(J)</bold> NPM1; <bold>(K)</bold> PON1.</p>
</caption></supplementary-material>
<supplementary-material xlink:href="Image4.tif" id="SF4" mimetype="image/tiff"><label>Supplementary Figure&#xa0;4</label>
<caption>
<p>Independent validation of the model and AUC assessment <bold>(A, B)</bold> Independent validation of the model in OEP000321 cohort; <bold>(C, E)</bold> AUC assessment.</p>
</caption></supplementary-material>
<supplementary-material xlink:href="Image5.jpeg" id="SF5" mimetype="image/jpeg"><label>Supplementary Figure&#xa0;5</label>
<caption>
<p>Prognostic performance of the risk signature in the ICGC-LIRI-JP validation cohort and its clinical subgroups. Kaplan-Meier curves for Overall Survival (OS) are shown for low-risk versus high risk patients in the entire cohort and within subgroups stratified by different clinical variables. P-values were determined using the log-rank test. The analyses are shown for <bold>(A)</bold> the entire cohort, and for subgroups based on: <bold>(B)</bold> Age &gt; median, <bold>(C)</bold> Age &#x2264; median, <bold>(D)</bold> Male patients, <bold>(E)</bold> Female patients, <bold>(F)</bold> HBV-infected patients, <bold>(G)</bold> HCV- infected patients, (1166 <bold>(H)</bold>) TNM stage I-II, <bold>(I)</bold> TNM stage III-IV, <bold>(J)</bold> Fibrosis stage F0-F2, and <bold>(K)</bold> Fibrosis stage F3-F4.</p>
</caption></supplementary-material>
<supplementary-material xlink:href="Image6.jpeg" id="SF6" mimetype="image/jpeg"><label>Supplementary Figure&#xa0;6</label>
<caption>
<p>Prognostic performance of the risk signature in the entire GSE124751 Ncohort and within clinical subgroups. Kaplan-Meier curves comparing Overall Survival (OS) and Disease-Free Survival (DFS) between the high-risk and low-risk groups. Analyses were performed for the entire cohort and for subgroups stratified by age (cutoff at 60 years) and Tumor Mutational Burden (TMB, cutoff at the median). P-values were calculated using the log-rank test. Overall Survival analysis in <bold>(A)</bold> the entire cohort, and in subgroups stratified by <bold>(B)</bold> Age &gt; 60, <bold>(C)</bold> Age &#x2264; 60, <bold>(D)</bold> High TMB, and <bold>(E)</bold> Low TMB. Disease-Free Survival analysis in <bold>(F)</bold> the entire cohort, and in subgroups stratified by <bold>(G)</bold> Age &gt; 60, <bold>(H)</bold> Age &#x2264; 60, <bold>(I)</bold> High TMB, and <bold>(J)</bold> Low TMB.</p>
</caption></supplementary-material>
<supplementary-material xlink:href="Image7.jpeg" id="SF7" mimetype="image/jpeg"><label>Supplementary Figure&#xa0;7</label>
<caption>
<p>Comparative analysis of the mutational landscape across three key hepatocellular carcinoma (HCC) cohorts from cBioPortal. The molecular profiles of the primary TCGA-LIHC cohort were compared with two independent cohorts (MSK 2024, CLCA 2024) to assess molecular heterogeneity. <bold>(A)</bold> An Oncoprint visualizing specific alterations in a panel of key genes (including HLA-B, NEU1, and CDK4) for individual patients within each cohort. Each column represents a patient, and each row a gene. Colors denote the type of alteration. <bold>(B)</bold> A stacked bar plot summarizing the frequency of major alteration types (e.g., amplification, deep deletion, mutation) across the three cohorts, highlighting the dominant genomic alteration in each study. <bold>(C)</bold> Boxplot showing the distribution of mutation counts corresponding to different Copy Number Alteration (CNA) types (e.g., amplification, gain, diploid, shallow deletion) for the NEU1 gene in the MSK-IMPACT cohort.</p>
</caption></supplementary-material>
<supplementary-material xlink:href="Image8.jpg" id="SF8" mimetype="image/jpeg"><label>Supplementary Figure&#xa0;8</label>
<caption>
<p>Clinical sample validation of CDK4 and HSDP1 mRNA expression levels.</p>
</caption></supplementary-material>
<supplementary-material xlink:href="Table1.csv" id="SM1" mimetype="text/csv"/>
<supplementary-material xlink:href="Table2.csv" id="SM2" mimetype="text/csv"/>
<supplementary-material xlink:href="Table3.xlsx" id="SM3" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"/></sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Bray</surname> <given-names>F</given-names></name>
<name><surname>Laversanne</surname> <given-names>M</given-names></name>
<name><surname>Sung</surname> <given-names>H</given-names></name>
<name><surname>Ferlay</surname> <given-names>J</given-names></name>
<name><surname>Siegel</surname> <given-names>RL</given-names></name>
<name><surname>Soerjomataram</surname> <given-names>I</given-names></name>
<etal/>
</person-group>. 
<article-title>Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries</article-title>. <source>CA Cancer J Clin</source>. (<year>2024</year>) <volume>74</volume>:<page-range>229&#x2013;63</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.3322/caac.21834</pub-id>, PMID: <pub-id pub-id-type="pmid">38572751</pub-id>
</mixed-citation>
</ref>
<ref id="B2">
<label>2</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Peng</surname> <given-names>Z</given-names></name>
<name><surname>Fan</surname> <given-names>W</given-names></name>
<name><surname>Zhu</surname> <given-names>B</given-names></name>
<name><surname>Wang</surname> <given-names>G</given-names></name>
<name><surname>Sun</surname> <given-names>J</given-names></name>
<name><surname>Xiao</surname> <given-names>C</given-names></name>
<etal/>
</person-group>. 
<article-title>Lenvatinib combined with transarterial chemoembolization as first-line treatment for advanced hepatocellular carcinoma: A phase III, randomized clinical trial (LAUNCH)</article-title>. <source>J Clin Oncol</source>. (<year>2023</year>) <volume>41</volume>:<page-range>117&#x2013;27</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1200/JCO.22.00392</pub-id>, PMID: <pub-id pub-id-type="pmid">35921605</pub-id>
</mixed-citation>
</ref>
<ref id="B3">
<label>3</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Zhang</surname> <given-names>Y</given-names></name>
<name><surname>Huang</surname> <given-names>G</given-names></name>
<name><surname>Wang</surname> <given-names>Y</given-names></name>
<name><surname>Liang</surname> <given-names>L</given-names></name>
<name><surname>Peng</surname> <given-names>B</given-names></name>
<name><surname>Fan</surname> <given-names>W</given-names></name>
<etal/>
</person-group>. 
<article-title>Is salvage liver resection necessary for initially unresectable hepatocellular carcinoma patients downstaged by transarterial chemoembolization? Ten years of experience</article-title>. <source>Oncologist</source>. (<year>2016</year>) <volume>21</volume>:<page-range>1442&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1634/theoncologist.2016-0094</pub-id>, PMID: <pub-id pub-id-type="pmid">27486202</pub-id>
</mixed-citation>
</ref>
<ref id="B4">
<label>4</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Bruix</surname> <given-names>J</given-names></name>
<name><surname>Qin</surname> <given-names>S</given-names></name>
<name><surname>Merle</surname> <given-names>P</given-names></name>
<name><surname>Granito</surname> <given-names>A</given-names></name>
<name><surname>Huang</surname> <given-names>YH</given-names></name>
<name><surname>Bodoky</surname> <given-names>G</given-names></name>
<etal/>
</person-group>. 
<article-title>Regorafenib for patients with hepatocellular carcinoma who progressed on sorafenib treatment (RESORCE): a randomised, double-blind, placebo-controlled, phase 3 trial</article-title>. <source>Lancet</source>. (<year>2017</year>) <volume>389</volume>:<fpage>56</fpage>&#x2013;<lpage>66</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0140-6736(16)32453-9</pub-id>, PMID: <pub-id pub-id-type="pmid">27932229</pub-id>
</mixed-citation>
</ref>
<ref id="B5">
<label>5</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Lok</surname> <given-names>AS</given-names></name>
<name><surname>Sterling</surname> <given-names>RK</given-names></name>
<name><surname>Everhart</surname> <given-names>JE</given-names></name>
<name><surname>Wright</surname> <given-names>EC</given-names></name>
<name><surname>Hoefs</surname> <given-names>JC</given-names></name>
<name><surname>Di Bisceglie</surname> <given-names>AM</given-names></name>
<etal/>
</person-group>. 
<article-title>Des-gamma-carboxy prothrombin and alpha-fetoprotein as biomarkers for the early detection of hepatocellular carcinoma</article-title>. <source>Gastroenterology</source>. (<year>2010</year>) <volume>138</volume>:<fpage>493</fpage>&#x2013;<lpage>502</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1053/j.gastro.2009.10.031</pub-id>, PMID: <pub-id pub-id-type="pmid">19852963</pub-id>
</mixed-citation>
</ref>
<ref id="B6">
<label>6</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Lu</surname> <given-names>Y</given-names></name>
<name><surname>Yang</surname> <given-names>A</given-names></name>
<name><surname>Quan</surname> <given-names>C</given-names></name>
<name><surname>Pan</surname> <given-names>Y</given-names></name>
<name><surname>Zhang</surname> <given-names>H</given-names></name>
<name><surname>Li</surname> <given-names>Y</given-names></name>
<etal/>
</person-group>. 
<article-title>A single-cell atlas of the multicellular ecosystem of primary and metastatic hepatocellular carcinoma</article-title>. <source>Nat Commun</source>. (<year>2022</year>) <volume>13</volume>:<fpage>4594</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-022-32283-3</pub-id>, PMID: <pub-id pub-id-type="pmid">35933472</pub-id>
</mixed-citation>
</ref>
<ref id="B7">
<label>7</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Meng</surname> <given-names>Y</given-names></name>
<name><surname>Zhao</surname> <given-names>Q</given-names></name>
<name><surname>An</surname> <given-names>L</given-names></name>
<name><surname>Jiao</surname> <given-names>S</given-names></name>
<name><surname>Li</surname> <given-names>R</given-names></name>
<name><surname>Sang</surname> <given-names>Y</given-names></name>
<etal/>
</person-group>. 
<article-title>A TNFR2-hnRNPK axis promotes primary liver cancer development via activation of YAP signaling in hepatic progenitor cells</article-title>. <source>Cancer Res</source>. (<year>2021</year>) <volume>81</volume>:<page-range>3036&#x2013;50</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/0008-5472.CAN-20-3175</pub-id>, PMID: <pub-id pub-id-type="pmid">33619115</pub-id>
</mixed-citation>
</ref>
<ref id="B8">
<label>8</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Hao</surname> <given-names>Y</given-names></name>
<name><surname>Stuart</surname> <given-names>T</given-names></name>
<name><surname>Kowalski</surname> <given-names>MH</given-names></name>
<name><surname>Choudhary</surname> <given-names>S</given-names></name>
<name><surname>Hoffman</surname> <given-names>P</given-names></name>
<name><surname>Hartman</surname> <given-names>A</given-names></name>
<etal/>
</person-group>. 
<article-title>Dictionary learning for integrative, multimodal and scalable single-cell analysis</article-title>. <source>Nat Biotechnol</source>. (<year>2024</year>) <volume>42</volume>:<fpage>293</fpage>&#x2013;<lpage>304</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41587-023-01767-y</pub-id>, PMID: <pub-id pub-id-type="pmid">37231261</pub-id>
</mixed-citation>
</ref>
<ref id="B9">
<label>9</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Ritchie</surname> <given-names>ME</given-names></name>
<name><surname>Phipson</surname> <given-names>B</given-names></name>
<name><surname>Wu</surname> <given-names>D</given-names></name>
<name><surname>Hu</surname> <given-names>Y</given-names></name>
<name><surname>Law</surname> <given-names>CW</given-names></name>
<name><surname>Shi</surname> <given-names>W</given-names></name>
<etal/>
</person-group>. 
<article-title>limma powers differential expression analyses for RNA-sequencing and microarray studies</article-title>. <source>Nucleic Acids Res</source>. (<year>2015</year>) <volume>43</volume>:<fpage>e47</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkv007</pub-id>, PMID: <pub-id pub-id-type="pmid">25605792</pub-id>
</mixed-citation>
</ref>
<ref id="B10">
<label>10</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Cao</surname> <given-names>J</given-names></name>
<name><surname>Yan</surname> <given-names>Q</given-names></name>
</person-group>. 
<article-title>Cancer epigenetics, tumor immunity, and immunotherapy</article-title>. <source>Trends Cancer</source>. (<year>2020</year>) <volume>6</volume>:<page-range>580&#x2013;92</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.trecan.2020.02.003</pub-id>, PMID: <pub-id pub-id-type="pmid">32610068</pub-id>
</mixed-citation>
</ref>
<ref id="B11">
<label>11</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Yuan</surname> <given-names>X</given-names></name>
<name><surname>Rosen</surname> <given-names>JM</given-names></name>
</person-group>. 
<article-title>Histone acetylation modulators in breast cancer</article-title>. <source>Breast Cancer Res</source>. (<year>2025</year>) <volume>27</volume>:<fpage>49</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s13058-025-02006-9</pub-id>, PMID: <pub-id pub-id-type="pmid">40165290</pub-id>
</mixed-citation>
</ref>
<ref id="B12">
<label>12</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Suraweera</surname> <given-names>A</given-names></name>
<name><surname>O'Byrne</surname> <given-names>KJ</given-names></name>
<name><surname>Richard</surname> <given-names>DJ</given-names></name>
</person-group>. 
<article-title>Epigenetic drugs in cancer therapy</article-title>. <source>Cancer Metastasis Rev</source>. (<year>2025</year>) <volume>44</volume>:<fpage>37</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10555-025-10253-7</pub-id>, PMID: <pub-id pub-id-type="pmid">40011240</pub-id>
</mixed-citation>
</ref>
<ref id="B13">
<label>13</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Kim</surname> <given-names>JJ</given-names></name>
<name><surname>Lee</surname> <given-names>SY</given-names></name>
<name><surname>Choi</surname> <given-names>JH</given-names></name>
<name><surname>Woo</surname> <given-names>HG</given-names></name>
<name><surname>Xhemalce</surname> <given-names>B</given-names></name>
<name><surname>Miller</surname> <given-names>KM</given-names></name>
<etal/>
</person-group>. 
<article-title>PCAF-mediated histone acetylation promotes replication fork degradation by MRE11 and EXO1 in BRCA-deficient cells</article-title>. <source>Mol Cell</source>. (<year>2020</year>) <volume>80</volume>:<fpage>327</fpage>&#x2013;<lpage>344.e8</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.molcel.2020.08.018</pub-id>, PMID: <pub-id pub-id-type="pmid">32966758</pub-id>
</mixed-citation>
</ref>
<ref id="B14">
<label>14</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Chen</surname> <given-names>P</given-names></name>
<name><surname>Hsu</surname> <given-names>WH</given-names></name>
<name><surname>Chang</surname> <given-names>A</given-names></name>
<name><surname>Tan</surname> <given-names>Z</given-names></name>
<name><surname>Lan</surname> <given-names>Z</given-names></name>
<name><surname>Zhou</surname> <given-names>A</given-names></name>
<etal/>
</person-group>. 
<article-title>Circadian regulator CLOCK recruits immune-suppressive microglia into the GBM tumor microenvironment</article-title>. <source>Cancer Discov</source>. (<year>2020</year>) <volume>10</volume>:<page-range>371&#x2013;81</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/2159-8290.CD-19-0400</pub-id>, PMID: <pub-id pub-id-type="pmid">31919052</pub-id>
</mixed-citation>
</ref>
<ref id="B15">
<label>15</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Guo</surname> <given-names>X</given-names></name>
<name><surname>Huang</surname> <given-names>G</given-names></name>
<name><surname>Qiu</surname> <given-names>D</given-names></name>
<name><surname>He</surname> <given-names>H</given-names></name>
<name><surname>Niu</surname> <given-names>X</given-names></name>
<name><surname>Guo</surname> <given-names>Z</given-names></name>
<etal/>
</person-group>. 
<article-title>RPS6KA1 is a histone acetylation-related oncoprotein in acute myeloid leukemia which is targeted by afzelin</article-title>. <source>BMC Cancer</source>. (<year>2024</year>) <volume>24</volume>:<fpage>1189</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12885-024-12886-3</pub-id>, PMID: <pub-id pub-id-type="pmid">39333927</pub-id>
</mixed-citation>
</ref>
<ref id="B16">
<label>16</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Liu</surname> <given-names>H</given-names></name>
<name><surname>Zhang</surname> <given-names>W</given-names></name>
<name><surname>Zhang</surname> <given-names>Y</given-names></name>
<name><surname>Adegboro</surname> <given-names>AA</given-names></name>
<name><surname>Fasoranti</surname> <given-names>DO</given-names></name>
<name><surname>Dai</surname> <given-names>L</given-names></name>
<etal/>
</person-group>. 
<article-title>Mime: A flexible machine-learning framework to construct and visualize models for clinical characteristics prediction and feature selection</article-title>. <source>Comput Struct Biotechnol J</source>. (<year>2024</year>) <volume>23</volume>:<page-range>2798&#x2013;810</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.csbj.2024.06.035</pub-id>, PMID: <pub-id pub-id-type="pmid">39055398</pub-id>
</mixed-citation>
</ref>
<ref id="B17">
<label>17</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Blanche</surname> <given-names>P</given-names></name>
<name><surname>Dartigues</surname> <given-names>JF</given-names></name>
<name><surname>Jacqmin-Gadda</surname> <given-names>H</given-names></name>
</person-group>. 
<article-title>Estimating and comparing time-dependent areas under receiver operating characteristic curves for censored event times with competing risks</article-title>. <source>Stat Med</source>. (<year>2013</year>) <volume>32</volume>:<page-range>5381&#x2013;97</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/sim.5958</pub-id>, PMID: <pub-id pub-id-type="pmid">24027076</pub-id>
</mixed-citation>
</ref>
<ref id="B18">
<label>18</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Robin</surname> <given-names>X</given-names></name>
<name><surname>Turck</surname> <given-names>N</given-names></name>
<name><surname>Hainard</surname> <given-names>A</given-names></name>
<name><surname>Tiberti</surname> <given-names>N</given-names></name>
<name><surname>Lisacek</surname> <given-names>F</given-names></name>
<name><surname>Sanchez</surname> <given-names>JC</given-names></name>
<etal/>
</person-group>. 
<article-title>pROC: an open-source package for R and S+ to analyze and compare ROC curves</article-title>. <source>BMC Bioinf</source>. (<year>2011</year>) <volume>12</volume>:<fpage>77</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1471-2105-12-77</pub-id>, PMID: <pub-id pub-id-type="pmid">21414208</pub-id>
</mixed-citation>
</ref>
<ref id="B19">
<label>19</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Wu</surname> <given-names>T</given-names></name>
<name><surname>Hu</surname> <given-names>E</given-names></name>
<name><surname>Xu</surname> <given-names>S</given-names></name>
<name><surname>Chen</surname> <given-names>M</given-names></name>
<name><surname>Guo</surname> <given-names>P</given-names></name>
<name><surname>Dai</surname> <given-names>Z</given-names></name>
<etal/>
</person-group>. 
<article-title>clusterProfiler 4.0: A universal enrichment tool for interpreting omics data</article-title>. <source>Innovation (Camb)</source>. (<year>2021</year>) <volume>2</volume>:<fpage>100141</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.xinn.2021.100141</pub-id>, PMID: <pub-id pub-id-type="pmid">34557778</pub-id>
</mixed-citation>
</ref>
<ref id="B20">
<label>20</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Becht</surname> <given-names>E</given-names></name>
<name><surname>Giraldo</surname> <given-names>NA</given-names></name>
<name><surname>Lacroix</surname> <given-names>L</given-names></name>
<name><surname>Buttard</surname> <given-names>B</given-names></name>
<name><surname>Elarouci</surname> <given-names>N</given-names></name>
<name><surname>Petitprez</surname> <given-names>F</given-names></name>
<etal/>
</person-group>. 
<article-title>Estimating the population abundance of tissue-infiltrating immune and stromal cell populations using gene expression</article-title>. <source>Genome Biol</source>. (<year>2016</year>) <volume>17</volume>:<fpage>218</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s13059-016-1070-5</pub-id>, PMID: <pub-id pub-id-type="pmid">27765066</pub-id>
</mixed-citation>
</ref>
<ref id="B21">
<label>21</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Newman</surname> <given-names>AM</given-names></name>
<name><surname>Liu</surname> <given-names>CL</given-names></name>
<name><surname>Green</surname> <given-names>MR</given-names></name>
<name><surname>Gentles</surname> <given-names>AJ</given-names></name>
<name><surname>Feng</surname> <given-names>W</given-names></name>
<name><surname>Xu</surname> <given-names>Y</given-names></name>
<etal/>
</person-group>. 
<article-title>Robust enumeration of cell subsets from tissue expression profiles</article-title>. <source>Nat Methods</source>. (<year>2015</year>) <volume>12</volume>:<page-range>453&#x2013;7</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nmeth.3337</pub-id>, PMID: <pub-id pub-id-type="pmid">25822800</pub-id>
</mixed-citation>
</ref>
<ref id="B22">
<label>22</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Aran</surname> <given-names>D</given-names></name>
<name><surname>Hu</surname> <given-names>Z</given-names></name>
<name><surname>Butte</surname> <given-names>AJ</given-names></name>
</person-group>. 
<article-title>xCell: digitally portraying the tissue cellular heterogeneity landscape</article-title>. <source>Genome Biol</source>. (<year>2017</year>) <volume>18</volume>:<fpage>220</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s13059-017-1349-1</pub-id>, PMID: <pub-id pub-id-type="pmid">29141660</pub-id>
</mixed-citation>
</ref>
<ref id="B23">
<label>23</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Maeser</surname> <given-names>D</given-names></name>
<name><surname>Gruener</surname> <given-names>RF</given-names></name>
<name><surname>Huang</surname> <given-names>RS</given-names></name>
</person-group>. 
<article-title>oncoPredict: an R package for predicting <italic>in vivo</italic> or cancer patient drug response and biomarkers from cell line screening data</article-title>. <source>Brief Bioinform</source>. (<year>2021</year>) <volume>22</volume>:<fpage>bbab260</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/bib/bbab260</pub-id>, PMID: <pub-id pub-id-type="pmid">34260682</pub-id>
</mixed-citation>
</ref>
<ref id="B24">
<label>24</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Mayakonda</surname> <given-names>A</given-names></name>
<name><surname>Lin</surname> <given-names>DC</given-names></name>
<name><surname>Assenov</surname> <given-names>Y</given-names></name>
<name><surname>Plass</surname> <given-names>C</given-names></name>
<name><surname>Koeffler</surname> <given-names>HP</given-names></name>
</person-group>. 
<article-title>Maftools: efficient and comprehensive analysis of somatic variants in cancer</article-title>. <source>Genome Res</source>. (<year>2018</year>) <volume>28</volume>:<page-range>1747&#x2013;56</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1101/gr.239244.118</pub-id>, PMID: <pub-id pub-id-type="pmid">30341162</pub-id>
</mixed-citation>
</ref>
<ref id="B25">
<label>25</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Liu</surname> <given-names>Z</given-names></name>
<name><surname>Zhao</surname> <given-names>Q</given-names></name>
<name><surname>Zuo</surname> <given-names>ZX</given-names></name>
<name><surname>Yuan</surname> <given-names>SQ</given-names></name>
<name><surname>Yu</surname> <given-names>K</given-names></name>
<name><surname>Zhang</surname> <given-names>Q</given-names></name>
<etal/>
</person-group>. 
<article-title>Systematic analysis of the aberrances and functional implications of ferroptosis in cancer</article-title>. <source>iScience</source>. (<year>2020</year>) <volume>23</volume>:<fpage>101302</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.isci.2020.101302</pub-id>, PMID: <pub-id pub-id-type="pmid">32629423</pub-id>
</mixed-citation>
</ref>
<ref id="B26">
<label>26</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Li</surname> <given-names>Z</given-names></name>
<name><surname>Li</surname> <given-names>Y</given-names></name>
<name><surname>Shen</surname> <given-names>L</given-names></name>
<name><surname>Shen</surname> <given-names>L</given-names></name>
<name><surname>Li</surname> <given-names>N</given-names></name>
</person-group>. 
<article-title>Molecular characterization, clinical relevance and immune feature of m7G regulator genes across 33 cancer types</article-title>. <source>Front Genet</source>. (<year>2022</year>) <volume>13</volume>:<elocation-id>981567</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fgene.2022.981567</pub-id>, PMID: <pub-id pub-id-type="pmid">36092891</pub-id>
</mixed-citation>
</ref>
<ref id="B27">
<label>27</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Jin</surname> <given-names>S</given-names></name>
<name><surname>Guerrero-Juarez</surname> <given-names>CF</given-names></name>
<name><surname>Zhang</surname> <given-names>L</given-names></name>
<name><surname>Chang</surname> <given-names>I</given-names></name>
<name><surname>Ramos</surname> <given-names>R</given-names></name>
<name><surname>Kuan</surname> <given-names>CH</given-names></name>
<etal/>
</person-group>. 
<article-title>Inference and analysis of cell-cell communication using CellChat</article-title>. <source>Nat Commun</source>. (<year>2021</year>) <volume>12</volume>:<fpage>1088</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-021-21246-9</pub-id>, PMID: <pub-id pub-id-type="pmid">33597522</pub-id>
</mixed-citation>
</ref>
<ref id="B28">
<label>28</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Gulati</surname> <given-names>GS</given-names></name>
<name><surname>Sikandar</surname> <given-names>SS</given-names></name>
<name><surname>Wesche</surname> <given-names>DJ</given-names></name>
<name><surname>Manjunath</surname> <given-names>A</given-names></name>
<name><surname>Bharadwaj</surname> <given-names>A</given-names></name>
<name><surname>Berger</surname> <given-names>MJ</given-names></name>
<etal/>
</person-group>. 
<article-title>Single-cell transcriptional diversity is a hallmark of developmental potential</article-title>. <source>Science</source>. (<year>2020</year>) <volume>367</volume>:<page-range>405&#x2013;11</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/science.aax0249</pub-id>, PMID: <pub-id pub-id-type="pmid">31974247</pub-id>
</mixed-citation>
</ref>
<ref id="B29">
<label>29</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Qiu</surname> <given-names>X</given-names></name>
<name><surname>Hill</surname> <given-names>A</given-names></name>
<name><surname>Packer</surname> <given-names>J</given-names></name>
<name><surname>Lin</surname> <given-names>D</given-names></name>
<name><surname>Ma</surname> <given-names>YA</given-names></name>
<name><surname>Trapnell</surname> <given-names>C</given-names></name>
<etal/>
</person-group>. 
<article-title>Single-cell mRNA quantification and differential analysis with Census</article-title>. <source>Nat Methods</source>. (<year>2017</year>) <volume>14</volume>:<page-range>309&#x2013;15</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nmeth.4150</pub-id>, PMID: <pub-id pub-id-type="pmid">28114287</pub-id>
</mixed-citation>
</ref>
<ref id="B30">
<label>30</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Liu</surname> <given-names>Y</given-names></name>
<name><surname>Cao</surname> <given-names>Y</given-names></name>
</person-group>. 
<article-title>Protein-ligand blind docking using CB-dock2</article-title>. <source>Methods Mol Biol</source>. (<year>2024</year>) <volume>2714</volume>:<page-range>113&#x2013;25</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/978-1-0716-3441-7_6</pub-id>, PMID: <pub-id pub-id-type="pmid">37676595</pub-id>
</mixed-citation>
</ref>
<ref id="B31">
<label>31</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Yang</surname> <given-names>X</given-names></name>
<name><surname>Liu</surname> <given-names>Y</given-names></name>
<name><surname>Gan</surname> <given-names>J</given-names></name>
<name><surname>Xiao</surname> <given-names>ZX</given-names></name>
<name><surname>Cao</surname> <given-names>Y</given-names></name>
</person-group>. 
<article-title>FitDock: protein-ligand docking by template fitting</article-title>. <source>Brief Bioinform</source>. (<year>2022</year>) <volume>23</volume>:<fpage>bbac087</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/bib/bbac087</pub-id>, PMID: <pub-id pub-id-type="pmid">35289358</pub-id>
</mixed-citation>
</ref>
<ref id="B32">
<label>32</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Su</surname> <given-names>H</given-names></name>
<name><surname>Chen</surname> <given-names>Y</given-names></name>
<name><surname>Wang</surname> <given-names>W</given-names></name>
</person-group>. 
<article-title>Novel prognostic model of complement and coagulation cascade-related genes correlates with immune environment and drug sensitivity in hepatocellular carcinoma</article-title>. <source>Heliyon</source>. (<year>2024</year>) <volume>10</volume>:<fpage>e38230</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.heliyon.2024.e38230</pub-id>, PMID: <pub-id pub-id-type="pmid">39391504</pub-id>
</mixed-citation>
</ref>
<ref id="B33">
<label>33</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Liu</surname> <given-names>Q</given-names></name>
<name><surname>Zhang</surname> <given-names>X</given-names></name>
<name><surname>Qi</surname> <given-names>J</given-names></name>
<name><surname>Tian</surname> <given-names>X</given-names></name>
<name><surname>Dovjak</surname> <given-names>E</given-names></name>
<name><surname>Zhang</surname> <given-names>J</given-names></name>
<etal/>
</person-group>. 
<article-title>Comprehensive profiling of lipid metabolic reprogramming expands precision medicine for LIHC</article-title>. <source>Hepatology</source>. (<year>2025</year>) <volume>81</volume>:<page-range>1164&#x2013;80</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1097/HEP.0000000000000962</pub-id>, PMID: <pub-id pub-id-type="pmid">38899975</pub-id>
</mixed-citation>
</ref>
<ref id="B34">
<label>34</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Guri</surname> <given-names>Y</given-names></name>
<name><surname>Colombi</surname> <given-names>M</given-names></name>
<name><surname>Dazert</surname> <given-names>E</given-names></name>
<name><surname>Hindupur</surname> <given-names>SK</given-names></name>
<name><surname>Roszik</surname> <given-names>J</given-names></name>
<name><surname>Moes</surname> <given-names>S</given-names></name>
<etal/>
</person-group>. 
<article-title>mTORC2 promotes tumorigenesis via lipid synthesis</article-title>. <source>Cancer Cell</source>. (<year>2017</year>) <volume>32</volume>:<fpage>807</fpage>&#x2013;<lpage>823.e12</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ccell.2017.11.011</pub-id>, PMID: <pub-id pub-id-type="pmid">29232555</pub-id>
</mixed-citation>
</ref>
<ref id="B35">
<label>35</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Kudo</surname> <given-names>Y</given-names></name>
<name><surname>Sugimoto</surname> <given-names>M</given-names></name>
<name><surname>Arias</surname> <given-names>E</given-names></name>
<name><surname>Kasashima</surname> <given-names>H</given-names></name>
<name><surname>Cordes</surname> <given-names>T</given-names></name>
<name><surname>Linares</surname> <given-names>JF</given-names></name>
<etal/>
</person-group>. 
<article-title>PKC&#x3bb;/&#x3b9; Loss induces autophagy, oxidative phosphorylation, and NRF2 to promote liver cancer progression</article-title>. <source>Cancer Cell</source>. (<year>2020</year>) <volume>38</volume>:<fpage>247</fpage>&#x2013;<lpage>262.e11</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ccell.2020.05.018</pub-id>, PMID: <pub-id pub-id-type="pmid">32589943</pub-id>
</mixed-citation>
</ref>
<ref id="B36">
<label>36</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Sun</surname> <given-names>S</given-names></name>
<name><surname>Liu</surname> <given-names>Y</given-names></name>
<name><surname>Zhou</surname> <given-names>M</given-names></name>
<name><surname>Wen</surname> <given-names>J</given-names></name>
<name><surname>Xue</surname> <given-names>L</given-names></name>
<name><surname>Han</surname> <given-names>S</given-names></name>
<etal/>
</person-group>. 
<article-title>PA2G4 promotes the metastasis of hepatocellular carcinoma by stabilizing FYN mRNA in a YTHDF2-dependent manner</article-title>. <source>Cell Biosci</source>. (<year>2022</year>) <volume>12</volume>:<fpage>55</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s13578-022-00788-5</pub-id>, PMID: <pub-id pub-id-type="pmid">35526051</pub-id>
</mixed-citation>
</ref>
<ref id="B37">
<label>37</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Seo</surname> <given-names>W</given-names></name>
<name><surname>Gao</surname> <given-names>Y</given-names></name>
<name><surname>He</surname> <given-names>Y</given-names></name>
<name><surname>Sun</surname> <given-names>J</given-names></name>
<name><surname>Xu</surname> <given-names>H</given-names></name>
<name><surname>Feng</surname> <given-names>D</given-names></name>
<etal/>
</person-group>. 
<article-title>ALDH2 deficiency promotes alcohol-associated liver cancer by activating oncogenic pathways via oxidized DNA-enriched extracellular vesicles</article-title>. <source>J Hepatol</source>. (<year>2019</year>) <volume>71</volume>:<page-range>1000&#x2013;11</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jhep.2019.06.018</pub-id>, PMID: <pub-id pub-id-type="pmid">31279903</pub-id>
</mixed-citation>
</ref>
<ref id="B38">
<label>38</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Tsai</surname> <given-names>MC</given-names></name>
<name><surname>Yang</surname> <given-names>SS</given-names></name>
<name><surname>Lin</surname> <given-names>CC</given-names></name>
<name><surname>Wang</surname> <given-names>WL</given-names></name>
<name><surname>Hsu</surname> <given-names>YC</given-names></name>
<name><surname>Chen</surname> <given-names>YS</given-names></name>
<etal/>
</person-group>. 
<article-title>Association of heavy alcohol intake and ALDH2 rs671 polymorphism with hepatocellular carcinoma and mortality in patients with hepatitis B virus-related cirrhosis</article-title>. <source>JAMA Netw Open</source>. (<year>2022</year>) <volume>5</volume>:<fpage>e2223511</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1001/jamanetworkopen.2022.23511</pub-id>, PMID: <pub-id pub-id-type="pmid">35877121</pub-id>
</mixed-citation>
</ref>
<ref id="B39">
<label>39</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Beck</surname> <given-names>JD</given-names></name>
<name><surname>Diken</surname> <given-names>M</given-names></name>
<name><surname>Suchan</surname> <given-names>M</given-names></name>
<name><surname>Streuber</surname> <given-names>M</given-names></name>
<name><surname>Diken</surname> <given-names>E</given-names></name>
<name><surname>Kolb</surname> <given-names>L</given-names></name>
<etal/>
</person-group>. 
<article-title>Long-lasting mRNA-encoded interleukin-2 restores CD8+ T cell neoantigen immunity in MHC class I-deficient cancers</article-title>. <source>Cancer Cell</source>. (<year>2024</year>) <volume>42</volume>:<page-range>1467&#x2013;70</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ccell.2024.07.010</pub-id>, PMID: <pub-id pub-id-type="pmid">39137730</pub-id>
</mixed-citation>
</ref>
<ref id="B40">
<label>40</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Kemi</surname> <given-names>N</given-names></name>
<name><surname>Eskuri</surname> <given-names>M</given-names></name>
<name><surname>Herva</surname> <given-names>A</given-names></name>
<name><surname>Lepp&#xe4;nen</surname> <given-names>J</given-names></name>
<name><surname>Huhta</surname> <given-names>H</given-names></name>
<name><surname>Helminen</surname> <given-names>O</given-names></name>
<etal/>
</person-group>. 
<article-title>Tumour-stroma ratio and prognosis in gastric adenocarcinoma</article-title>. <source>Br J Cancer</source>. (<year>2018</year>) <volume>119</volume>:<page-range>435&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41416-018-0202-y</pub-id>, PMID: <pub-id pub-id-type="pmid">30057407</pub-id>
</mixed-citation>
</ref>
<ref id="B41">
<label>41</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Baghy</surname> <given-names>K</given-names></name>
<name><surname>Lad&#xe1;nyi</surname> <given-names>A</given-names></name>
<name><surname>Reszegi</surname> <given-names>A</given-names></name>
<name><surname>Kovalszky</surname> <given-names>I</given-names></name>
</person-group>. 
<article-title>Insights into the tumor microenvironment-components, functions and therapeutics</article-title>. <source>Int J Mol Sci</source>. (<year>2023</year>) <volume>24</volume>:<fpage>17536</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms242417536</pub-id>, PMID: <pub-id pub-id-type="pmid">38139365</pub-id>
</mixed-citation>
</ref>
<ref id="B42">
<label>42</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Fukumura</surname> <given-names>D</given-names></name>
<name><surname>Kloepper</surname> <given-names>J</given-names></name>
<name><surname>Amoozgar</surname> <given-names>Z</given-names></name>
<name><surname>Duda</surname> <given-names>DG</given-names></name>
<name><surname>Jain</surname> <given-names>RK</given-names></name>
</person-group>. 
<article-title>Enhancing cancer immunotherapy using antiangiogenics: opportunities and challenges</article-title>. <source>Nat Rev Clin Oncol</source>. (<year>2018</year>) <volume>15</volume>:<page-range>325&#x2013;40</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nrclinonc.2018.29</pub-id>, PMID: <pub-id pub-id-type="pmid">29508855</pub-id>
</mixed-citation>
</ref>
<ref id="B43">
<label>43</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Arriola Apelo</surname> <given-names>SI</given-names></name>
<name><surname>Lamming</surname> <given-names>DW</given-names></name>
</person-group>. 
<article-title>Rapamycin: an inhibiTOR of aging emerges from the soil of easter island</article-title>. <source>J Gerontol A Biol Sci Med Sci</source>. (<year>2016</year>) <volume>71</volume>:<page-range>841&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/gerona/glw090</pub-id>, PMID: <pub-id pub-id-type="pmid">27208895</pub-id>
</mixed-citation>
</ref>
<ref id="B44">
<label>44</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Jiang</surname> <given-names>X</given-names></name>
<name><surname>Liu</surname> <given-names>B</given-names></name>
<name><surname>Nie</surname> <given-names>Z</given-names></name>
<name><surname>Duan</surname> <given-names>L</given-names></name>
<name><surname>Xiong</surname> <given-names>Q</given-names></name>
<name><surname>Jin</surname> <given-names>Z</given-names></name>
<etal/>
</person-group>. 
<article-title>The role of m6A modification in the biological functions and diseases</article-title>. <source>Signal Transduct Target Ther</source>. (<year>2021</year>) <volume>6</volume>:<fpage>74</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41392-020-00450-x</pub-id>, PMID: <pub-id pub-id-type="pmid">33611339</pub-id>
</mixed-citation>
</ref>
<ref id="B45">
<label>45</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Sathe</surname> <given-names>A</given-names></name>
<name><surname>Mason</surname> <given-names>K</given-names></name>
<name><surname>Grimes</surname> <given-names>SM</given-names></name>
<name><surname>Zhou</surname> <given-names>Z</given-names></name>
<name><surname>Lau</surname> <given-names>BT</given-names></name>
<name><surname>Bai</surname> <given-names>X</given-names></name>
<etal/>
</person-group>. 
<article-title>Colorectal cancer metastases in the liver establish immunosuppressive spatial networking between tumor-associated SPP1+ Macrophages and fibroblasts</article-title>. <source>Clin Cancer Res</source>. (<year>2023</year>) <volume>29</volume>:<page-range>244&#x2013;60</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/1078-0432.CCR-22-2041</pub-id>, PMID: <pub-id pub-id-type="pmid">36239989</pub-id>
</mixed-citation>
</ref>
<ref id="B46">
<label>46</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Itoh</surname> <given-names>K</given-names></name>
<name><surname>Tsukimoto</surname> <given-names>J</given-names></name>
</person-group>. 
<article-title>Lysosomal sialidase NEU1, its intracellular properties, deficiency, and use as a therapeutic agent</article-title>. <source>Glycoconj J</source>. (<year>2023</year>) <volume>40</volume>:<page-range>611&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10719-023-10135-6</pub-id>, PMID: <pub-id pub-id-type="pmid">38147151</pub-id>
</mixed-citation>
</ref>
<ref id="B47">
<label>47</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Chen</surname> <given-names>Y</given-names></name>
<name><surname>Han</surname> <given-names>P</given-names></name>
<name><surname>Zhu</surname> <given-names>H</given-names></name>
<name><surname>Zhang</surname> <given-names>W</given-names></name>
<name><surname>Ma</surname> <given-names>X</given-names></name>
<name><surname>He</surname> <given-names>Y</given-names></name>
<etal/>
</person-group>. 
<article-title>New use of an old drug: mechanism of oseltamivir phosphate inhibiting liver cancer through regulation of lipophagy via NEU1</article-title>. <source>Front Pharmacol</source>. (<year>2025</year>) <volume>16</volume>:<elocation-id>1556661</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fphar.2025.1556661</pub-id>, PMID: <pub-id pub-id-type="pmid">40196362</pub-id>
</mixed-citation>
</ref>
<ref id="B48">
<label>48</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Kie&#x142;bowski</surname> <given-names>K</given-names></name>
<name><surname>Szwedkowicz</surname> <given-names>A</given-names></name>
<name><surname>Plewa</surname> <given-names>P</given-names></name>
<name><surname>Bakinowska</surname> <given-names>E</given-names></name>
<name><surname>Becht</surname> <given-names>R</given-names></name>
<name><surname>Pawlik</surname> <given-names>A</given-names></name>
<etal/>
</person-group>. 
<article-title>Anticancer properties of histone deacetylase inhibitors - what is their potential</article-title>? <source>Expert Rev Anticancer Ther</source>. (<year>2025</year>) <volume>25</volume>:<page-range>105&#x2013;20</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/14737140.2025.2452338</pub-id>, PMID: <pub-id pub-id-type="pmid">39791841</pub-id>
</mixed-citation>
</ref>
<ref id="B49">
<label>49</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Liu</surname> <given-names>Y</given-names></name>
<name><surname>Yang</surname> <given-names>X</given-names></name>
<name><surname>Gan</surname> <given-names>J</given-names></name>
<name><surname>Chen</surname> <given-names>S</given-names></name>
<name><surname>Xiao</surname> <given-names>ZX</given-names></name>
<name><surname>Cao</surname> <given-names>Y</given-names></name>
<etal/>
</person-group>. 
<article-title>CB-Dock2: improved protein-ligand blind docking by integrating cavity detection, docking and homologous template fitting</article-title>. <source>Nucleic Acids Res</source>. (<year>2022</year>) <volume>50</volume>:<page-range>W159&#x2013;64</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkac394</pub-id>, PMID: <pub-id pub-id-type="pmid">35609983</pub-id>
</mixed-citation>
</ref>
</ref-list>
<fn-group>
<fn id="n1" fn-type="custom" custom-type="edited-by">
<p>Edited by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/388133">Arunasree M Kalle</ext-link>, University of Hyderabad, India</p></fn>
<fn id="n2" fn-type="custom" custom-type="reviewed-by">
<p>Reviewed by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1001462">Silvia Liu</ext-link>, University of Pittsburgh, United States</p>
<p><ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1121683">Xuefeng Gu</ext-link>, Jiangsu University, China</p></fn>
</fn-group>
</back>
</article>