<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.3 20210610//EN" "JATS-journalpublishing1-3-mathml3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="1.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title-group>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
</journal-title-group>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2025.1729362</article-id>
<article-version article-version-type="Version of Record" vocab="NISO-RP-8-2008"/>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Original Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Expression and clinical value of key m<sup>6</sup>A RNA modification regulators in tuberculosis</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name><surname>Du</surname><given-names>Hongfei</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="author-notes" rid="fn003"><sup>&#x2020;</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/3249645/overview"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/conceptualization/">Conceptualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name><surname>Wang</surname><given-names>Hang</given-names></name>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="author-notes" rid="fn003"><sup>&#x2020;</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/3341177/overview"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="software" vocab-term-identifier="https://credit.niso.org/contributor-roles/software/">Software</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Yang</surname><given-names>Yan</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/3341250/overview"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="resources" vocab-term-identifier="https://credit.niso.org/contributor-roles/resources/">Resources</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Yu</surname><given-names>Qiao</given-names></name>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/3341452/overview"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="resources" vocab-term-identifier="https://credit.niso.org/contributor-roles/resources/">Resources</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Jiang</surname><given-names>Zhongyong</given-names></name>
<xref ref-type="aff" rid="aff3"><sup>3</sup></xref>
<xref ref-type="corresp" rid="c001"><sup>*</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/3341211/overview"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision/">Supervision</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization/">Visualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Xu</surname><given-names>Ying</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="corresp" rid="c001"><sup>*</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/1055749/overview"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis/">Formal analysis</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision/">Supervision</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization/">Visualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
</contrib-group>
<aff id="aff1"><label>1</label><institution>Department of Clinical Laboratory, The First Affiliated Hospital of Chengdu Medical College,School of Clinical Medicine,Chengdu Medical College</institution>, <city>Chengdu</city>, <state>Sichuan</state>,&#xa0;<country country="cn">China</country></aff>
<aff id="aff2"><label>2</label><institution>School of Laboratory Medicine, Chengdu Medical College</institution>, <city>Chengdu</city>, <state>Sichuan</state>,&#xa0;<country country="cn">China</country></aff>
<aff id="aff3"><label>3</label><institution>Department of Clinical Laboratory, The Affiliated Cancer Hospital of Chengdu Medical College, Chengdu Seventh People&#x2019;s Hospital</institution>, <city>Chengdu</city>, <state>Sichuan</state>,&#xa0;<country country="cn">China</country></aff>
<author-notes>
<corresp id="c001"><label>*</label>Correspondence: Zhongyong Jiang, <email xlink:href="mailto:jiangzhongyong@cmc.edu.cn">jiangzhongyong@cmc.edu.cn</email>; Ying Xu, <email xlink:href="mailto:yingxu825@126.com">yingxu825@126.com</email></corresp>
<fn fn-type="equal" id="fn003">
<label>&#x2020;</label>
<p>These authors have contributed equally to this work</p></fn>
</author-notes>
<pub-date publication-format="electronic" date-type="pub" iso-8601-date="2026-01-14">
<day>14</day>
<month>01</month>
<year>2026</year>
</pub-date>
<pub-date publication-format="electronic" date-type="collection">
<year>2025</year>
</pub-date>
<volume>16</volume>
<elocation-id>1729362</elocation-id>
<history>
<date date-type="received">
<day>21</day>
<month>10</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>23</day>
<month>12</month>
<year>2025</year>
</date>
<date date-type="rev-recd">
<day>17</day>
<month>12</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2026 Du, Wang, Yang, Yu, Jiang and Xu.</copyright-statement>
<copyright-year>2026</copyright-year>
<copyright-holder>Du, Wang, Yang, Yu, Jiang and Xu</copyright-holder>
<license>
<ali:license_ref start_date="2026-01-14">https://creativecommons.org/licenses/by/4.0/</ali:license_ref>
<license-p>This is an open-access article distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License (CC BY)</ext-link>. The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</license-p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>N6-methyladenosine (m<sup>6</sup>A), the most prevalent and reversible post-transcriptional RNA modification, is involved in the progression of various diseases. Nonetheless, the role of m<sup>6</sup>A modification in Tuberculosis (TB) pathogenesis remains unknown. Here, we investigated the general expression patterns and potential functions of m<sup>6</sup>A regulators in TB.</p>
</sec>
<sec>
<title>Methods</title>
<p>The differentially expressed m<sup>6</sup>A genes between the healthy and TB groups were evaluated using the public Gene Expression Omnibus (GEO) database, and quantitative real-time PCR (qRT-PCR) was used to test the expression of key m<sup>6</sup>A regulators in our collected human TB and healthy samples. Random forest and LASSO regression analysis were performed to determine the prognostic performance of m<sup>6</sup>A regulators in TB patients. The relationship between m<sup>6</sup>A regulators and immune cells and immune reaction activity was analyzed through single-sample gene set enrichment analysis (ssGSEA). Unsupervised clustering was used to confirm that m<sup>6</sup>A regulators induced m<sup>6</sup>A modification patterns. The relationship between m<sup>6</sup>A modification patterns and the immune microenvironment, biological function, and TB subtype construction was evaluated by using Gene Set Enrichment Analysis (GSEA), Gene Ontology (GO) analysis and KEGG pathway analysis.</p>
</sec>
<sec>
<title>Results</title>
<p>Our data revealed seven differentially expressed m<sup>6</sup>A -related genes-METTL3, VIRMA, YTHDF1, YTHDC1, YTHDC2, ELAVL1and LRPPRC mRNA-confirmed as critical m<sup>6</sup>A regulators in TB. The excellent diagnostic significance of these genes was further supported by the random forest, LASSO regression and clinical samples, which achieved a high area under the ROC (0.97). Unsupervised clustering classified patients into two m<sup>6</sup>A patterns with different immune microenvironment and biological feature.</p>
</sec>
<sec>
<title>Conclusions</title>
<p>Our study provides an overview of the expression patterns and potential roles of key m<sup>6</sup>A regulatory genes as diagnostic biomarkers and immunotherapy targets for TB, revealing their functions in TB pathogenesis. Our data may offer a valuable resource to guide both mechanistic and therapeutic analyses of key m<sup>6</sup>A regulators in TB.</p>
</sec>
</abstract>
<kwd-group>
<kwd>N6-methyladenosine</kwd>
<kwd>m6A RNA modification</kwd>
<kwd>tuberculosis</kwd>
<kwd>pulmonarytuberculosis</kwd>
<kwd>immune cell</kwd>
<kwd>immune process</kwd>
<kwd>immunemicroenvironment</kwd>
</kwd-group>
<funding-group>
<funding-statement>The author(s) declared that financial support was received for this work and/or its publication. Sichuan Provincial Clinical Research Center for Geriatrics (24LHLNYX1-60); The Affiliated Cancer Hospital of Chengdu Medical College Chengdu Seventh People&#x2019;s Hospital/School of Laboratory Medicine, Chengdu Medical College (2022LHTD-01); The Affiliated Cancer Hospital of Chengdu Medical College Chengdu Seventh People&#x2019;s Hospital/The First Affiliated Hospital of Chengdu Medical College (2022LHJYZD-01). Research Project of the Sichuan Provincial Health and Health Promotion Committee (KE2022QN0295).</funding-statement>
</funding-group>
<counts>
<fig-count count="15"/>
<table-count count="4"/>
<equation-count count="0"/>
<ref-count count="39"/>
<page-count count="21"/>
<word-count count="7499"/>
</counts>
<custom-meta-group>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Comparative Immunology</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Tuberculosis (TB), caused by Mycobacterium tuberculosis (Mtb), is the most communicable infectious disease, with high morbidity and mortality (<xref ref-type="bibr" rid="B1">1</xref>). Despite continued efforts in treatment, TB remains a major public health crisis (<xref ref-type="bibr" rid="B2">2</xref>). However, only approximately 10% of patients infected with Mtb develop active TB, while approximately 90% of the infected cases exhibit latent infection, indicating a key role of host innate immunity in preventing Mtb infection (<xref ref-type="bibr" rid="B3">3</xref>). As reports demonstration, Macrophages, the first line of human host immunity in controlling Mtb infection, can act as different innate immune defenses against Mtb and clear foreign pathogenic microorganisms (<xref ref-type="bibr" rid="B4">4</xref>). However, the molecular mechanisms involved in the regulation of macrophage defense against Mtb infection have not been fully explored. Thus, it is important to understand TB pathogenesis of TB and to identify effective therapeutic targets.</p>
<p>In the term of RNA epigenetics, N6-methyladenosine (m<sup>6</sup>A) is the most prevalent chemical modification of eukaryotic mRNAs among different known RNA modifications, and it can mediate many biological processes of RNA, containing splicing, nuclear export, stability and translation efficiency (<xref ref-type="bibr" rid="B5">5</xref>&#x2013;<xref ref-type="bibr" rid="B10">10</xref>). Several studies have demonstrated that internal m<sup>6</sup>A modifications play a role in regulating pathogen infection. For instance, m<sup>6</sup>A modification enhances the replication of enterovirus type 71 (EV71) (<xref ref-type="bibr" rid="B11">11</xref>). Conversely, m<sup>6</sup>A negatively mediates the production or release of infectious hepatitis C virus (HCV) viral particles (<xref ref-type="bibr" rid="B12">12</xref>). RNA m<sup>6</sup>A reader YTHDF1 regulate inflammation via enhancing NLRP3 translation (<xref ref-type="bibr" rid="B13">13</xref>). while the role of m<sup>6</sup>A RNA methylation regulators in TB and their correlation with TB genes remain poorly understood. A systematic understanding of m<sup>6</sup>A regulatory expression and genetic variation in TB heterogeneity will promote the validation of therapeutic targets based on RNA methylation. Therefore, in this study, we explored and validated the expression patterns and functions of m<sup>6</sup>A RNA methylation regulators in TB through public database and clinical samples.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Data acquisition and analysis</title>
<p>Two Homo sapiens gene array expression series matrix files of tuberculosis peripheral blood samples, including GSE54992 (<xref ref-type="bibr" rid="B14">14</xref>) and GSE83456 (<xref ref-type="bibr" rid="B15">15</xref>), were collected from GEO (<xref ref-type="table" rid="T1"><bold>Table&#xa0;1</bold></xref>). GSE54992, in which tests were performed on the Affymetrix Human Genome U133 Plus 2.0 Array (GPL570 platform, Affymetrix, Inc.), contains the expression profiles of 39 samples, which comprise 27 active pulmonary TB cases, six healthy controls, and six latent TB cases. A total of 33 TB cases and healthy controls were enrolled, and 6 samples of latent TB were excluded from our investigation. GSE83456(GPL10558) contains 45 humans with pulmonary TB, 47 humans with extra-pulmonary TB, 49 cases of pulmonary sarcoidosis, and 61 healthy human controls. A total of 106 patients with PTB and healthy controls were recruited for this study. The flowchart of the study is displayed in <xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1</bold></xref>. The m<sup>6</sup>A differentially expressed genes (DEGs) analysis between pulmonary TB and healthy controls were conducted by using &#x201c;limma&#x201d;R packages (version 3.64.1) (<xref ref-type="bibr" rid="B16">16</xref>). A volcano plot was used to visualize the expression of DEGs through &#x201c;pheatmap&#x201d;R packages (version 1.0.13) (<xref ref-type="bibr" rid="B17">17</xref>) and a heatmap diagram was performed to exhibit the expression of m<sup>6</sup>A regulators in TB and normal control by &#x201c;ggplot&#x201d; R packages (version 3.5.2) (<xref ref-type="bibr" rid="B18">18</xref>).</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>The information of dataset.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">Dataset</th>
<th valign="middle" align="left">Normal</th>
<th valign="middle" align="left">Disease</th>
<th valign="middle" align="left">Platform</th>
<th valign="middle" align="left">Organism</th>
<th valign="middle" align="left">Tissue</th>
<th valign="middle" align="left">Reference</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">GSE54992</td>
<td valign="middle" align="left">6</td>
<td valign="middle" align="left">27</td>
<td valign="middle" align="left">GPL570</td>
<td valign="middle" align="left">Homo sapiens</td>
<td valign="middle" align="left">Blood</td>
<td valign="middle" align="left">(<xref ref-type="bibr" rid="B14">14</xref>)</td>
</tr>
<tr>
<td valign="middle" align="left">GSE83456</td>
<td valign="middle" align="left">61</td>
<td valign="middle" align="left">45</td>
<td valign="middle" align="left">GPL10558</td>
<td valign="middle" align="left">Homo sapiens</td>
<td valign="middle" align="left">Blood</td>
<td valign="middle" align="left">(<xref ref-type="bibr" rid="B15">15</xref>)</td>
</tr>
</tbody>
</table>
</table-wrap>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>The overall chart of this study.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1729362-g001.tif">
<alt-text content-type="machine-generated">Flowchart illustrating a data analysis process. It starts with two datasets, GSE54992 and GSE83456, undergoing normalization. These are merged and subjected to SVA, followed by differential analysis. This leads to m6A gene analysis with heatmap and volcano plot outputs. The m6A gene is analyzed to determine subtypes, including m6A and gene subtype. Further processes involve immune analysis and enrichment analysis, leading back to gene subtype and another differential analysis.</alt-text>
</graphic></fig>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Identification of m<sup>6</sup>A RNA methylation regulatory genes in TB</title>
<p>Twenty-two widely studied m<sup>6</sup>A methylation regulators containing Eraser: FTO, ALKBH5; Writer: VIRMA, WTAP, ZC3H13, METTL14, METTL3, CBLL1, RBM15, RBM15B; Reader: YTHDF1, YTHDF2, YTHDF3, YTHDC1, YTHDC2, HNRNPC, HNRNPA2BP1, IGF2BP1, IGF2BP2, IGF2BP3, ELAVL1, LRPPRC were confirmed from published reports. Spearman correlation analysis was conducted to evaluate the association between m<sup>6</sup>A RNA methylation regulators and TB by using &#x201c;corrr&#x201d;R packages (version 0.4.5), and the results were visualized and plotted through &#x201c;ggplot2&#x201d; and &#x201c;pheatmap&#x201d; R packages (version 3.5.2, version 1.0.13respecively). Random forest (RF) algorithm was used to screen and identify TB-related m<sup>6</sup>A RNA methylation regulators Least absolute shrinkage and selection operator (LASSO) regression was performed to construct the prognostic model (<xref ref-type="bibr" rid="B19">19</xref>). Receiver Operating Characteristic (ROC) was used to assess the diagnostic performance of the established model.</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>The correlation between m<sup>6</sup>A RNA methylation regulators and immune features</title>
<p>Single-sample Gene Set Enrichment Analysis (ssGSEA) (<xref ref-type="bibr" rid="B20">20</xref>) was employed to assess the relative abundance of specific infiltrating immune cells and the activity of immune responses. This analysis was conducted through the &#x201c;GSVA&#x201d;package (version 2.2.0) of R software (version 4.0.2), which employing its built-in ssgsea method for scoring. The list of genes of infiltrated immune cells, including activated CD8+ T cells, natural killer T cells, Regulatory T cells (Tregs), activated dendritic cells, and macrophages were obtained from previous studies (<xref ref-type="bibr" rid="B21">21</xref>). The list of immune response genes was obtained from the ImmPort database (<xref ref-type="bibr" rid="B22">22</xref>). The correlation between m<sup>6</sup>A RNA methylation regulators and the proportion of immune cells and immune reaction activity was evaluated using Spearman correlation analysis.</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Unsupervised clustering analysis of m<sup>6</sup>A modification patterns</title>
<p>Based on the expression profiles of 22 m<sup>6</sup>A RNA methylation regulators, unsupervised consensus clustering analysis was performed on TB samples by using the R package ConsensusClusterPlus (Wilkerson &amp; Hayes, 2010) (<xref ref-type="bibr" rid="B23">23</xref>). The clustering analysis employed Euclidean distance as the similarity measure, combined with the k-means algorithm for clustering, and generated a consensus matrix through 1,000 resampling iterations with approximately 80% of samples participating in each iteration to evaluate clustering stability. By comparing the cumulative distribution function (CDF) curves, delta area curves, and consensus heatmaps for different cluster numbers (k = 2&#x2013;9), the optimal number of clusters was determined. Subsequently, principal component analysis (PCA) was performed based on the expression matrix of the 22 m6A regulators for dimensionality reduction, aiming to visualize the distribution differences between the two modification patterns and validate the clustering effect. Among different m6A modification patterns, the expression levels of m6A regulators, immune cell infiltration abundance, immune response scores, and HLA gene expression were compared. For normally distributed variables, student&#x2019;s t-test was used for comparisons between the two groups. For non-normally distributed variables, the Mann&#x2013;Whitney U test (Wilcoxon rank-sum test) was applied. All statistical tests were two-sided, with the significance level set at P &lt; 0.05.</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Identification of differentially expressed genes among different modification patterns</title>
<p>To analyze the effect of m<sup>6</sup>A modification patterns on TB, we used the &#x201c;limma&#x201d;R packages (version 3.64.1) to analyze the DEGs of the two m<sup>6</sup>A modification patterns. The significance criteria for the determination of DEGs were as |log2FC (fold change) | &gt;0.5 and P.adj&lt; 0.01. Meanwhile, logFC&gt;0.5 and P.ajj &lt;0.01 was defined as upregulated genes. LogFC &lt;-0.5 and P.adj&lt;0.01 was considered as downregulated genes.</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Functional enrichment analysis of DEGs</title>
<p>To explore the potential biological functions and signaling pathways of differentially expressed genes (DEGs) under different m<sup>6</sup>A modification patterns, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis were performed using the R package clusterProfiler (version 4.16.0). The GO analysis included three categories: Biological Process (BP), Molecular Function (MF), and Cellular Component (CC). For the enrichment analysis, the org.Hs.eg.db database was used as the human gene annotation reference, and all genes detected in the combined GEO dataset were set as the background gene set. Enrichment calculations were conducted using the enrich GO and enrich KEGG functions. Multiple testing correction was applied using the Benjamini&#x2013;Hochberg method with a significance threshold at adjusted p-value (Padj) &lt; 0.05. Significantly enriched functional categories and signaling pathways were visualized using dot plots (dotplot) and bar plots (barplot).</p>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Gene set enrichment analysis</title>
<p>The &#x201c;c2.cp.kegg.v7.5.1.entrez.gmt&#x201d; (<xref ref-type="bibr" rid="B25">25</xref>) and &#x201c;h.all.v 7.5.1. entrez.gmt&#x201d; (<xref ref-type="bibr" rid="B26">26</xref>) data were acquired from Molecular Signatures Database (MLgDB), which was analyzed through GSEA by using R &#x201c;clusterProfiler&#x201d;package (<xref ref-type="bibr" rid="B24">24</xref>).</p>
</sec>
<sec id="s2_8">
<label>2.8</label>
<title>Gene set variation analysis and functional annotation</title>
<p>To investigate the biological functional differences between different m<sup>6</sup>A modification-based TB subtypes, Gene Set Variation Analysis (GSVA) was applied to quantitatively evaluate pathway activation levels. The gene sets used in the analysis were collected from the HALLMARK gene sets in the Molecular Signatures Database (MSigDB, <ext-link ext-link-type="uri" xlink:href="https://www.gsea-msigdb.org/gsea/index.jsp">https://www.gsea-msigdb.org/gsea/index.jsp</ext-link>) (<xref ref-type="bibr" rid="B25">25</xref>). GSVA analysis was performed using the R package &#x201c;GSVA&#x201d; (version 2.2.0) (<xref ref-type="bibr" rid="B20">20</xref>) and employing a non-parametric kernel method to calculate an enrichment score for each sample in each specific pathway. The main parameters were set as follows: method = &#x201c;gsva&#x201d;, kcdf = &#x201c;Gaussian&#x201d;, mx.diff = TRUE. Subsequently, the R package &#x201c;limma&#x201d; (version 3.64.1) was used to compare the GSVA pathway scores between different m<sup>6</sup>A modification-based TB subtypes. The activation score for each pathway was input as the dependent variable into a linear model for different test without other covariates. To control the false discovery rate (FDR) from multiple hypothesis test, the results were adjusted using the Benjamini&#x2013;Hochberg method with a corrected FDR &lt; 0.05 as the threshold for statistical significance. The significant differences were visualized with a volcano plot.</p>
</sec>
<sec id="s2_9">
<label>2.9</label>
<title>Clinical specimens</title>
<p>This case-control investigation included 34 patients with pulmonary tuberculosis who were diagnosed according to clinical laboratory tests including blood, sputum or bronchoalveolar lavage fluid, simple skin tests, and histological findings. 34 age- and sex-matched healthy individuals who underwent a physical examination at the First Affiliated Hospital of Chengdu Medical College were free of diabetes, hypertension, heart, liver, kidney, and other organ diseases or dysfunctions, and had a history of malignant tumors and severe organ dysfunction. None of all TB patients with TB received the standard antituberculosis treatment.</p>
<p>Peripheral venous blood samples were collected from all the participants in the early morning under fasting conditions. Two milliliters of peripheral blood was collected into EDTA anticoagulant tubes. The samples were either immediately analyzed or aliquoted for a single use and stored at -80&#xb0;C until further use. The study was approved by the Ethics Committee of the First Affiliated Hospital of Chengdu Medical College (Sichuan, China) and conducted in accordance with the Declaration of Helsinki. Written informed consent was obtained from all participants.</p>
</sec>
<sec id="s2_10">
<label>2.10</label>
<title>Quantitative real-time polymerase chain reaction (QRT-PCR) analysis</title>
<p>Total RNA was isolated from PBMC of TB patients and healthy controls using a whole blood total RNA extraction kit (Simgen, China) according to the manufacturer&#x2019;s protocols. The concentration and purity of each total RNA were detected (using the A260/A280 and A260/A230 ratios) through a NaoDrop ND-1000 spectrophotometer (Invitrogen). For PCR analysis, 1 mg of total RNA was used to synthesize cDNA by reverse transcription using a PrimeScript TM RT reagent kit (Tiangen Biotech, China) following the manufacturer&#x2019;s protocol. The product was used as a template for PCR in a CFX-96 real-time PCR system that employed SYBR VRPremix Ex TaqTM II (Tiangen Biotech, China). The primer sequences used for amplification are listed in <xref ref-type="table" rid="T2"><bold>Table&#xa0;2</bold></xref>. Relative expression of each gene was determined using the 2<sup>-&#x25b3;&#x25b3;Ct</sup> method.</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>The amplification primers sequences of different genes.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Gene</th>
<th valign="top" align="left">Sequence (5&#x2019;-3&#x2019;)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" rowspan="2" align="left">METTL3</td>
<td valign="top" align="left">F:TTGTCTCCAACCTTCCGTAGT</td>
</tr>
<tr>
<td valign="top" align="left">R:CCAGATCAGAGAGGTGGTGTAG</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">RBM15</td>
<td valign="top" align="left">F:ACGACCCGCAACAATGAAG</td>
</tr>
<tr>
<td valign="top" align="left">R:GGAAGTCGAGTCCTCACCAC</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">RBM15B</td>
<td valign="top" align="left">F:TACACGGAGGCTACCAGTACA</td>
</tr>
<tr>
<td valign="top" align="left">R:GTCGTACAGCCCGTAGTAGTC</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">CBLL1</td>
<td valign="top" align="left">F:TCCTTGGGTGGTCTTGATGTT</td>
</tr>
<tr>
<td valign="top" align="left">R:CAGGTTTCGCTTTGTTTGCTT</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">YTHDC1</td>
<td valign="top" align="left">F:AACTGGTTTCTAAGCCACTGAGC</td>
</tr>
<tr>
<td valign="top" align="left">R:GGAGGCACTACTTGATAGACGA</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">YTHDC2</td>
<td valign="top" align="left">F:AGGACATTCGCATTGATGAGG</td>
</tr>
<tr>
<td valign="top" align="left">R:CTCTGGTCCCCGTATCGGA</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">HNRNPC</td>
<td valign="top" align="left">F:TCCTCCTCCTATTGCTCGGG</td>
</tr>
<tr>
<td valign="top" align="left">R:GTGTTTCCTGATACACGCTGA</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">HNRNPA2B1</td>
<td valign="top" align="left">F:ATTGATGGGAGAGTAGTTGAGCC</td>
</tr>
<tr>
<td valign="top" align="left">R:AATTCCGCCAACAAACAGCTT</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">IGF2BP1</td>
<td valign="top" align="left">F:GCGGCCAGTTCTTGGTCAA</td>
</tr>
<tr>
<td valign="top" align="left">R:TTGGGCACCGAATGTTCAATC</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">IGF2BP3</td>
<td valign="top" align="left">F:ACGAAATATCCCGCCTCATTTAC</td>
</tr>
<tr>
<td valign="top" align="left">R:GCAGTTTCCGAGTCAGTGTTCA</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">ELAVL1</td>
<td valign="top" align="left">F:GGGTGACATCGGGAGAACG</td>
</tr>
<tr>
<td valign="top" align="left">R:CTGAACAGGCTTCGTAACTCAT</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">LRPPRC</td>
<td valign="top" align="left">F:GCTCATAGGATATGGGACACACT</td>
</tr>
<tr>
<td valign="top" align="left">R:CCAGGAAATCAGTTGGTGAGAAT</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">LAMP2</td>
<td valign="top" align="left">F:GAAAATGCCACTTGCCTTTATGC</td>
</tr>
<tr>
<td valign="top" align="left">R:AGGAAAAGCCAGGTCCGAAC</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_11">
<label>2.11</label>
<title>Statistical analysis</title>
<p>All data analyses were performed in R software (version 4.0.2). For gene expression analysis, after normalization and log transformation, the data approximated a normal distribution under the large sample assumption. Therefore, differential analysis was conducted using the limma package (version 3.64.1). For comparisons of continuous variables between independent samples, student&#x2019;s t-test was applied when the data met the assumptions of normal distribution and homogeneity of variance. If the variables did not follow a normal distribution (e.g., Shapiro&#x2013;Wilk test p &lt; 0.05) or the sample size was small with markedly skewed distribution, the Mann&#x2013;Whitney U test was used. All statistical tests were two-sided, and a p-value &lt; 0.05 was considered statistically significant.</p>
<p>The expression correlations among m6A regulators were calculated using Spearman&#x2019;s rank correlation analysis. The analysis was based on the paired expression values of each regulator, and the results were expressed as correlation coefficients (&#x3c1;). The significance of correlations was determined based on p-values without adjustment for multiple tests. The correlation coefficient matrix and the significance results were visualized via heatmaps and network plots.</p>
<p>The receiver operating characteristic (ROC) curve and area under the ROC curve (AUC) were calculated to evaluate the feasibility of m<sup>6</sup>A regulators as potential markers for TB diagnosis. Meanwhile, the discriminative performance of the model was evaluated using the ROC curve. To compare the predictive ability of the model across different datasets, ROC curves were calculated based on the training set and the validation set, respectively. The area under the curve (AUC) and its 95% confidence interval were computed using the R package &#x201c;pROC&#x201d; (Version 1.18.5). To assess the robustness of the model, the study samples were randomly divided into a training set and a validation set at a ratio of 7:3 for model fitting and validation without additional resampling or cross-validation.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>The differential expression of m<sup>6</sup>A -related genes in TB</title>
<p>The workflow of this study is illustrated in <xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1</bold></xref>. After the integration of the GEO datasets GSE54992 and GSE83456, the raw expression data were first subjected to background correction and normalization using &#x201c;limma&#x201d;R packages (version 3.64.1), followed by batch-effect adjustment via the empirical Bayesian algorithm implemented in the &#x201c;sva&#x201d; package to ensure comparability across datasets. The data of boxplots of normalized expression values demonstrated that after normalization, the median levels of the boxplots were well aligned, indicating comparable distributions across samples (<xref ref-type="fig" rid="f2"><bold>Figures&#xa0;2A-D</bold></xref>). Subsequently, principal component analysis (PCA) was conducted to evaluate overall clustering characteristics and group consistency. The PCA results (<xref ref-type="fig" rid="f2"><bold>Figures&#xa0;2E, F</bold></xref>) revealed clear separation between TB group and healthy control group in the principal component space. PC1 and PC2 explained 13.52% and 9.74% of the total variance, respectively, indicating that the first two principal components can effectively capture the primary variation structure among the samples.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Normalized expression matrices <bold>(A-D)</bold> and PCA diagrams <bold>(E, F)</bold> of the GSE54992, GSE83456 datasets. PCA, principal component analysis.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1729362-g002.tif">
<alt-text content-type="machine-generated">Panel of graphs depicting data distributions and PCA plots. Graphs A to D show boxplots of sample data, with color differentiation for distinct groups. Graphs E and F are scatter plots for principal component analysis, illustrating group clusters, with E separating GSE49992 and GSE83456, and F differentiating HC and TB groups.</alt-text>
</graphic></fig>
<p>Then, the landscape of genetic expression of m<sup>6</sup>A RNA methylation genes between the TB group and control group was analyzed through &#x201c;limma&#x201d; R packages. Volcano plots of DEGs in the above two datasets showed that METTL3, VIRMA, RBM15, RBM15B, YTHDF1, YTHDC1, YTHDC2, ELAVL1, LRPPRC and ALKBH5 were downregulated in TB (<xref ref-type="fig" rid="f3"><bold>Figure&#xa0;3A</bold></xref>). The data further demonstrated that the results of the heat map (<xref ref-type="fig" rid="f3"><bold>Figure&#xa0;3B</bold></xref>), box plot (<xref ref-type="fig" rid="f3"><bold>Figure&#xa0;3C</bold></xref>) and chromosome map (<xref ref-type="fig" rid="f3"><bold>Figure&#xa0;3D</bold></xref>) were the same as those of the volcano plot.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>The differential expression of m<sup>6</sup>A RNA methylation genes between healthy controls and TB cases. <bold>(A-D)</bold> Volcano plot, Heat map, box plot and chromosome map of 22 m<sup>6</sup>A RNA methylation regulators between healthy control samples and TB samples, respectively. (*P&lt;0.05; ***P&lt;0.001; ****P&lt;0.0001. ns, p&gt;0.05).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1729362-g003.tif">
<alt-text content-type="machine-generated">Panel A shows a volcano plot with labeled genes such as METTL3 and ELAVL1. Panel B is a heatmap displaying gene expression levels, with colors indicating different conditions. Panel C presents box plots comparing gene expression between two groups, HC and TB. Panel D illustrates a circular diagram mapping gene locations on chromosomes.</alt-text>
</graphic></fig>
<p>Moreover, the validation and clinical relevance of different m<sup>6</sup>A regulators in TB were evaluated. We examined the mRNA expression of METTL3, VIRMA, RBM15, RBM15B, YTHDF1, YTHDC1, YTHDC2, ELAVL1, LRPPRC and ALKBH5 in peripheral blood by using qRT-PCR. METTL3, VIRMA, YTHDF1, YTHDC1, YTHDC2, ELAVL1 and LRPPRC mRNA levels were significantly downregulated in TB samples compared to those in the control group (<xref ref-type="fig" rid="f4"><bold>Figures&#xa0;4A-J</bold></xref>). In addition, we evaluated the association between serum METTL3, VIRMA, YTHDF1, YTHDC1, YTHDC2, ELAVL1, LRPPRC mRNA expression, and clinical markers in TB patients. As shown in <xref ref-type="fig" rid="f5"><bold>Figure&#xa0;5</bold></xref>, there was a close association between LRPPRC and Lymphocyte percentage (Lymph%) (r=0.358, P&#xa0;=&#xa0;0.0002) and number (Lymph#) (r=0.415, P&lt;0.0001) (<xref ref-type="fig" rid="f5"><bold>Figures&#xa0;5A-P</bold></xref>).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>The mRNA expression of METTL3, VIRMA, RBM15, RBM15B, YTHDF1, YTHDC1, YTHDC2, ELAVL1, LRPPRC and ALKBH5 in peripheral blood by using qRT-PCR in our collected samples. <bold>(A&#x2013;J)</bold> The expression of RBM15,RBM15B,ELAVL1,LRPPRC,METTL3,YTHDC1,YTHDC2,ALKBH5,VIRMA and YTHDF1 in TB samples and healthy control samples,respectively.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1729362-g004.tif">
<alt-text content-type="machine-generated">Dot plot graphs comparing gene expression levels for RBM15, RBM15B, ELAVL1, LRPPRC, METTL3, YTHDC1, YTHDC2, ALKBH5, VIRMA, and YTHDF1 between TB and HC groups. Each plot shows individual data points with a mean and standard deviation bar. P-values indicate statistical significance, with several showing significant differences.</alt-text>
</graphic></fig>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>The spearman correlation analysis between m<sup>6</sup>A genes and laboratory indicators in our collected TB specimens. <bold>(A-P)</bold> Statistically significant correlation analysis of serum <italic>LRPPRC, ELAVL1, YTHDC1, METTL3, YTHDC2</italic> with different laboratory makers respectively in TB patients.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1729362-g005.tif">
<alt-text content-type="machine-generated">Scatter plot grid displaying gene expression against various blood parameters, with regression lines. Each plot has an R-squared and p-value indicating correlation strength and significance. Genes include LRPPRC, ELAVL1, YTHDC1, METTL3, and YTHDC2, compared against parameters like HB, Neutrophils, Lymphocytes, Platelets, AST, and WBC. The plots illustrate different trends, both positive and negative correlations. Each subplot is labeled from A to P.</alt-text>
</graphic></fig>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>The expression correlation analysis of m<sup>6</sup>A regulators in TB</title>
<p>The correlation between the expression levels of the 22 m<sup>6</sup>A genes in TB and normal samples was analyzed. The results were visualized using a heat map (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6A</bold></xref>) and network map (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6B</bold></xref>). The upper right section presents the expression correlation of m<sup>6</sup>A -related genes in all samples, whereas the lower left section shows the expression correlation of m<sup>6</sup>A -related genes in TB samples. These data revealed that YTHDF2 was strongly associated with YTHDF1 in the TB group (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6C</bold></xref>). YTHDF1 was highly correlated with VIRMA in all the samples ((<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6D</bold></xref>).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>The correlation analysis of m<sup>6</sup>A regulators in TB. <bold>(A)</bold> The expression correlation heat map of 22 m<sup>6</sup>A gene. The right upper corner is the all samples, and the left lower corner is TB cases. <bold>(B)</bold> The network between m<sup>6</sup>A regulators. <bold>(C)</bold> The scatter plot of YTHDF2 and YTHDF1 expression in all samples. <bold>(D)</bold> The scatter plot of YTHDF1 and VIRMA expression in TB samples.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1729362-g006.tif">
<alt-text content-type="machine-generated">Panel A shows a correlation matrix with colored dots indicating correlations between different samples. Panel B features a network diagram illustrating relationships among various genes. Panel C presents a scatter plot with a line of best fit, depicting the relationship between YTHDF1 and YTHDF2. Panel D shows another scatter plot with a trend line, illustrating the connection between YTHDF1 and VIRMA. Each plot includes statistical information such as p-values and confidence intervals.</alt-text>
</graphic></fig>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>The prediction model of m<sup>6</sup>A regulators in TB</title>
<p>To further explore the diagnostic ability of m<sup>6</sup>A -related regulators in TB, the random forest method was used (<xref ref-type="fig" rid="f7"><bold>Figures&#xa0;7A, B</bold></xref>). The samples were randomly divided into the training (70%) and validation (30%) sets. Boxplots (<xref ref-type="fig" rid="f7"><bold>Figures&#xa0;7C, D</bold></xref>) revealed significant differences in the model scores between the TB and healthy groups in both the training and validation sets. The ROC curve (<xref ref-type="fig" rid="f7"><bold>Figure&#xa0;7E</bold></xref>) demonstrated that the constructed model exhibited excellent diagnostic performance for TB, indicating that m<sup>6</sup>A genes had strong predictive power.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Random forest analysis. <bold>(A, B)</bold> Modeling of m<sup>6</sup>A gene through random forest method in TB. <bold>(C, D)</bold> The box plot of training group and verification group. <bold>(E)</bold> ROC curve of random forest.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1729362-g007.tif">
<alt-text content-type="machine-generated">Panel A shows a line graph of error rates versus the number of trees in a Random Forest model, decreasing and stabilizing around 100 trees. Panel B is a dot plot illustrating variable importance of top genes ranked by IncNodePurity, with LRPPRC as the most important. Panels C and D are box plots displaying rf_scores for HC and TB samples, both showing significant differences. Panel E presents an ROC curve with true positive rate versus false positive rate, achieving an AUC of 0.9497.</alt-text>
</graphic></fig>
<p>LASSO regression analysis was used to screen variables and construct a prediction model as follows: risk scores = METTL3 &#xd7; (-1.265) + METTL14 &#xd7; 0.598 + WTAP &#xd7; (-1.559) + RBM15 &#xd7; (-0.926) + RBM15B &#xd7; (-0.432) + CBLL1 &#xd7; 1.623 + YTHDF2 &#xd7; 0.564 + YTHDC1 &#xd7; (-0.744) + YTHDC2 &#xd7; (-1.844) + HNRNPC &#xd7; (-1.119) + HNRNPA2B1 &#xd7; 1.109 + IGF2BP1 &#xd7; 0.559 + IGF2BP3 &#xd7; (-2.372) + ELAVL1 &#xd7; (-1.273) + LRPPRC &#xd7; (-2.031) + ALKBH5 &#xd7; 1.297. As showed in <xref ref-type="fig" rid="f8"><bold>Figures&#xa0;8A, B</bold></xref>, the results were the same as those in the above conclusion. The boxplot shows a significant difference in the risk scores between the TB and healthy groups (<xref ref-type="fig" rid="f8"><bold>Figure&#xa0;8C</bold></xref>). The ROC curve (<xref ref-type="fig" rid="f8"><bold>Figure&#xa0;8D</bold></xref>) indicated that the risk model had strong diagnostic capability for TB.</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>LASSO regression modeling. <bold>(A, B)</bold> LASSO regression was used to model of m<sup>6</sup>A gene. <bold>(C)</bold> Score box plot. <bold>(D)</bold> Diagnostic ROC curve of LASSO regression.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1729362-g008.tif">
<alt-text content-type="machine-generated">Panel A shows a line plot with coefficient paths across varying log Lambda values. Panel B is a plot of binomial deviance versus log Lambda, indicating optimal points. Panel C displays a box plot comparing risk scores between HC (blue) and TB (yellow) groups, with statistical significance indicated (p &lt; 2.2e-16). Panel D presents a receiver operating characteristic (ROC) curve with an AUC of 0.933, illustrating the true positive rate against the false positive rate.</alt-text>
</graphic></fig>
<p>In addition, the predictive values of METTL3, VIRMA, YTHDF1, YTHDC1, YTHDC2, ELAVL1and LRPPRC individually and in combination with Ziehl-Neelsen staining were evaluated by using a binary logistic regression model. Receiver operating characteristic (ROC) curves were plotted to analyze and compare their predictive values (<xref ref-type="fig" rid="f9"><bold>Figure&#xa0;9</bold></xref>). The areas under the ROC for predicting TB using METTL3, VIRMA, YTHDF1, YTHDC1, YTHDC2, ELAVL1and LRPPRC were 0.543 (95% CI: 0.331&#x2013;0.755), 0.564 (95% CI: 0.354&#x2013;0.774), 0.462 (95% CI: 0.254&#x2013;0.669), 0.521(CI:0.313-0.730), 0.556(CI:0.350-0.761), 0.564(CI:0.358-0.77) and 0.436(CI:0.222-0.649) respectively, indicating that none of the individually identified genes can possess sufficient diagnostic accuracy for clinical application. When compared to individual predictions, the combined ROC area under the curve for these seven markers and Ziehl-Neelsen staining was 0.953 (95% CI: 0.874&#x2013;1.00) (P&lt;0.001).</p>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>ROC revealing a diagnostic value of METTL3, VIRMA, YTHDF1, YTHDC1, YTHDC2, ELAVL1and LRPPRC combination with Ziehl-Neelsen staining as TB infection biomarker.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1729362-g009.tif">
<alt-text content-type="machine-generated">ROC curve showing sensitivity versus 1-specificity for various markers, including Ziehl-Neelsen stain, ELAVL1, LRPPRC, METTL3, YTHDC1, YTHDC2, YTHDF1, VIRMA, and combined markers. A reference line is included.</alt-text>
</graphic></fig>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>Correlation analysis of m<sup>6</sup>A regulators with immune cell and immune process in TB</title>
<p>Immune cell infiltration is a vital component of the tumor microenvironment and is closely associated with the development of various diseases (Gajewski et&#xa0;al., 2013). Therefore, the relationship between m<sup>6</sup>A regulators, immune cell infiltration, and immune response was explored in TB (<xref ref-type="fig" rid="f10"><bold>Figures&#xa0;10A, B</bold></xref>). FTO and METTL3 were positively correlated with most immune cells, whereas LRPPRC exhibited a negative correlation. Type 1 T helper cells were positively associated with most m<sup>6</sup>A genes, whereas gamma delta T cells were negatively correlated. In terms of immune processes, ALKBH5 and METTL3 levels were negatively correlated with immune processes. These findings suggested that m<sup>6</sup>A regulators could serve as predictors of the immune microenvironment and immune processes in TB, with METTL3 acting as a significant immunosuppressive regulator, and HNRNPA2B1 acting as an immune-activating gene.</p>
<fig id="f10" position="float">
<label>Figure&#xa0;10</label>
<caption>
<p>The Correlation between infiltrating immune cells, immune response genes and m<sup>6</sup>A regulators. <bold>(A)</bold> The association between abnormal infiltrating cell in the immune microenvironment and abnormal m<sup>6</sup>A regulators displayed by dot plot. <bold>(B)</bold> The dot plot showed the correlation between each immune response pathway and m<sup>6</sup>A regulators.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1729362-g010.tif">
<alt-text content-type="machine-generated">A heatmap showing correlation matrices A and B. Matrix A correlates various immune cell types, such as T helper cells and macrophages, with specific gene markers. Matrix B correlates molecules like cytokine receptors with gene markers. Yellow to blue gradient indicates correlation strength from 0.5 to -0.6, with levels of significance marked by asterisks.</alt-text>
</graphic></fig>
</sec>
<sec id="s3_5">
<label>3.5</label>
<title>m<sup>6</sup>A regulators-mediated m<sup>6</sup>A modification patterns in TB</title>
<p>Based on the expression of 22 m<sup>6</sup>A regulators, unsupervised cluster analysis was applied to classify the different m<sup>6</sup>A modification patterns in TB (<xref ref-type="fig" rid="f11"><bold>Figures&#xa0;11A-C</bold></xref>). The data demonstrated that the optimal clustering stability was k = 2 in the consensus clustering. Patients with TB were divided into two subtypes (clusters 1 and 2). Furthermore, PCA revealed a statistically significant difference between the two m<sup>6</sup>A molecular subtypes (<xref ref-type="fig" rid="f11"><bold>Figure&#xa0;11D</bold></xref>). Heat maps ((<xref ref-type="fig" rid="f11"><bold>Figure&#xa0;11E</bold></xref>) and boxplots ((<xref ref-type="fig" rid="f11"><bold>Figure&#xa0;11F</bold></xref>) demonstrated the expression specificity of m<sup>6</sup>A regulators between these two molecular subtypes.</p>
<fig id="f11" position="float">
<label>Figure&#xa0;11</label>
<caption>
<p>The unsupervised cluster analysis of 22 m<sup>6</sup>A regulators. Two different subtypes of m<sup>6</sup>A modification patterns were identified in TB. <bold>(A)</bold> The distribution cumulative of consensus clustering when k=2-9. <bold>(B)</bold> Relative change of area under CDF curve when k=2-9. <bold>(C)</bold> Heat map of the co-occurrence proportion matrix of TB samples when k=2. <bold>(D)</bold> The transcriptome difference in two modification modes. <bold>(E)</bold> The heat map of 22 m<sup>6</sup>A regulators in two modification modes. <bold>(F)</bold> The expression of 22 m<sup>6</sup>A regulators in two m<sup>6</sup>A subtypes. ns:p&gt;0.05, *:p&lt;0.05, **:p&lt;0.01, ***:p&lt;0.001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1729362-g011.tif">
<alt-text content-type="machine-generated">Six-panel scientific data visualization showing:  A. Line graph of consensus cumulative distribution functions (CDF) across different k-values. B. Line graph of Delta area, indicating relative change with increasing k. C. Heatmap of a consensus matrix at k=2 with hierarchical clustering. D. Scatter plot of principal component analysis (PCA) with two clusters highlighted by blue and yellow ellipses. E. Heatmap showing gene expression across two clusters with corresponding dendrogram. F. Box plot of gene expression levels across two clusters, with statistical significance marked.  Each panel provides different insights into clustering and expression patterns.</alt-text>
</graphic></fig>
</sec>
<sec id="s3_6">
<label>3.6</label>
<title>Immune microenvironment characteristics of different m<sup>6</sup>A modification patterns</title>
<p>m<sup>6</sup>A modification may affect the translation efficiency or stability of immune-related genes, leading to differences in immune response intensity between the two subtypes. To explore the differences in immune microenvironment features between different m<sup>6</sup>A modification patterns, we evaluated immune cell infiltration, immune response, and HLA expression under different m<sup>6</sup>A modification patterns. As shown in <xref ref-type="fig" rid="f12"><bold>Figure&#xa0;12A</bold></xref>, the number of immune cells differed between the two groups. Pattern 1 exhibited a relatively high proportion of activated immune cells, including gamma delta T cells, neutrophils, and NK cells. Pattern 2 showed a higher proportion of type 1 T-helper cells. Chemokine and cytokine processes were relatively more active in pattern 1, whereas the TCR signaling pathway was highly active in pattern 2 (<xref ref-type="fig" rid="f12"><bold>Figure&#xa0;12B</bold></xref>), which aligns with previous analysis of immune processes. To enhance the reliability of the results, CIBERSORT was used to calculate the immune cell content in the different modes (<xref ref-type="fig" rid="f12"><bold>Figure&#xa0;12C</bold></xref>). Similar to ssGSEA, there was a high level of Gamma Delta T cells in Pattern 1. However, there was no significant difference in HLA family gene expression between the two patterns (<xref ref-type="fig" rid="f12"><bold>Figure&#xa0;12D</bold></xref>). These findings suggested that pattern 1 mediates an active immune response, whereas pattern 2 regulates a mild immune response, revealing the important role of m<sup>6</sup>A methylation in regulating the formation of different immune microenvironments in TB.</p>
<fig id="f12" position="float">
<label>Figure&#xa0;12</label>
<caption>
<p>Differences in immune microenvironment characteristics between different m<sup>6</sup>A modification patterns. <bold>(A)</bold> The differences abundance of infiltrating immune cells in different immune microenvironments by ssgesa scores under two m<sup>6</sup>A modification patterns. <bold>(B)</bold> The differences of immune processes scores under two m<sup>6</sup>A modification patterns. <bold>(C)</bold> The abundance difference of infiltrating immune cells in different immune microenvironments by CIBERSORT scores under two m<sup>6</sup>A modification patterns. <bold>(D)</bold> Different expression of HLA genes in three m<sup>6</sup>A modification patterns. ns:p&gt;0.05, *:p&lt;0.05, **:p&lt;0.01, ***:p&lt;0.001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1729362-g012.tif">
<alt-text content-type="machine-generated">Four box plots labeled A, B, C, and D display data distributions across two clusters represented by yellow and blue colors. Plots compare various categories such as cell types and gene expressions, with statistical significance indicated by symbols like asterisks and “ns” for non-significant results. Each plot shows different horizontal labels representing specific categories with vertical axes indicating relative scores or expression levels.</alt-text>
</graphic></fig>
</sec>
<sec id="s3_7">
<label>3.7</label>
<title>Biological features of different m<sup>6</sup>A modification patterns</title>
<p>The two subtypes may represent different biological states. We use &#x201c;limma&#x201d; package to investigate the biological responses under the two m<sup>6</sup>A modification patterns. Volcano and heat maps were used to display the results of the difference analysis (<xref ref-type="fig" rid="f13"><bold>Figures&#xa0;13A, B</bold></xref>). We set the thresholds for differentially expressed genes (DEGs) as |log2 fold change (logFC)| &gt; 0.5 and adjusted P-value (Padj) &lt; 0.01. Enrichment analysis was conducted on the DEGs (<xref ref-type="fig" rid="f13"><bold>Figures&#xa0;13C, D</bold></xref>). GSEA was used to conduct an enrichment analysis for the two patterns (<xref ref-type="fig" rid="f13"><bold>Figures&#xa0;13E, F</bold></xref>). The KEGG and HALLMARK results showed that pattern 2 was more biologically active (<xref ref-type="table" rid="T3"><bold>Tables&#xa0;3</bold></xref>, <xref ref-type="table" rid="T4"><bold>4</bold></xref>).</p>
<fig id="f13" position="float">
<label>Figure&#xa0;13</label>
<caption>
<p>Difference analysis and enrichment analysis of two m<sup>6</sup>A modification patterns. <bold>(A)</bold> Volcano map of m<sup>6</sup>A modification Model 1 and Model 2. <bold>(B)</bold> Heat map of m<sup>6</sup>A modification mode 1 and Mode 2. <bold>(C)</bold> GO enrichment analysis between pattern 1 and pattern 2. <bold>(D)</bold> KEGG enrichment analysis of m<sup>6</sup>A modified pattern 1 and pattern 2. <bold>(E, F)</bold> GSEA enrichment analysis of m<sup>6</sup>A modified pattern 1 and pattern 2.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1729362-g013.tif">
<alt-text content-type="machine-generated">A figure showing six panels of bioinformatics data visualizations. Panel A is a volcano plot depicting gene expression changes with 680 genes downregulated and 257 upregulated. Panel B is a heatmap clustered by expression levels with three groups indicated in different colors. Panels C and D are bar charts displaying enriched pathways, with panel C focusing on biological processes and panel D on signaling pathways, both color-coded by significance. Panels E and F present GSEA results with ridge plots for KEGG and HALLMARK pathways, respectively, again color-coded by significance.</alt-text>
</graphic></fig>
<table-wrap id="T3" position="float">
<label>Table&#xa0;3</label>
<caption>
<p>GO function enrichment analyses on the difference genes between m<sup>6</sup>A subtypes.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">Ontology</th>
<th valign="middle" align="left">ID</th>
<th valign="middle" align="left">Description</th>
<th valign="middle" align="left">p.adjust</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">BP</td>
<td valign="middle" align="left">GO:0007626</td>
<td valign="middle" align="left">locomotory behavior</td>
<td valign="middle" align="left">0.051255</td>
</tr>
<tr>
<td valign="middle" align="left">BP</td>
<td valign="middle" align="left">GO:0001503</td>
<td valign="middle" align="left">ossification</td>
<td valign="middle" align="left">0.051255</td>
</tr>
<tr>
<td valign="middle" align="left">BP</td>
<td valign="middle" align="left">GO:0030534</td>
<td valign="middle" align="left">adult behavior</td>
<td valign="middle" align="left">0.051255</td>
</tr>
<tr>
<td valign="middle" align="left">BP</td>
<td valign="middle" align="left">GO:0098656</td>
<td valign="middle" align="left">anion transmembrane transport</td>
<td valign="middle" align="left">0.051255</td>
</tr>
<tr>
<td valign="middle" align="left">BP</td>
<td valign="middle" align="left">GO:1905039</td>
<td valign="middle" align="left">carboxylic acid transmembrane transport</td>
<td valign="middle" align="left">0.051255</td>
</tr>
<tr>
<td valign="middle" align="left">BP</td>
<td valign="middle" align="left">GO:1903825</td>
<td valign="middle" align="left">organic acid transmembrane transport</td>
<td valign="middle" align="left">0.051255</td>
</tr>
<tr>
<td valign="middle" align="left">BP</td>
<td valign="middle" align="left">GO:0006936</td>
<td valign="middle" align="left">muscle contraction</td>
<td valign="middle" align="left">0.051255</td>
</tr>
<tr>
<td valign="middle" align="left">BP</td>
<td valign="middle" align="left">GO:0048821</td>
<td valign="middle" align="left">erythrocyte development</td>
<td valign="middle" align="left">0.051255</td>
</tr>
<tr>
<td valign="middle" align="left">BP</td>
<td valign="middle" align="left">GO:0061564</td>
<td valign="middle" align="left">axon development</td>
<td valign="middle" align="left">0.05224</td>
</tr>
<tr>
<td valign="middle" align="left">BP</td>
<td valign="middle" align="left">GO:0007409</td>
<td valign="middle" align="left">axonogenesis</td>
<td valign="middle" align="left">0.05224</td>
</tr>
<tr>
<td valign="middle" align="left">BP</td>
<td valign="middle" align="left">GO:0043010</td>
<td valign="middle" align="left">camera-type eye development</td>
<td valign="middle" align="left">0.052321</td>
</tr>
<tr>
<td valign="middle" align="left">CC</td>
<td valign="middle" align="left">GO:0044306</td>
<td valign="middle" align="left">neuron projection terminus</td>
<td valign="middle" align="left">0.017179</td>
</tr>
<tr>
<td valign="middle" align="left">CC</td>
<td valign="middle" align="left">GO:0043679</td>
<td valign="middle" align="left">axon terminus</td>
<td valign="middle" align="left">0.017179</td>
</tr>
<tr>
<td valign="middle" align="left">CC</td>
<td valign="middle" align="left">GO:0032589</td>
<td valign="middle" align="left">neuron projection membrane</td>
<td valign="middle" align="left">0.041449</td>
</tr>
<tr>
<td valign="middle" align="left">CC</td>
<td valign="middle" align="left">GO:0098978</td>
<td valign="middle" align="left">glutamatergic synapse</td>
<td valign="middle" align="left">0.041449</td>
</tr>
<tr>
<td valign="middle" align="left">MF</td>
<td valign="middle" align="left">GO:0001228</td>
<td valign="middle" align="left">DNA-binding transcription activator activity, RNA polymerase II-specific</td>
<td valign="middle" align="left">0.026143</td>
</tr>
<tr>
<td valign="middle" align="left">MF</td>
<td valign="middle" align="left">GO:0008509</td>
<td valign="middle" align="left">anion transmembrane transporter activity</td>
<td valign="middle" align="left">0.026143</td>
</tr>
<tr>
<td valign="middle" align="left">MF</td>
<td valign="middle" align="left">GO:0001216</td>
<td valign="middle" align="left">DNA-binding transcription activator activity</td>
<td valign="middle" align="left">0.026143</td>
</tr>
<tr>
<td valign="middle" align="left">MF</td>
<td valign="middle" align="left">GO:0043394</td>
<td valign="middle" align="left">proteoglycan binding</td>
<td valign="middle" align="left">0.028116</td>
</tr>
<tr>
<td valign="middle" align="left">MF</td>
<td valign="middle" align="left">GO:0019955</td>
<td valign="middle" align="left">cytokine binding</td>
<td valign="middle" align="left">0.028116</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="T4" position="float">
<label>Table&#xa0;4</label>
<caption>
<p>KEGG function enrichment analyses on the difference genes between m<sup>6</sup>A subtypes.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">ID</th>
<th valign="middle" align="left">Description</th>
<th valign="middle" align="left">p.value</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">hsa04080</td>
<td valign="middle" align="left">Neuroactive ligand-receptor interaction</td>
<td valign="middle" align="left">0.001174</td>
</tr>
<tr>
<td valign="middle" align="left">hsa04978</td>
<td valign="middle" align="left">Mineral absorption</td>
<td valign="middle" align="left">0.002827</td>
</tr>
<tr>
<td valign="middle" align="left">hsa04024</td>
<td valign="middle" align="left">cAMP signaling pathway</td>
<td valign="middle" align="left">0.003954</td>
</tr>
<tr>
<td valign="middle" align="left">hsa04710</td>
<td valign="middle" align="left">Circadian rhythm</td>
<td valign="middle" align="left">0.00777</td>
</tr>
<tr>
<td valign="middle" align="left">hsa04060</td>
<td valign="middle" align="left">Cytokine-cytokine receptor interaction</td>
<td valign="middle" align="left">0.009087</td>
</tr>
<tr>
<td valign="middle" align="left">hsa04512</td>
<td valign="middle" align="left">ECM-receptor interaction</td>
<td valign="middle" align="left">0.009411</td>
</tr>
<tr>
<td valign="middle" align="left">hsa00040</td>
<td valign="middle" align="left">Pentose and glucuronate interconversions</td>
<td valign="middle" align="left">0.011519</td>
</tr>
<tr>
<td valign="middle" align="left">hsa04961</td>
<td valign="middle" align="left">Endocrine and other factor-regulated calcium reabsorption</td>
<td valign="middle" align="left">0.020131</td>
</tr>
<tr>
<td valign="middle" align="left">hsa05219</td>
<td valign="middle" align="left">Bladder cancer</td>
<td valign="middle" align="left">0.024631</td>
</tr>
<tr>
<td valign="middle" align="left">hsa04928</td>
<td valign="middle" align="left">Parathyroid hormone synthesis, secretion and action</td>
<td valign="middle" align="left">0.028719</td>
</tr>
<tr>
<td valign="middle" align="left">hsa00860</td>
<td valign="middle" align="left">Porphyrin metabolism</td>
<td valign="middle" align="left">0.029631</td>
</tr>
<tr>
<td valign="middle" align="left">hsa02010</td>
<td valign="middle" align="left">ABC transporters</td>
<td valign="middle" align="left">0.035228</td>
</tr>
<tr>
<td valign="middle" align="left">hsa04136</td>
<td valign="middle" align="left">Autophagy &#x2013; other</td>
<td valign="middle" align="left">0.03976</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s3_8">
<label>3.8</label>
<title>TB subtypes construction based on differentially expressed genes of m<sup>6</sup>A modification patterns</title>
<p>To further elucidate the impact of m<sup>6</sup>A modification on the transcriptomic landscape of tuberculosis (TB), this study conducted a secondary subtype analysis based on differentially expressed genes (DEGs), which was built upon the previously identified m<sup>6</sup>A modification patterns derived from 22 m<sup>6</sup>A regulators. This analysis aimed to extend from the m<sup>6</sup>A regulatory level to the gene expression level and systematically uncovered the downstream effects of m<sup>6</sup>A modification on TB molecular heterogeneity. The clustering results (<xref ref-type="fig" rid="f14"><bold>Figures&#xa0;14A&#x2013;C</bold></xref>) showed that the m6A-related signature genes robustly distinguished two expression subtypes among TB samples. PCA analysis (<xref ref-type="fig" rid="f14"><bold>Figure&#xa0;14D</bold></xref>) further validated clear separation between the two subtypes in transcriptomic space, suggesting that m6A modification may drive distinct downstream transcriptional responses. The heatmap (<xref ref-type="fig" rid="f14"><bold>Figure&#xa0;14E</bold></xref>) displayed differential expression patterns of the signature genes across the two subtypes, reflecting potential functional divergences in metabolic regulation, immune responses, and signaling pathways. The Sankey diagram (<xref ref-type="fig" rid="f14"><bold>Figure&#xa0;14F</bold></xref>) revealed the relationship between the m<sup>6</sup>A modification patterns and expression subtypes, indicating that different m<sup>6</sup>A modification patterns may shape distinct transcriptional states by regulating specific gene networks.</p>
<fig id="f14" position="float">
<label>Figure&#xa0;14</label>
<caption>
<p>Construction of TB subtypes under different m<sup>6</sup>A modification patterns. <bold>(A)</bold> The cumulative distribution function of consensus clustering when k=2-9. <bold>(B)</bold> Relative change of area under CDF curve when k=2-9. <bold>(C)</bold> Heat map of the co-occurrence proportion matrix of TB samples when k=2. <bold>(D)</bold> The component analysis was performed in transcriptome maps of different TB subtype. <bold>(E)</bold> The expression heat map of 22 m<sup>6</sup>A related characteristic genes in two modification modes. <bold>(F)</bold> Sankey diagram of two typing construction processes.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1729362-g014.tif">
<alt-text content-type="machine-generated">Panel A shows a consensus cumulative distribution function (CDF) plot with multiple colored lines representing different clusters. Panel B is a delta area plot showing the relative change in areas under the CDF curve for different k values, with a sharp decline at k=3. Panel C displays a consensus matrix heatmap for k=2, highlighting two distinct clusters. Panel D is a principal component analysis (PCA) plot with two groups, cluster-A and cluster-B, shown in blue and red with overlapping ellipses. Panel E provides a heatmap of gene expression across clusters-A and B, with a color gradient from blue for low expression to red for high. Panel F is a Sankey diagram visualizing the flow between datasets and clusters.</alt-text>
</graphic></fig>
</sec>
<sec id="s3_9">
<label>3.9</label>
<title>Functional differences in TB subtypes</title>
<p>As shown in <xref ref-type="fig" rid="f15"><bold>Figure&#xa0;15A</bold></xref>, no significant differences were observed in immune cell infiltration, immune processes, or expression of HLA family genes (<xref ref-type="fig" rid="f15"><bold>Figures&#xa0;15B-E</bold></xref>), suggesting that the differences between the two subtypes might not be driven by immune infiltration. We then employed the GSVA package to convert the expression matrix into a pathway activation score matrix in the &#x201c;h.all.v7.5. symbols&#x201d; gene set. The R package limma was used to compare pathway activation scores between the two subtypes, and a volcano plot was generated (<xref ref-type="fig" rid="f15"><bold>Figure&#xa0;15F</bold></xref>). Subtype A primarily activates the hallmark heme metabolism pathway, whereas subtype B mainly activates the hallmark TGF beta signaling pathway.</p>
<fig id="f15" position="float">
<label>Figure&#xa0;15</label>
<caption>
<p>Functional differences of TB subtypes in different m<sup>6</sup>A modification modes. <bold>(A)</bold> The m<sup>6</sup>A gene expression difference of TB subtypes in two m<sup>6</sup>A modification modes. <bold>(B)</bold> Under the TB subtype, the abundance difference of infiltrating immune cells in different immune microenvironments was evaluated by ssgesa scores. <bold>(C)</bold> The score differences of immune process in TB subtype. <bold>(D)</bold> The abundance of infiltrating immune cells in different immune microenvironments was performed by CIBERSORT score under two different TB subtypes. <bold>(E)</bold> different expression of HLA genes in two TB subtypes <bold>(F)</bold> the volcano map of different HALLMARK pathway between two TB subtype. ns:p&gt;0.05, *:p&lt;0.05, **:p&lt;0.01, ***:p&lt;0.001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1729362-g015.tif">
<alt-text content-type="machine-generated">Box plots display different data comparisons between cluster A (blue) and cluster B (red) across multiple categories. Panels A to E illustrate variables such as gene expression and relative scores, with significance noted. Panel F shows a scatter plot of log fold change, highlighting changes as up, down, or not significant.</alt-text>
</graphic></fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>Numerous reports have revealed that m<sup>6</sup>A regulators are involved in many diseases such as cancers, cardiovascular disorders, abdominal aortic aneurysm and chronic obstructive pulmonary disease. For example, m<sup>6</sup>A can shape the host response to viral infections, such as SARS-CoV-2 (<xref ref-type="bibr" rid="B27">27</xref>), pseudorabies virus infection (<xref ref-type="bibr" rid="B28">28</xref>) and bacterial infection (<xref ref-type="bibr" rid="B29">29</xref>) by modulating the stability and translation of immune-related transcripts, which has attracted extensive attention for exploring m<sup>6</sup>A in TB. However, m<sup>6</sup>A regulators in TB field still remain poorly understood. From my perspective, our conclusions provide scientific investigation and experiments for m<sup>6</sup>A regulators in TB, which will help us find reliable directions for future experimental research on TB and novel targets for effective therapies.</p>
<p>In the present study, we present a comprehensive analysis of the important role of m<sup>6</sup>A modification in TB, combined with clinical validation. First, we identified significant downregulation of multiple crucial m<sup>6</sup>A regulators (METTL3, VIRMA, YTHDF1, YTHDC1, YTHDC2, ELAVL1, and LRPPRC) in the peripheral blood of TB patients, which was consistent between GEO datasets and subsequently confirmed by qRT-PCR, suggesting global dysregulation of m<sup>6</sup>A during TB pathogenesis. Our data, consistent with previous studies, revealed that the expression of YTHDF1, ELAVL1, LRPPRC, and HNRNPC mRNA was obviously downregulated in TB patients compared to healthy control (<xref ref-type="bibr" rid="B30">30</xref>, <xref ref-type="bibr" rid="B31">31</xref>). Meanwhile, in PTB, studies have demonstrated that FTO gene polymorphisms are closely connected with PTB, and the expression of ALKBH5 and FTO levels are reduced in PTB patients (<xref ref-type="bibr" rid="B32">32</xref>). Another report revealed that m<sup>6</sup>A METTL3, METTL14, and WTAP levels were downregulated in PTB. Moreover, variants of METTL14 rs62328061 and WTAP rs11752345 are related to the genetic background of PTB, indicating that these m<sup>6</sup>A regulators play a pivotal role in PTB (<xref ref-type="bibr" rid="B33">33</xref>). Notably, our research combined two GEO datasets and provided new molecules containing METTL3, VIRMA, YTHDC1, and YTHDC2 perspectives on the pathological process of TB and a comprehensive analysis of 22 core m<sup>6</sup>A regulators in the epitranscriptomic landscape of TB. We further developed and validated two diagnostic models based on m<sup>6</sup>A regulator expression profiles, both of which demonstrated excellent discriminatory power between TB patients and healthy controls, highlighting their potential as novel diagnostic biomarkers. Interestingly, these results were confirmed in clinical samples. Our innovative findings revealed that the combined AUC of these m<sup>6</sup>A genes and Ziehl-Neelsen staining for TB was 0.953, which may reduce the missed detection rate of Ziehl-Neelsen staining in clinical settings and significantly improve the diagnostic accuracy for TB infection. The low AUCs of individual genes underscored the multifactorial futures of TB pathogenesis and supported the rationale for developing multi-gene rather than single-gene diagnostic models. As in the research of Ding (<xref ref-type="bibr" rid="B31">31</xref>), they highlight the potential of key m<sup>6</sup>A regulatory genes YTHDF1, HNRNPC, LRPPRC, and ELAVL1 as diagnostic biomarkers for TB through machine learning, which demonstrated their crucial role in TB pathogenesis. We not only revealed the importance of multiple key m<sup>6</sup>A molecules in the diagnosis of tuberculosis from bioinformatic analysis but also confirmed their function in clinical samples and clinical TB tests. We are the first to construct and validate a multivariate diagnostic model based on a panel of m<sup>6</sup>A regulators, revealing superior performance compared to individual markers and even showing additive value to traditional smear microscopy. This may move beyond associations and tangible clinical applications.</p>
<p>In addition to their diagnostic potential, we explored the biological implications of m<sup>6</sup>A modification patterns in TB. Using unsupervised clustering analysis, we identified two distinct m<sup>6</sup>A modification patterns among patients with TB, and each pattern was associated with different immune profiles and biological characteristics. Pattern 1 exhibited higher levels of activated immune cells such as gamma delta T cells and neutrophils, suggesting a more robust immune response. In contrast, pattern 2 was characterized by a predominance of type 1 T helper cells and a relatively milder immune response. These differences in immune microenvironment characteristics might influence the progression and treatment outcomes of TB, highlighting the need for personalized therapeutic strategies based on m<sup>6</sup>A modification patterns, which might offer a potential framework for advancing fundamental research into personalized therapeutic strategies. Importantly, immune subclassification has been successfully applied in the study of cancers and infectious diseases, where it has helped clarify how variations in local immune microenvironments contribute to divergent disease trajectories. In the future, we will focus on elucidating the distinct immune response profiles associated with tuberculosis patterns through detailed molecular and cellular characterizations in larger or independent cohorts. Such investigations will deepen our understanding of TB immunopathology and provide the mechanistic insights necessary for the rational design of pattern-specific interventions. Extensive research has highlighted the pivotal role of gamma delta T cells play multiple crucial roles in anti-TB immunity, as demonstrated in several studies. For instance, gamma delta T cells can produce key antimicrobial cytokines such as interferon-&#x3b3; (IFN-&#x3b3;) and tumor necrosis factor-&#x3b1; (TNF-&#x3b1;), which are crucial for controlling Mycobacterium tuberculosis (Mtb) infection (<xref ref-type="bibr" rid="B34">34</xref>, <xref ref-type="bibr" rid="B35">35</xref>). &#x3b3;&#x3b4; T cells possess cytotoxic functions and can directly kill infected cells through CD16-mediated pathways, which play a particularly prominent role in chronic tuberculosis infection (<xref ref-type="bibr" rid="B36">36</xref>). &#x3b3;&#x3b4; T cells provide rapid protection in the early stages of infection, particularly in terms of mucosal immunity. They are the main circulating &#x3b3;&#x3b4; T cell subset (V&#x3b3;2V&#x3b4;2 T cells) in humans and other primates, and are capable of quickly recognizing microbial phosphoantigens (such as HMBPP) and exerting multifunctional effects, including IL-17 production, thereby playing a key role in the early control of tuberculosis infection (<xref ref-type="bibr" rid="B37">37</xref>, <xref ref-type="bibr" rid="B38">38</xref>). Taken together, these findings implicate m<sup>6</sup>A regulatory genes in the modulation of TB progression via immune and inflammatory mechanisms.</p>
<p>Furthermore, we derived a 22-gene signature from these m<sup>6</sup>A patterns and used it to classify TB patients into two novel subtypes (subtypes A and B). These subtypes, while immunologically similar, were driven by different biological processes: subtype A by heme metabolism and subtype B by TGF-&#x3b2; signaling, revealing a previously unrecognized layer of heterogeneity in TB. Infection with Mycobacterium tuberculosis might affect iron metabolism in the host, and since iron is a key component of heme, it may lead to anemia or oxidative stress. In addition, TGF-&#x3b2; plays a role in immune regulation and may promote immunosuppression in TB (<xref ref-type="bibr" rid="B39">39</xref>). Overall, the m<sup>6</sup>A -derived subtypes were linked to heme metabolism and the TGF-&#x3b2; signaling pathway, revealing a novel axis of TB heterogeneity independent of classic immune infiltration, suggesting that m<sup>6</sup>A modification influences TB pathophysiology through previously unexplored biological pathways.</p>
<p>Our study has several limitations. First, our validation was performed on peripheral blood, which might not fully mirror the complex m<sup>6</sup>A modifications and cellular interactions in the lungs during infection. our findings in PBMCs serve as a foundational discovery. In the future, validation in relevant lung-resident cells or tissues is essential to fully elucidate the localized mechanistic role of m6A modification in TB pathogenesis. The sample size for the clinical validation cohort was also moderate, potentially limiting the statistical power and generalizability of our diagnostic models. Second, although strong associations and patterns were identified, functional experiments to establish causal relationships between specific m<sup>6</sup>A regulators and immune or metabolic phenotypes were lacking. To illustrate these limitations, more samples, including bronchoalveolar lavage fluid (BALF) or granuloma tissues from patients with TB, will be conducted to obtain more precise data. A multicenter study with a larger cohort is required to confirm our findings. Cell culture and animal models will be used to explore the mechanisms by which m<sup>6</sup>A regulators influence specific immune pathways through m<sup>6</sup>A -dependent mechanisms.</p>
<p>In conclusion, our study systematically delineates the dynamic landscape of m<sup>6</sup>A modifications throughout the pathological progression of TB. We identified a cluster of m<sup>6</sup>A -regulated genes and elucidated their potential involvement in the immune microenvironment and the biological heterogeneity of TB. These results help to bridge the current gaps in TB epigenetics and highlight the promising potential of m<sup>6</sup>A -based biomarkers for diagnostic applications and targeted therapeutic interventions. Our results support the hypothesis that m<sup>6</sup>A modification serves as a critical regulatory mechanism influencing TB pathogenesis and progression, laying the foundation for subsequent research on early detection and personalized treatment strategies. This study provides valuable insights that may guide future clinical translation of TB management.</p>
</sec>
</body>
<back>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.</p></sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The study was approved by the Ethics Committee of the First Affiliated Hospital of Chengdu Medical College (Sichuan, China) and conducted in accordance with the Declaration of Helsinki. Written informed consent was obtained from all participants.</p></sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>HD: Conceptualization, Validation, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing. HW: Data curation, Methodology, Software, Validation, Writing &#x2013; review &amp; editing. YY: Resources, Writing &#x2013; review &amp; editing. QY: Resources, Writing &#x2013; review &amp; editing. ZJ: Supervision, Visualization, Writing &#x2013; review &amp; editing. YX: Formal Analysis, Investigation, Supervision, Visualization, Writing &#x2013; review &amp; editing.</p></sec>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p></sec>
<sec id="s10" sec-type="ai-statement">
<title>Generative AI statement</title>
<p>The author(s) declared that generative AI was not used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p></sec>
<sec id="s11" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p></sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<mixed-citation publication-type="book">
<person-group person-group-type="author"><collab>World Health Organization</collab>
</person-group>. <source>Global tuberculosis report 2020</source>. <publisher-loc>Geneva, Switzerland</publisher-loc>: 
<publisher-name>World Health Organization</publisher-name> (<year>2020</year>). Available online at: <uri xlink:href="https://apps.who.int/iris/handle/10665/336069">https://apps.who.int/iris/handle/10665/336069</uri> (Accessed <date-in-citation content-type="access-date">January 7, 2026</date-in-citation>).
</mixed-citation>
</ref>
<ref id="B2">
<label>2</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Lange</surname> <given-names>C</given-names></name>
<name><surname>Chesov</surname> <given-names>D</given-names></name>
<name><surname>Heyckendorf</surname> <given-names>J</given-names></name>
<name><surname>Leung</surname> <given-names>CC</given-names></name>
<name><surname>Udwadia</surname> <given-names>Z</given-names></name>
<name><surname>Dheda</surname> <given-names>K</given-names></name>
</person-group>. 
<article-title>Drug-resistant tuberculosis: An update on disease burden, diagnosis and treatment</article-title>. <source>Respirology</source>. (<year>2018</year>) <volume>23</volume>:<page-range>656&#x2013;73</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/resp.13304</pub-id>, PMID: <pub-id pub-id-type="pmid">29641838</pub-id>
</mixed-citation>
</ref>
<ref id="B3">
<label>3</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Getahun</surname> <given-names>H</given-names></name>
<name><surname>Matteelli</surname> <given-names>A</given-names></name>
<name><surname>Chaisson</surname> <given-names>RE</given-names></name>
<name><surname>Raviglione</surname> <given-names>M</given-names></name>
</person-group>. 
<article-title>Latent Mycobacterium tuberculosis infection</article-title>. <source>N Engl J Med</source>. (<year>2015</year>) <volume>372</volume>:<page-range>2127&#x2013;35</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1056/NEJMra1405427</pub-id>, PMID: <pub-id pub-id-type="pmid">26017823</pub-id>
</mixed-citation>
</ref>
<ref id="B4">
<label>4</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Philips</surname> <given-names>JA</given-names></name>
<name><surname>Ernst</surname> <given-names>JD</given-names></name>
</person-group>. 
<article-title>Tuberculosis pathogenesis and immunity</article-title>. <source>Annu Rev Pathol</source>. (<year>2012</year>) <volume>7</volume>:<page-range>353&#x2013;84</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1146/annurev-pathol-011811-132458</pub-id>, PMID: <pub-id pub-id-type="pmid">22054143</pub-id>
</mixed-citation>
</ref>
<ref id="B5">
<label>5</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Tong</surname> <given-names>J</given-names></name>
<name><surname>Flavell</surname> <given-names>RA</given-names></name>
<name><surname>Li</surname> <given-names>HB</given-names></name>
</person-group>. 
<article-title>RNA m<sup>6</sup>A modification and its function in diseases</article-title>. <source>Front Med</source>. (<year>2018</year>) <volume>12</volume>:<page-range>481&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11684-018-0654-8</pub-id>, PMID: <pub-id pub-id-type="pmid">30097961</pub-id>
</mixed-citation>
</ref>
<ref id="B6">
<label>6</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Wang</surname> <given-names>Q</given-names></name>
<name><surname>Zhang</surname> <given-names>H</given-names></name>
<name><surname>Chen</surname> <given-names>Q</given-names></name>
<name><surname>Wan</surname> <given-names>Z</given-names></name>
<name><surname>Gao</surname> <given-names>X</given-names></name>
<name><surname>Qian</surname> <given-names>W</given-names></name>
</person-group>. 
<article-title>Identification of METTL14 in kidney renal clear cell carcinoma using bioinformatics analysis</article-title>. <source>Dis Markers</source>. (<year>2019</year>) <volume>2019</volume>:<elocation-id>5648783</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1155/2019/5648783</pub-id>, PMID: <pub-id pub-id-type="pmid">31976022</pub-id>
</mixed-citation>
</ref>
<ref id="B7">
<label>7</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Wu</surname> <given-names>R</given-names></name>
<name><surname>Jiang</surname> <given-names>D</given-names></name>
<name><surname>Wang</surname> <given-names>Y</given-names></name>
<name><surname>Wang</surname> <given-names>XN</given-names></name>
</person-group>. 
<article-title>(6)-methyladenosine (m(6)A) methylation in mRNA with A dynamic and reversible epigenetic modification</article-title>. <source>Mol Biotechnol</source>. (<year>2016</year>) <volume>58</volume>:<page-range>450&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s12033-016-9947-9</pub-id>, PMID: <pub-id pub-id-type="pmid">27179969</pub-id>
</mixed-citation>
</ref>
<ref id="B8">
<label>8</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Du</surname> <given-names>J</given-names></name>
<name><surname>Hou</surname> <given-names>K</given-names></name>
<name><surname>Mi</surname> <given-names>S</given-names></name>
<name><surname>Ji</surname> <given-names>H</given-names></name>
<name><surname>Ma</surname> <given-names>S</given-names></name>
<name><surname>Ba</surname> <given-names>Y</given-names></name>
<etal/>
</person-group>. 
<article-title>Malignant evaluation and clinical prognostic values of m<sup>6</sup>A RNA methylation regulators in glioblastoma</article-title>. <source>Front Oncol</source>. (<year>2020</year>) <volume>10</volume>:<elocation-id>208</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fonc.2020.00208</pub-id>, PMID: <pub-id pub-id-type="pmid">32211315</pub-id>
</mixed-citation>
</ref>
<ref id="B9">
<label>9</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Liu</surname> <given-names>ZX</given-names></name>
<name><surname>Li</surname> <given-names>LM</given-names></name>
<name><surname>Sun</surname> <given-names>HL</given-names></name>
<name><surname>Liu</surname> <given-names>SM</given-names></name>
</person-group>. 
<article-title>Link between m<sup>6</sup>A modification and cancers</article-title>. <source>Front Bioeng Biotechnol</source>. (<year>2018</year>) <volume>6</volume>:<elocation-id>89</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fbioe.2018.00089</pub-id>, PMID: <pub-id pub-id-type="pmid">30062093</pub-id>
</mixed-citation>
</ref>
<ref id="B10">
<label>10</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Li</surname> <given-names>Y</given-names></name>
<name><surname>Xiao</surname> <given-names>J</given-names></name>
<name><surname>Bai</surname> <given-names>J</given-names></name>
<name><surname>Tian</surname> <given-names>Y</given-names></name>
<name><surname>Qu</surname> <given-names>Y</given-names></name>
<name><surname>Chen</surname> <given-names>X</given-names></name>
<etal/>
</person-group>. 
<article-title>Molecular characterization and clinical relevance of m<sup>6</sup>A regulators across 33 cancer types</article-title>. <source>Mol Cancer</source>. (<year>2019</year>) <volume>18</volume>:<fpage>137</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12943-019-1066-3</pub-id>, PMID: <pub-id pub-id-type="pmid">31521193</pub-id>
</mixed-citation>
</ref>
<ref id="B11">
<label>11</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Hao</surname> <given-names>H</given-names></name>
<name><surname>Hao</surname> <given-names>S</given-names></name>
<name><surname>Chen</surname> <given-names>H</given-names></name>
<name><surname>Chen</surname> <given-names>Z</given-names></name>
<name><surname>Zhang</surname> <given-names>Y</given-names></name>
<name><surname>Wang</surname> <given-names>J</given-names></name>
<etal/>
</person-group>. 
<article-title>N6-methyladenosine modification and METTL3 modulate enterovirus 71 replication</article-title>. <source>Nucleic Acids Res</source>. (<year>2019</year>) <volume>47</volume>:<page-range>362&#x2013;74</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gky1007</pub-id>, PMID: <pub-id pub-id-type="pmid">30364964</pub-id>
</mixed-citation>
</ref>
<ref id="B12">
<label>12</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Gokhale</surname> <given-names>NS</given-names></name>
<name><surname>McIntyre</surname> <given-names>ABR</given-names></name>
<name><surname>McFadden</surname> <given-names>MJ</given-names></name>
<name><surname>Roder</surname> <given-names>AE</given-names></name>
<name><surname>Kennedy</surname> <given-names>EM</given-names></name>
<name><surname>Gandara</surname> <given-names>JA</given-names></name>
<etal/>
</person-group>. 
<article-title>N6-methyladenosine in flaviviridae viral RNA genomes regulates infection</article-title>. <source>Cell Host Microbe</source>. (<year>2016</year>) <volume>20</volume>:<page-range>654&#x2013;65</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.chom.2016.09.015</pub-id>, PMID: <pub-id pub-id-type="pmid">27773535</pub-id>
</mixed-citation>
</ref>
<ref id="B13">
<label>13</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Hao</surname> <given-names>WY</given-names></name>
<name><surname>Lou</surname> <given-names>Y</given-names></name>
<name><surname>Hu</surname> <given-names>GY</given-names></name>
<name><surname>Qian</surname> <given-names>CY</given-names></name>
<name><surname>Liang</surname> <given-names>WR</given-names></name>
<name><surname>Zhao</surname> <given-names>J</given-names></name>
<etal/>
</person-group>. 
<article-title>RNA m<sup>6</sup>A reader YTHDF1 facilitates inflammation via enhancing NLRP3 translation</article-title>. <source>Biochem Biophys Res Commun</source>. (<year>2022</year>) <volume>616</volume>:<fpage>76</fpage>&#x2013;<lpage>81</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bbrc.2022.05.076</pub-id>, PMID: <pub-id pub-id-type="pmid">35649302</pub-id>
</mixed-citation>
</ref>
<ref id="B14">
<label>14</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Cai</surname> <given-names>Y</given-names></name>
<name><surname>Yang</surname> <given-names>Q</given-names></name>
<name><surname>Tang</surname> <given-names>Y</given-names></name>
<name><surname>Zhang</surname> <given-names>M</given-names></name>
<name><surname>Liu</surname> <given-names>H</given-names></name>
<name><surname>Zhang</surname> <given-names>G</given-names></name>
<etal/>
</person-group>. 
<article-title>Increased complement C1q level marks active disease in human tuberculosis</article-title>. <source>PloS One</source>. (<year>2014</year>) <volume>9</volume>:<fpage>e92340</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0092340</pub-id>, PMID: <pub-id pub-id-type="pmid">24647646</pub-id>
</mixed-citation>
</ref>
<ref id="B15">
<label>15</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Blankley</surname> <given-names>S</given-names></name>
<name><surname>Graham</surname> <given-names>CM</given-names></name>
<name><surname>Turner</surname> <given-names>J</given-names></name>
<name><surname>Berry</surname> <given-names>MP</given-names></name>
<name><surname>Bloom</surname> <given-names>CI</given-names></name>
<name><surname>Xu</surname> <given-names>Z</given-names></name>
<etal/>
</person-group>. 
<article-title>The transcriptional signature of active tuberculosis reflects symptom status in extra-pulmonary and pulmonary tuberculosis</article-title>. <source>PloS One</source>. (<year>2016</year>) <volume>11</volume>:<fpage>e0162220</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0162220</pub-id>, PMID: <pub-id pub-id-type="pmid">27706152</pub-id>
</mixed-citation>
</ref>
<ref id="B16">
<label>16</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Ritchie</surname> <given-names>ME</given-names></name>
<name><surname>Phipson</surname> <given-names>B</given-names></name>
<name><surname>Wu</surname> <given-names>D</given-names></name>
<name><surname>Hu</surname> <given-names>Y</given-names></name>
<name><surname>Law</surname> <given-names>CW</given-names></name>
<name><surname>Shi</surname> <given-names>W</given-names></name>
<etal/>
</person-group>. 
<article-title>limma powers differential expression analyses for RNA-sequencing and microarray studies</article-title>. <source>Nucleic Acids Res</source>. (<year>2015</year>) <volume>43</volume>:<fpage>e47</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkv007</pub-id>, PMID: <pub-id pub-id-type="pmid">25605792</pub-id>
</mixed-citation>
</ref>
<ref id="B17">
<label>17</label>
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name><surname>Kolde</surname> <given-names>R</given-names></name>
<name><surname>Kolde</surname> <given-names>M</given-names></name>
</person-group>. <source>Package &#x2018;pheatmap&#x2019;</source>, Vol. <volume>1</volume>. 
<publisher-name>The Comprehensive R Archive Network(CRAN)</publisher-name> (<year>2015</year>). p. <fpage>790</fpage>.
</mixed-citation>
</ref>
<ref id="B18">
<label>18</label>
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name><surname>Wickham</surname> <given-names>H</given-names></name>
</person-group>. <source>ggplot2</source> Vol. <volume>3</volume>. <publisher-loc>Hoboken, New Jersey, USA</publisher-loc>: 
<publisher-name>John Wiley &amp; Sons, Inc.</publisher-name> (<year>2011</year>) p. <page-range>180&#x2013;5</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/wics.147</pub-id>
</mixed-citation>
</ref>
<ref id="B19">
<label>19</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Friedman</surname> <given-names>J</given-names></name>
<name><surname>Hastie</surname> <given-names>T</given-names></name>
<name><surname>Tibshirani</surname> <given-names>R</given-names></name>
</person-group>. 
<article-title>Regularization paths for generalized linear models via coordinate descent</article-title>. <source>J Stat Software</source>. (<year>2010</year>) <volume>33</volume>:<fpage>1</fpage>&#x2013;<lpage>22</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.18637/jss.v033.i01</pub-id>, PMID: <pub-id pub-id-type="pmid">20808728</pub-id>
</mixed-citation>
</ref>
<ref id="B20">
<label>20</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>H&#xe4;nzelmann</surname> <given-names>S</given-names></name>
<name><surname>Castelo</surname> <given-names>R</given-names></name>
<name><surname>Guinney</surname> <given-names>J</given-names></name>
</person-group>. 
<article-title>GSVA: gene set variation analysis for microarray and RNA-seq data</article-title>. <source>BMC Bioinf</source>. (<year>2013</year>) <volume>14</volume>:<elocation-id>7</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1471-2105-14-7</pub-id>, PMID: <pub-id pub-id-type="pmid">23323831</pub-id>
</mixed-citation>
</ref>
<ref id="B21">
<label>21</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Zhang</surname> <given-names>B</given-names></name>
<name><surname>Wu</surname> <given-names>Q</given-names></name>
<name><surname>Li</surname> <given-names>B</given-names></name>
<name><surname>Wang</surname> <given-names>D</given-names></name>
<name><surname>Wang</surname> <given-names>L</given-names></name>
<name><surname>Zhou</surname> <given-names>YL</given-names></name>
</person-group>. 
<article-title>m<sup>6</sup>A regulator-mediated methylation modification patterns and tumor microenvironment infiltration characterization in gastric cancer</article-title>. <source>Mol Cancer</source>. (<year>2020</year>) <volume>19</volume>:<fpage>53</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12943-020-01170-0</pub-id>, PMID: <pub-id pub-id-type="pmid">32164750</pub-id>
</mixed-citation>
</ref>
<ref id="B22">
<label>22</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Bhattacharya</surname> <given-names>S</given-names></name>
<name><surname>Dunn</surname> <given-names>P</given-names></name>
<name><surname>Thomas</surname> <given-names>CG</given-names></name>
<name><surname>Smith</surname> <given-names>B</given-names></name>
<name><surname>Schaefer</surname> <given-names>H</given-names></name>
<name><surname>Chen</surname> <given-names>J</given-names></name>
<etal/>
</person-group>. 
<article-title>ImmPort, toward repurposing of open access immunological assay data for translational and clinical research</article-title>. <source>Sci Data</source>. (<year>2018</year>) <volume>5</volume>:<fpage>180015</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/sdata.2018.15</pub-id>, PMID: <pub-id pub-id-type="pmid">29485622</pub-id>
</mixed-citation>
</ref>
<ref id="B23">
<label>23</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Wilkerson</surname> <given-names>MD</given-names></name>
<name><surname>Hayes</surname> <given-names>DN</given-names></name>
</person-group>. 
<article-title>ConsensusClusterPlus: a class discovery tool with confidence assessments and item tracking</article-title>. <source>Bioinformatics</source>. (<year>2010</year>) <volume>26</volume>:<page-range>1572&#x2013;3</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/bioinformatics/btq170</pub-id>, PMID: <pub-id pub-id-type="pmid">20427518</pub-id>
</mixed-citation>
</ref>
<ref id="B24">
<label>24</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Yu</surname> <given-names>G</given-names></name>
<name><surname>Wang</surname> <given-names>LG</given-names></name>
<name><surname>Han</surname> <given-names>Y</given-names></name>
<name><surname>He</surname> <given-names>QY</given-names></name>
</person-group>. 
<article-title>clusterProfiler: an R package for comparing biological themes among gene clusters</article-title>. <source>OMICS</source>. (<year>2012</year>) <volume>16</volume>:<page-range>284&#x2013;7</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1089/omi.2011.0118</pub-id>, PMID: <pub-id pub-id-type="pmid">22455463</pub-id>
</mixed-citation>
</ref>
<ref id="B25">
<label>25</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Liberzon</surname> <given-names>A</given-names></name>
<name><surname>Subramanian</surname> <given-names>A</given-names></name>
<name><surname>Pinchback</surname> <given-names>R</given-names></name>
<name><surname>Thorvaldsd&#xf3;ttir</surname> <given-names>H</given-names></name>
<name><surname>Tamayo</surname> <given-names>P</given-names></name>
<name><surname>Mesirov</surname> <given-names>JP</given-names></name>
</person-group>. 
<article-title>Molecular signatures database (MSigDB) 3</article-title>. <source>0 Bioinf</source>. (<year>2011</year>) <volume>27</volume>:<page-range>1739&#x2013;40</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/bioinformatics/btr260</pub-id>, PMID: <pub-id pub-id-type="pmid">21546393</pub-id>
</mixed-citation>
</ref>
<ref id="B26">
<label>26</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Liberzon</surname> <given-names>A</given-names></name>
<name><surname>Birger</surname> <given-names>C</given-names></name>
<name><surname>Thorvaldsd&#xf3;ttir</surname> <given-names>H</given-names></name>
<name><surname>Ghandi</surname> <given-names>M</given-names></name>
<name><surname>Mesirov</surname> <given-names>JP</given-names></name>
<name><surname>Tamayo</surname> <given-names>P</given-names></name>
</person-group>. 
<article-title>The Molecular Signatures Database (MSigDB) hallmark gene set collection</article-title>. <source>Cell Syst</source>. (<year>2015</year>) <volume>1</volume>:<page-range>417&#x2013;25</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cels.2015.12.004</pub-id>, PMID: <pub-id pub-id-type="pmid">26771021</pub-id>
</mixed-citation>
</ref>
<ref id="B27">
<label>27</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Li</surname> <given-names>N</given-names></name>
<name><surname>Hui</surname> <given-names>H</given-names></name>
<name><surname>Bray</surname> <given-names>B</given-names></name>
<name><surname>Gonzalez</surname> <given-names>GM</given-names></name>
<name><surname>Zeller</surname> <given-names>M</given-names></name>
<name><surname>Anderson</surname> <given-names>KG</given-names></name>
<etal/>
</person-group>. 
<article-title>METTL3 regulates viral m<sup>6</sup>A RNA modification and host cell innate immune responses during SARS-CoV-2 infection</article-title>. <source>Cell Rep</source>. (<year>2021</year>) <volume>35</volume>:<elocation-id>109091</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.celrep.2021.109091</pub-id>, PMID: <pub-id pub-id-type="pmid">33961823</pub-id>
</mixed-citation>
</ref>
<ref id="B28">
<label>28</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Wang</surname> <given-names>L</given-names></name>
<name><surname>Qiu</surname> <given-names>X</given-names></name>
<name><surname>Wang</surname> <given-names>L</given-names></name>
<name><surname>Yang</surname> <given-names>X</given-names></name>
<name><surname>Li</surname> <given-names>M</given-names></name>
<name><surname>Zhao</surname> <given-names>X</given-names></name>
<etal/>
</person-group>. 
<article-title>ERK-METTL3 axis acts as a novel regulator of antiviral innate immunity combating pseudorabies virus infection</article-title>. <source>PloS Pathog</source>. (<year>2025</year>) <volume>21</volume>:<fpage>e1013234</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.ppat.1013234</pub-id>, PMID: <pub-id pub-id-type="pmid">40802811</pub-id>
</mixed-citation>
</ref>
<ref id="B29">
<label>29</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Si</surname> <given-names>X</given-names></name>
<name><surname>Chen</surname> <given-names>X</given-names></name>
<name><surname>Guo</surname> <given-names>B</given-names></name>
<name><surname>Liao</surname> <given-names>Z</given-names></name>
<name><surname>Yan</surname> <given-names>X</given-names></name>
<name><surname>Qi</surname> <given-names>P</given-names></name>
</person-group>. 
<article-title>The role of methyltransferase-like 3 (METTL3) in immune response modulation in bivalve (Mytilus coruscus) during bacterial infection</article-title>. <source>Fish Shellfish Immunol</source>. (<year>2025</year>) <volume>157</volume>:<elocation-id>110094</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fsi.2024.110094</pub-id>, PMID: <pub-id pub-id-type="pmid">39716580</pub-id>
</mixed-citation>
</ref>
<ref id="B30">
<label>30</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Li</surname> <given-names>HM</given-names></name>
<name><surname>Tang</surname> <given-names>F</given-names></name>
<name><surname>Wang</surname> <given-names>LJ</given-names></name>
<name><surname>Huang</surname> <given-names>Q</given-names></name>
<name><surname>Pan</surname> <given-names>HF</given-names></name>
<name><surname>Zhang</surname> <given-names>TP</given-names></name>
</person-group>. 
<article-title>Association of N6-methyladenosine readers' genes variation and expression level with pulmonary tuberculosis</article-title>. <source>Front Public Health</source>. (<year>2022</year>) <volume>10</volume>:<elocation-id>925303</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpubh.2022.925303</pub-id>, PMID: <pub-id pub-id-type="pmid">36072379</pub-id>
</mixed-citation>
</ref>
<ref id="B31">
<label>31</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Ding</surname> <given-names>S</given-names></name>
<name><surname>Gao</surname> <given-names>J</given-names></name>
<name><surname>Huang</surname> <given-names>C</given-names></name>
<name><surname>Zhou</surname> <given-names>Y</given-names></name>
<name><surname>Yang</surname> <given-names>Y</given-names></name>
<name><surname>Cai</surname> <given-names>Z</given-names></name>
</person-group>. 
<article-title>Identification of diagnostic biomarkers and molecular subtype analysis associated with m<sup>6</sup>A in Tuberculosis immunopathology using machine learning</article-title>. <source>Sci Rep</source>. (<year>2024</year>) <volume>14</volume>:<fpage>29982</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41598-024-81790-4</pub-id>, PMID: <pub-id pub-id-type="pmid">39622968</pub-id>
</mixed-citation>
</ref>
<ref id="B32">
<label>32</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Zhang</surname> <given-names>TP</given-names></name>
<name><surname>Li</surname> <given-names>R</given-names></name>
<name><surname>Wang</surname> <given-names>LJ</given-names></name>
<name><surname>Li</surname> <given-names>HM</given-names></name>
</person-group>. 
<article-title>Impact of m<sup>6</sup>A demethylase (ALKBH5, FTO) genetic polymorphism and expression levels on the development of pulmonary tuberculosis</article-title>. <source>Front Cell Infect Microbiol</source>. (<year>2022</year>) <volume>12</volume>:<elocation-id>1074380</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fcimb.2022.1074380</pub-id>, PMID: <pub-id pub-id-type="pmid">36619747</pub-id>
</mixed-citation>
</ref>
<ref id="B33">
<label>33</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Zhang</surname> <given-names>TP</given-names></name>
<name><surname>Li</surname> <given-names>R</given-names></name>
<name><surname>Wang</surname> <given-names>LJ</given-names></name>
<name><surname>Huang</surname> <given-names>Q</given-names></name>
<name><surname>Li</surname> <given-names>HM</given-names></name>
</person-group>. 
<article-title>Roles of the m<sup>6</sup>A methyltransferases METTL3, METTL14, and WTAP in pulmonary tuberculosis</article-title>. <source>Front Immunol</source>. (<year>2022</year>) <volume>13</volume>:<elocation-id>992628</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2022.992628</pub-id>, PMID: <pub-id pub-id-type="pmid">36569923</pub-id>
</mixed-citation>
</ref>
<ref id="B34">
<label>34</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Wei</surname> <given-names>J</given-names></name>
<name><surname>Guo</surname> <given-names>F</given-names></name>
<name><surname>Song</surname> <given-names>Y</given-names></name>
<name><surname>Feng</surname> <given-names>T</given-names></name>
<name><surname>Wang</surname> <given-names>Y</given-names></name>
<name><surname>Xu</surname> <given-names>K</given-names></name>
<etal/>
</person-group>. 
<article-title>Analysis of the components of Mycobacterium tuberculosis heat-resistant antigen (Mtb-HAg) and its regulation of &#x3b3;&#x3b4; T-cell function</article-title>. <source>Cell Mol Biol Lett</source>. (<year>2024</year>) <volume>29</volume>:<fpage>70</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s11658-024-00585-7</pub-id>, PMID: <pub-id pub-id-type="pmid">38741147</pub-id>
</mixed-citation>
</ref>
<ref id="B35">
<label>35</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Felgueres</surname> <given-names>MJ</given-names></name>
<name><surname>Esteso</surname> <given-names>G</given-names></name>
<name><surname>Garc&#xed;a-Jim&#xe9;nez</surname> <given-names>&#xc1;F</given-names></name>
<name><surname>Bengur&#xed;a</surname> <given-names>A</given-names></name>
<name><surname>V&#xe1;zquez</surname> <given-names>E</given-names></name>
<name><surname>Aguil&#xf3;</surname> <given-names>N</given-names></name>
<etal/>
</person-group>. 
<article-title>Cytolytic &#x3b3;&#x3b4; T-cells and IFN&#x3b3;-producing CD4-lymphocytes characterize the early response to MTBVAC tuberculosis vaccine</article-title>. <source>NPJ Vaccines</source>. (<year>2025</year>) <volume>10</volume>:<fpage>58</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41541-025-01110-3</pub-id>, PMID: <pub-id pub-id-type="pmid">40155627</pub-id>
</mixed-citation>
</ref>
<ref id="B36">
<label>36</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Roy Chowdhury</surname> <given-names>R</given-names></name>
<name><surname>Valainis</surname> <given-names>JR</given-names></name>
<name><surname>Dubey</surname> <given-names>M</given-names></name>
<name><surname>von Boehmer</surname> <given-names>L</given-names></name>
<name><surname>Sola</surname> <given-names>E</given-names></name>
<name><surname>Wilhelmy</surname> <given-names>J</given-names></name>
<etal/>
</person-group>. 
<article-title>NK-like CD8 + &#x3b3;&#x3b4; T cells are expanded in persistent Mycobacterium tuberculosis infection</article-title>. <source>Sci Immunol</source>. (<year>2023</year>) <volume>8</volume>:<fpage>eade3525</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/sciimmunol.ade3525</pub-id>, PMID: <pub-id pub-id-type="pmid">37000856</pub-id>
</mixed-citation>
</ref>
<ref id="B37">
<label>37</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Guo</surname> <given-names>F</given-names></name>
<name><surname>Song</surname> <given-names>Y</given-names></name>
<name><surname>Dong</surname> <given-names>S</given-names></name>
<name><surname>Wei</surname> <given-names>J</given-names></name>
<name><surname>Li</surname> <given-names>B</given-names></name>
<name><surname>Xu</surname> <given-names>T</given-names></name>
<etal/>
</person-group>. 
<article-title>Characterization and anti-tuberculosis effects of &#x3b3;&#x3b4; T cells expanded and activated by Mycobacterium tuberculosis heat-resistant antigen</article-title>. <source>Virulence</source>. (<year>2025</year>) <volume>16</volume>:<elocation-id>2462092</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/21505594.2025.2462092</pub-id>, PMID: <pub-id pub-id-type="pmid">39921673</pub-id>
</mixed-citation>
</ref>
<ref id="B38">
<label>38</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Shen</surname> <given-names>L</given-names></name>
<name><surname>Huang</surname> <given-names>D</given-names></name>
<name><surname>Qaqish</surname> <given-names>A</given-names></name>
<name><surname>Frencher</surname> <given-names>J</given-names></name>
<name><surname>Yang</surname> <given-names>R</given-names></name>
<name><surname>Shen</surname> <given-names>H</given-names></name>
<etal/>
</person-group>. 
<article-title>Fast-acting &#x3b3;&#x3b4; T-cell subpopulation and protective immunity against infections</article-title>. <source>Immunol Rev</source>. (<year>2020</year>) <volume>298</volume>:<page-range>254&#x2013;63</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/imr.12927</pub-id>, PMID: <pub-id pub-id-type="pmid">33037700</pub-id>
</mixed-citation>
</ref>
<ref id="B39">
<label>39</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Imperiale</surname> <given-names>BR</given-names></name>
<name><surname>Gamberale</surname> <given-names>A</given-names></name>
<name><surname>Yokobori</surname> <given-names>N</given-names></name>
<name><surname>Garc&#xed;a</surname> <given-names>A</given-names></name>
<name><surname>Bartoletti</surname> <given-names>B</given-names></name>
<name><surname>Aidar</surname> <given-names>O</given-names></name>
<etal/>
</person-group>. 
<article-title>Transforming growth factor-&#x3b2;, Interleukin-23 and interleukin-1&#x3b2; modulate TH22 response during active multidrug-resistant tuberculosis</article-title>. <source>Immunology</source>. (<year>2024</year>) <volume>171</volume>:<fpage>45</fpage>&#x2013;<lpage>59</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/imm.13698</pub-id>, PMID: <pub-id pub-id-type="pmid">37715690</pub-id>
</mixed-citation>
</ref>
</ref-list>
<fn-group>
<fn id="n1" fn-type="custom" custom-type="edited-by">
<p>Edited by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/580061">Guan-Jun Yang</ext-link>, Ningbo University, China</p></fn>
<fn id="n2" fn-type="custom" custom-type="reviewed-by">
<p>Reviewed by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1892849">Valentina Di Salvatore</ext-link>, University of Catania, Italy</p>
<p><ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/3237248">Sima Kazemi</ext-link>, Hamadan University of Medical Sciences, Iran</p></fn>
</fn-group>
</back>
</article>