Peripheral blood and DNA samples from the patients were sent to MyGenostics (Beijing, China) for Whole-exome sequencing (WES) (14). Mutations in the ITPR3 gene were confirmed by Sanger sequencing. The primers for the PCR: ITPR3 Forward primers: CAGGAAGGGCCAAACCGCTAC, Reverse primers: GAGTCCTATCTTGCCCCAGTGAAT.

For the detection of CD107a expression on NK cells as our previously established protocol (15). Peripheral blood mononuclear cells (PBMCs) from patients and healthy controls were stimulated with K562 cells for 4 hours. Following incubation, the cells were retrieved and stained with CD3-Percp (Biolegend), CD56-PE (Biolegend), and CD107a-APC (Biolegend) at room temperature for 30 minutes. The stained cells were then analyzed using a BD celesta flow cytometer.

Magnetic bead-sorted CD4+ T cells were subjected to calcium flux analysis following an established protocol (Blanco et al.) (13). Briefly, 1×10⁶ CD4+ T cells were pre-incubated with 0.6 μg/ml anti-CD3 monoclonal antibody (clone OKT3) for 10 minutes at 37°C in complete RPMI-1640 medium prior to acquisition. Baseline Fluo-4 fluorescence was recorded for 30 seconds under all experimental conditions. Cells were then stimulated with F(ab’)2 fragment (goat anti-mouse IgG, Jackson ImmunoResearch) for anti-CD3 preactivated cells, and then 1 μg/ml ionomycin (Sigma-Aldrich) as a positive control. Calcium flux kinetics were analyzed using FlowJo softwares.

T cell proliferation were evaluated using a carboxyfluorescein succinimidyl ester (CFSE)-based dilution assay and circulating T follicular helper (Tfh) cell subsets analysis using flow cytometry according to established protocols (16). 1×10⁶ PBMCs were labeled with CFSE for cell dye and cell proliferation assessment. PHA or CD3/28 was employed to stimulate T lymphocytes, while F(ab)2’ IgM with CPG was used to stimulate B lymphocytes. The cells were incubated at 37°C, 5% CO2 for 72 hours.

Full-length wild-type (WT) ITPR3 cDNA was obtained from Youbao Biotechnology, Changsha, China. Mutant ITPR3 cDNA was constructed by PCR mutagenesis and subcloned.

into the 7.1-pCMV-3×Flag vector. The sequence is sequenced for confirmation by Sangon Biotech (Shanghai, China). The overexpression experiment in 293T cells was performed according to our previously established protocol (17).

293T cells or 1×10⁶ PBMCs were lysed with protein splitting mixture, and then supernatant was discarded by high-speed centrifugation to obtain protein. Protein were separated by concentrated gel and separation gel, with ITPR3 rabbit monoclonal antibody or Flag labeled, and infrared imager was used for detection and analysis.

This article adopts the diagnostic guidelines of HLH-2004 (18), and meets five of the eight criteria to consider diagnosing HLH. The specific content is shown in Supplementary Table 1 .

Patient 1 (P1) was the first child of non-consanguineous Han Chinese parents, born at full term to healthy parents. His symptoms began in the neonatal period, requiring NICU admission due to acute laryngitis and severe pneumonia. Subsequently, he experienced frequent recurrent upper respiratory tract infections (2–4 episodes/month) and was hospitalized at 6 months of age for severe rotavirus gastroenteritis and streptococcal pneumonia ( Figure 1A ). The patient exhibited global developmental delay with significant retardation in both language and motor development. At 18 months, he was admitted with persistent fever, cough, hepatosplenomegaly, and lymphadenopathy. Admission evaluation showed he was conscious with pale complexion, no skin rash, but with facial and periorbital edema; vital signs included temperature 38.5 °C, respiratory rate 40/min, blood pressure 76/41 mmHg, and oxygen saturation 90%. Laboratory tests revealed: WBC 8.46×10⁹/L, HGB 82 g/L, PLT 142×10⁹/L; peripheral blood smear showed no abnormal erythrocyte or leukocyte morphology; ESR 64 mm/h; PCT 1.53 ng/mL; CRP 20.73 mg/L. Imaging studies demonstrated: chest CT revealed multiple pulmonary infectious lesions consistent with pneumonia; abdominal ultrasound showed mild hepatosplenomegaly, hypoechoic areas around the portal vein sagittal section, enlarged retroperitoneal lymph nodes, ascites, and bilateral cervical lymphadenopathy. Subsequently, he developed progressive cytopenia involving all three lineages (neutrophils, hemoglobin, and platelets), prompting further investigations for suspected HLH ( Figure 1B ). Coagulation and liver function tests revealed hypofibrinogenemia, elevated D-dimer, increased international normalized ratio, hypertriglyceridemia and elevated alanine aminotransferase (ALT). The cytokine profile revealed elevated levels of IL-6, IL-8, IL-10, and IFN-γ. Additionally, he exhibited hyperferritinemia and elevated soluble IL-2 receptor (sCD25) ( Table 1 ). His natural killer (NK) cell count and activity were normal ( Supplementary Figure 1 ). Bone marrow cytology demonstrated the presence of hemophagocytic macrophages ( Figure 2A ). Consequently, based on the HLH-2004 diagnostic criteria, the patient was diagnosed with HLH (meeting 7 out of 8 diagnostic criteria, including fever, hepatosplenomegaly, trilineage cytopenia, hypertriglyceridemia, hypofibrinogenemia, the presence of hemophagocytes in the bone marrow, hyperferritinemia, and elevated sCD25 levels) ( Supplementary Table 1 ) (18). Subsequent investigations for infectious etiologies showed reactive EBV capsid antigen IgM (>160) with EBV nuclear antigen IgG at 5.31 U/mL, positive CMV capsid antigen IgM but negative CMV nuclear antigen IgG. Blood PCR confirmed high EBV viral load (3.13×10⁶ copies/mL, reference: <400 copies/mL). Blood cultures grew Staphylococcus aureus, while metagenomic next-generation sequencing (mNGS) of sputum detected bocavirus type 1 (432 sequence reads), Stenotrophomonas maltophilia (500 sequence reads), and human herpesvirus 4 EBV (2193 sequence reads) (19).

P1 received combination therapy with glucocorticoids (methylprednisolone 100 mg/day for 3 days, then 50 mg/day for 6 days, followed by dexamethasone 4.5 mg/day for 3 days) and immunosuppressants (ruxolitinib 10 mg/day for 12 days, etoposide 35 mg/day for 2 days). Antimicrobial therapy included piperacillin-tazobactam plus meropenem, teicoplanin, sulfamethoxazole, and ganciclovir antiviral therapy, along with supportive care consisting of intravenous immunoglobulin (10 g/day for 3 days), transfusions of cryoprecipitate, fresh frozen plasma, red blood cells, and fresh platelets, as well as hepatocardiac protection with nutritional support. However, Patient P1 continued to exhibit persistent high fever, developed multi-organ involvement and coagulation disorders, and ultimately succumbed to the disease after treatment discontinuation by the parents against medical advice.

Patient 2 (P2), the second child born to non-consanguineous Han Chinese parents following an uncomplicated delivery. He has a healthy 10-year-old sister. Since early childhood, he has experienced recurrent infections including multiple episodes of pneumonia, sinusitis, otitis media, and tonsillitis ( Figure 1A ). He has also failed to meet numerous developmental and social milestones, demonstrating both language and motor delays, along with physical dysmorphic features including thin hair and nails, square skull configuration, moderate malnutrition, and pectus carinatum. At 2 years and 4 months of age, he presented with recurrent high fever and cough to an outside hospital where he was diagnosed with “bronchopneumonia and suppurative tonsillitis” and treated with azithromycin and penicillin. Due to persistent high fever accompanied by hepatosplenomegaly, cervical lymphadenopathy, and periorbital edema, he was transferred to our institution. Laboratory findings showed: WBC 37×10⁹/L, Hb 99 g/L, PLT 154×10⁹/L, lymphocytes 52.6%, monocytes 11.9×10⁹/L, CRP 18.4 mg/L, and ESR 3 mm/h ( Figure 1C ). Thoracoabdominal CT revealed bilateral pulmonary inflammation, pleural effusions, axillary and hilar lymphadenopathy, hepatosplenomegaly, mesenteric lymphadenopathy, and ascites ( Figure 2B ). Parotid and cervical ultrasound showed no significant parotid abnormalities but demonstrated multiple enlarged cervical lymph nodes. Peripheral blood smear showed increased atypical lymphocytes (28%). EBV serology was positive for both VCA-IgM and IgG, with quantitative PCR confirming high EBV viral load (5.58×10⁴ copies/mL, reference <400 copies/mL). Infectious mononucleosis was suspected.

Subsequently, the patient developed progressive bicytopenia (hemoglobin and platelets). Initially, serum ferritin levels were within normal range. However, the patient subsequently developed persistent high fever accompanied by hypofibrinogenemia despite normal triglyceride levels. Elevated cytokines including IL-6, IL-10, and IFN-γ indicated a hyperinflammatory state. Subsequent laboratory tests revealed elevated ferritin and sCD25, along with impaired NK-cell degranulation function ( Table 1 ) ( Figure 2C ). The patient was ultimately diagnosed with infectious mononucleosis-associated HLH as he met at least 7 (including high fever, hepatosplenomegaly, reduced hemoglobin and platelets, hypofibrinogenemia, diminished NK-cell activity, hyperferritinemia, and elevated sCD25 levels) of the HLH-2004 diagnostic criteria one week after admission ( Supplementary Table 1 ) (18). Additional etiological findings including coinfection with Coxsackievirus and Mycoplasma pneumoniae.

Patient P2 received glucocorticoid therapy (dexamethasone 5 mg/day for 6 days, subsequently reduced to 2.5 mg/day for an additional 6 days) combined with immunosuppressive treatment (etoposide 50 mg/dose administered twice at 4-day intervals). Adjunctive therapies included antiviral prophylaxis with ganciclovir tablets (50 mg twice daily orally for 12 days), supportive intravenous immunoglobulin (5 g/day from August 17-19), oral vitamin K₁ supplementation, and transfusion therapy comprising cryoprecipitate, fresh frozen plasma, and packed red blood cells, along with hepatoprotective therapy (Atomeron) and nutritional support. Following this intensive treatment regimen, the patient demonstrated gradual defervescence and clinical improvement without developing neurological or other complications, achieving full recovery and discharge after two weeks of hospitalization. Regrettably, the patient succumbed to unknown causes at home one year later.

WES analysis of both patients revealed no pathogenic variants in known familial HLH-associated genes (such as PRF1, UNC13D, and STX11 et al.) (20). Notably, both patients harbored heterozygous de novo ITPR3 mutations that were absent in all unaffected family members. P1 carried the previously reported ITPR3: c.7570C>T, p.(Arg2524Cys) mutation, while P2 harbored a different nucleotide substitution at the identical position: c.7570C>G, p.(Arg2524Gly) ( Figure 3A ) (12, 13). Notably, both mutations occurred at the same site as previously documented cases, with the affected arginine residue being highly conserved across species ( Figure 3B ). Multiple prediction algorithms consistently classified these variants as pathogenic, supported by CADD scores of 34 and 35, respectively ( Table 2 ). Using AlphaFold2, we further predicted that both R2524G and R2524C substitutions disrupt the interchain salt bridges normally formed by arginine, consistent with previous reports ( Figure 3C ). Based on these findings, we strongly suspect these mutations represent pathogenic variants responsible for our patients’ conditions.

Since we only obtained blood samples from P2, we subsequently focused our analysis on this patient. The ITPR3 protein expression level in P2’s PBMCs was comparable to that of his parents, and overexpression of the mutant ITPR3 protein in 293T cells showed no difference from WT, indicating that the mutation did not affect ITPR3 protein expression ( Figures 4A, B ). However, P2’s T cells exhibited significantly impaired Ca²⁺ influx following either TCR stimulation or ionomycin stimulation, confirming the pathogenicity of the c.7570C>G, p.(Arg2524Gly) mutation ( Figure 4C ). We then analyzed the immunological phenotypes of both patients. During HLH episodes, both patients showed normal or elevated immunoglobulin levels ( Table 1 ). Absolute counts of all lymphocyte subsets were decreased, with reduced percentages of CD27⁺CD45RA⁺ cells (Naive) in both CD4⁺ and CD8⁺ T cell subsets, while CD27⁺CD45RA^- cells (CM) and CD27^-CD45RA^- cells (EM) were increased ( Table 3 ). These findings were consistent with the previously reported senescent T cell phenotype in ITPR3-mutated patients (12, 13). T cell proliferation assays in P2 demonstrated severely impaired proliferation upon either anti-CD3/CD28 or PHA stimulation ( Figure 4D ). However, the proportion of circulating Tfh cells and their subsets in P2’s peripheral blood showed no significant differences compared to healthy controls ( Figure 4E ). Collectively, these results confirm the pathogenicity of the ITPR3 variants in our patients.