<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2025.1652645</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Immunology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Single-cell RNA sequencing and proteomics uncover SIRP&#x3b1;-CD47 immune checkpoint and glycolysis-driven immune evasion in cardiac myxoma</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Zhu</surname>
<given-names>Xinyuan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Gao</surname>
<given-names>Qingle</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2002605/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Dai</surname>
<given-names>Xintong</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1209938/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Sun</surname>
<given-names>Baofa</given-names>
</name>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1606053/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Li</surname>
<given-names>Yanping</given-names>
</name>
<xref ref-type="aff" rid="aff5">
<sup>5</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Zhai</surname>
<given-names>Hongyan</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="aff" rid="aff6">
<sup>6</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2866334/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Shan</surname>
<given-names>Changliang</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/433239/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Department of Cardiovascular Surgery, The Fifth Central Hospital of Tianjin</institution>, <addr-line>Tianjin</addr-line>,&#xa0;<country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>State Key Laboratory of Medicinal Chemical Biology, College of Pharmacy and Tianjin Key Laboratory of Molecular Drug Research, Nankai University</institution>, <addr-line>Tianjin</addr-line>,&#xa0;<country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Tianjin Pharmaceutical Research Institute Co., LTD</institution>, <addr-line>Tianjin</addr-line>,&#xa0;<country>China</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>State Key Laboratory of Medicinal Chemical Biology, College of Life Science, Nankai University</institution>, <addr-line>Tianjin</addr-line>,&#xa0;<country>China</country>
</aff>
<aff id="aff5">
<sup>5</sup>
<institution>Department of Pathology and Institute of Precision Medicine, Jining Medical University</institution>, <addr-line>Jining</addr-line>,&#xa0;<country>China</country>
</aff>
<aff id="aff6">
<sup>6</sup>
<institution>Department of Ultrasound, Tianjin Medical University General Hospital</institution>, <addr-line>Tianjin</addr-line>,&#xa0;<country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2222971/overview">Chunjing Wang</ext-link>, University College London, United Kingdom</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/96770/overview">Dongbo Jiang</ext-link>, Air Force Medical University, China</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/457790/overview">Jianlei Hao</ext-link>, Jinan University, China</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/985298/overview">Bolin Liu</ext-link>, Louisiana State University, United States</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/3111933/overview">Pengbo Yao</ext-link>, Qingdao University, China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Hongyan Zhai, <email xlink:href="mailto:zhaihongyan@tmu.edu.cn">zhaihongyan@tmu.edu.cn</email>; Changliang Shan, <email xlink:href="mailto:changliangshan@nankai.edu.cn">changliangshan@nankai.edu.cn</email>; Yanping Li, <email xlink:href="mailto:yanpingli@mail.jnmc.edu.cn">yanpingli@mail.jnmc.edu.cn</email>; Baofa Sun, <email xlink:href="mailto:sunbf@nankai.edu.cn">sunbf@nankai.edu.cn</email>
</p>
</fn>
<fn fn-type="equal" id="fn003">
<p>&#x2020;These authors have contributed equally to this work</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>01</day>
<month>09</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2025</year>
</pub-date>
<volume>16</volume>
<elocation-id>1652645</elocation-id>
<history>
<date date-type="received">
<day>24</day>
<month>06</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>05</day>
<month>08</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Zhu, Gao, Dai, Sun, Li, Zhai and Shan.</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Zhu, Gao, Dai, Sun, Li, Zhai and Shan</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>Cardiac myxoma (CM), a rare primary cardiac tumor, poses significant life-threatening risks. Current CM research has remained largely limited to clinical case observations and pathological analyses, thus restricting its clinical therapeutic impact. Fundamental research should be urgently strengthened to better support future CM treatment strategies. In this work, single-cell sequencing is used to elucidated the intricate cellular composition of the CM microenvironments. The mechanisms of heart myxoma cell growth are investigated via proteomics and organoid models, while our western blot analysis reveals cardiac myxoma&#x2019;s immune evasion strategies. This study successfully characterizes diverse cell types within the CM microenvironment. Notably, ap-CAF cells are found to effectively recruit immune cells via chemokine secretion, fostering immune microenvironment formation. The work&#x2019;s pseudotime trajectory analysis also demonstrates that CM tumor cells derive from mesenchymal stem cells. Additionally, this work demonstrated that the glycolysis pathway is significantly activated and fuels CM cell growth. Tumor cells exploit the SIRP&#x3b1;-CD47 immune checkpoint to evade the immune system by inhibiting antigen-presenting cell phagocytosis. Tumor-associated macrophages (TAMs) concurrently assume M2 polarization and suppress autoimmune activity through <italic>IL-10</italic>. This research comprehensively examines CM&#x2019;s microenvironmental cellular architecture, metabolic features, and immune escape mechanisms. These work&#x2019;s findings not only deepen the current understanding of CM&#x2019;s biological nature but also offer vital theoretical foundations for developing safer, more effective CM therapies.</p>
</abstract>
<kwd-group>
<kwd>single-cell sequencing</kwd>
<kwd>immune microenvironment</kwd>
<kwd>glycolysis</kwd>
<kwd>immune evasion</kwd>
<kwd>M2 polarization</kwd>
<kwd>IL-10</kwd>
</kwd-group>
<counts>
<fig-count count="10"/>
<table-count count="0"/>
<equation-count count="0"/>
<ref-count count="36"/>
<page-count count="19"/>
<word-count count="7750"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Cancer Immunity and Immunotherapy</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>Primary cardiac tumors (CM) are exceptionally rare: Three-quarters of all CM are histologically classified as benign, predominantly myxomas. The annual incidence of CM is measured at approximately two cases per million individuals (<xref ref-type="bibr" rid="B1">1</xref>, <xref ref-type="bibr" rid="B2">2</xref>). Although considered rare and benign, CM can cause significant morbidity through complications such as tumor stroma detachment, potentially causing vascular occlusion and cerebrovascular events (<xref ref-type="bibr" rid="B3">3</xref>). While surgical resection is currently the gold standard for CM management (<xref ref-type="bibr" rid="B4">4</xref>), this approach poses challenges for elderly high-risk patients, and its postoperative recurrence factors remain poorly understood. Advancing CM intervention strategies necessitates a comprehensive investigation into CM&#x2019;s pathogenic mechanisms and developmental pathways.</p>
<p>Tumor research over recent years has increasingly recognized single-cell transcriptomic sequencing (scRNA-seq) applications in tumor research (<xref ref-type="bibr" rid="B5">5</xref>, <xref ref-type="bibr" rid="B6">6</xref>). Notably, scRNA-seq has substantially propelled cardiovascular disease investigations. Felipe Prosper&#x2019;s work detailed cardiac fibroblast heterogeneity and its dynamic behavior after myocardial infarction, reshaping our understanding of their role in injury response and myocardial remodeling processes (<xref ref-type="bibr" rid="B7">7</xref>). Ali J. Marian revealed through scRNA-seq that extracardiac fibroblasts and epithelial cells produce paracrine mediators that facilitate the epithelial&#x2013;mesenchymal transition. In arrhythmogenic cardiomyopathy (ACM) models, these factors also promote myocardial fibrosis, apoptosis, and the development of arrhythmias and heart failure (<xref ref-type="bibr" rid="B8">8</xref>). Few studies have employed multiomics approaches to examine cardiac myxoma. The synergy between scRNA-seq and proteomics presents a robust methodology for exploring CM biology. scRNA-seq permits the characterization of cellular diversity within CMs and functional dynamics in their microenvironment (<xref ref-type="bibr" rid="B9">9</xref>&#x2013;<xref ref-type="bibr" rid="B11">11</xref>). Thorough analysis of the tumor microenvironment and its constituents can deepen insights into CM pathogenesis and behavior (<xref ref-type="bibr" rid="B12">12</xref>). Multiomics investigations of cardiac myxoma currently remain scarce. Combining multiomics strategies enables the holistic examination of CM microenvironment features and disease mechanisms.</p>
<p>scRNA-seq and proteomic profiling were conducted in this work to uncover CM microenvironment properties and immune evasion tactics. We identified diverse cell populations within CM microenvironments. Notably, apCAFs were found to critically orchestrate immune cell recruitment via chemokine secretion (MIF, ANXA1); moreover, we discovered that despite abundant immune infiltration, tumor cells employ sophisticated evasion strategies. These tumor cells engage the SIRP&#x3b1;-CD47 axis to inhibit antigen-presenting cell phagocytosis, while glycolytic metabolites polarize TAMs toward M2 phenotypes, which secrete IL-10 to dampen immune responses. These coordinated mechanisms allow CM persistence despite immune surveillance.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and methods</title>
<p>The data, all protocols, and study materials will be available to other researchers for purposes of reproducing the results or replicating the procedures that are presented in this article.</p>
<sec id="s2_1">
<title>Human sample collection</title>
<p>Human CM tissues and adjacent non-tumor CM tissues were collected from Tianjin Medical University General Hospital (Tianjin, China) after surgical resection, for scRNA-seq, proteomics, organoid model, and histologic analysis. The clinical CM specimens all have the written consent approving the use of the samples for research purposes from patients. The relevant characteristics were shown in <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table&#xa0;1</bold>
</xref>. The study protocol was approved by Tianjin Medical University General Hospital Ethics Committee.</p>
</sec>
<sec id="s2_2">
<title>CM tissue single-cell processing</title>
<p>CM tissues from three patients (P1, P2, P3) and adjacent non-tumorous tissues from two patients (P1, P3) were subjected to scRNA-seq. After harvesting fresh tissues by surgery, using ice-cold RPMI1640 and Multi-tissue dissociation kit 2 wash and dissociate the tissues as instructions. After removing erythrocytes (using Miltenyi 130-094-183), cell count and viability were assessed using a fluorescence cell analyzer (Countstar<sup>&#xae;</sup> Rigel S2) with AO/PI reagent. According to the results, choose whether to perform debris and dead cell removal using Miltenyi 130-109-398/130-090-101. Finally, the fresh cells were washed twice in RPMI1640, resuspended at a concentration of 1&#xd7;10<sup>6</sup> cells per ml in 1&#xd7;PBS, and supplemented with 0.04% bovine serum albumin.</p>
</sec>
<sec id="s2_3">
<title>10&#xd7; genomics chromium library preparation and sequencing</title>
<p>Single-cell RNA-Seq libraries were prepared with SeekOne<sup>&#xae;</sup> Digital Droplet Single Cell 3&#x2019; library preparation kit. Single-cell separation and capture were achieved by water-in-oil, and nucleic acid modified Barcoded Beads were used for molecular labeling of RNA from different cells. Then high-throughput single-cell transcriptome libraries compatible with Illumina NovaSeq 6000 sequencers were constructed. Finally, the SeekOne<sup>&#xae;</sup>DD single-cell 3 &#x2018;transcriptome Kit was sequenced using Illumina NovaSeq 6000 high-throughput sequencing platform with &#x2265;50,000 reads per cell to ensure the accuracy of the single-cell sequencing data analysis.</p>
</sec>
<sec id="s2_4">
<title>Single-cell RNA quality control and sequencing analysis</title>
<p>SeekOne<sup>&#xae;</sup> Tools were used to perform quality control on the raw sequencing data. Subsequently, Seurat (v4.1.1) was utilized for downstream single-cell sequencing analysis. Cells with over 200 expressed genes and a mitochondrial unique molecular identifier (UMI) rate below 10% passed the cell quality filtering, and mitochondrial genes were removed from the expression table. A total of 55793 met the above quality control requirements.</p>
</sec>
<sec id="s2_5">
<title>Differentially expressed genes and function enrichment analysis</title>
<p>The FindAllMarkers function within the Seurat R package is employed to investigate differentially expressed genes (DEGs) across various cell types, clusters, and groups. Log-transformed fold change threshold greater than 0.5, &#x2018;min.pct&#x2019; greater than 0.25, and p-value less than 0.05 were considered indicative of significantly different genes.</p>
<p>ClusterProfiler (v4.2.0) R package was used to perform gene enrichment analysis using the msigdbr database37. The items of pathway with enrichment score greater than 1 and a p-value less than 0.05 were deemed significant. In addition, the self-constructed gene set (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table&#xa0;2</bold>
</xref>) according to previous studies was scored through the AddModuleScore function in Seurat R package or AUCell (v2.4.0).</p>
<p>Visualization was realized through ggplot2 (v3.3.6), jjAnno (v0.0.3) and Seurat with its own visualization function.</p>
</sec>
<sec id="s2_6">
<title>Cell communication analysis</title>
<p>We performed cell-cell communication analysis with the cellchat software (v1.6.1). According to the Secreted Signaling and Cell-Cell Chat databases, cellchat was used to evaluate the interactions among cells, and we conducted an assessment of the signal intensity transmitted and received by every celltype. The receptor-ligand pairs (SIRPA-CD47) was added to database to fulfill the requirements of analysis. Meanwhile, Circle plots and heatmaps visualized the relationship between the ligands of interest, while violin plots visualized the expression levels of the ligand and receptor.</p>
</sec>
<sec id="s2_7">
<title>Single-cell metabolism analysis</title>
<p>Based on the KEGG metabolic database, we used scMetabolism (v0.2.1) to assess the metabolic pathways across various samples. The resulting metabolic scores was visualized with heatmap.</p>
</sec>
<sec id="s2_8">
<title>Cell trajectory analysis</title>
<p>The monocle (v2.2.6) package was used to analyze tumor cells trajectories. We used differentially expressed genes identified by Seurat to sort cells in pseudo-time order. The visualization functions &#x2018;plot cell trajectory&#x2019; or &#x2018;plot genes in pseudotime&#x2019; were used to plot the minimum spanning tree on cells.</p>
</sec>
<sec id="s2_9">
<title>Evaluation of cell type purity</title>
<p>We utilized ROGUE (v1.0.0) to assess the purity of cell populations within each cluster. By default, a ROGUE score exceeding 0.9 indicates a highly consistent celltype.</p>
</sec>
<sec id="s2_10">
<title>HE staining</title>
<p>HE Staining is one of the principal stains in pathology histology. We used the Hematoxylin-Eosin Stain Kit (Solarbio G1120) to observe the morphology of CM tissue samples and explore the composition of extracellular matrix and tumor microenvironment cells.</p>
</sec>
<sec id="s2_11">
<title>Cell culture</title>
<p>THP-1 is a human monocytic cell line derived from an acute monocytic leukemia patient. The THP1 cells were cultured in RPMI1640 supplemented with 10% fetal bovine serum (FBS) and 0.05mM &#x3b2;-Mercaptoethanol. HEK293T cells were cultured in DMEM with 10% FBS. All cells were cultured at 37&#xb0;C in an incubator supplied with 5% CO<sub>2</sub>.</p>
</sec>
<sec id="s2_12">
<title>Inducing M0 macrophages <italic>in vitro</italic>
</title>
<p>After thawing and culturing THP-1 cells in RPMI-1640 complete medium (supplemented with 0.05 mM &#x3b2;-mercaptoethanol) until they reached logarithmic growth phase, the cells were centrifuged at 800 rpm for 3 minutes. The pellet was resuspended in a measured volume of RPMI1640 complete medium containing 0.1% PMA, adjusted to a density of 2.5&#xd7;1<sup>5</sup> cells/mL, and seeded into 6-well plates at 500,000 cells per well. Following 24 hours of incubation, the old medium was discarded, and adherent cells were washed twice with 1 mL PBS per well before fresh RPMI1640 complete medium (with 0.1% PMA) was added for another 24-hour culture period. Microscopic examination after this second incubation confirmed that the majority of THP-1 cells had adhered and differentiated into M0-type macrophages. Finally, the medium was discarded, non-adherent cells were removed by PBS washing, and fresh RPMI1640 medium was introduced for subsequent experimental treatments.</p>
</sec>
<sec id="s2_13">
<title>Conditioned medium treatment of M0 macrophages</title>
<p>Organoids treated with drugs were subjected to a process where the drug-containing medium was removed and replaced with fresh medium for further culturing over 48 hours. The organoid culture medium was then collected, centrifuged, aspirated, and transferred to a new tube with detailed sample information and time noted. Subsequently, a conditioned medium was prepared by mixing the collected media with fresh media at a 3:7 ratio. Following this, the old medium from culturing M0 macrophages was replaced in a 6-well cell culture plate with the conditioned medium, and the plate was placed in a cell culture incubator for 48 hours after proper documentation. Post-treatment, cell pellets were collected for lysis and protein samples were prepared for Western blot experiments to detect the expression of the target protein.</p>
</sec>
<sec id="s2_14">
<title>Proteomics</title>
<p>CM tissues and adjacent non-tumorous tissues from patients P6, P7, and P8 were used for proteomic analysis. The tissue sample was frozen with liquid nitrogen, followed by lysis solution containing inhibitors. The tissue was then ground with a cold grinder at -35&#xb0;C, and the supernatant was centrifuged to obtain a total protein solution. After measuring the concentration, the solution was aliquoted and stored. Each sample was taken at 50 &#x3bc;g, the concentration was adjusted, DTT was added and incubated, followed by the addition of iodoacetamide and cooling. Acetone was added to precipitate the protein, the supernatant was discarded after centrifugation, the precipitate was collected and acetone was evaporated. The precipitate was dissolved with TEAB, trypsin was added for overnight digestion, followed by freeze-drying and storage. For peptide labeling and detection, TEAB buffer was added to the freeze-dried sample, mixed well, TMT reagent was added for labeling reaction, the reaction was terminated, and freeze-dried for storage. Finally, peptides were identified using chromatography and mass spectrometry.</p>
</sec>
<sec id="s2_15">
<title>Differential analysis</title>
<p>Differential expression proteins were identified based on Log2 (Fold Change) &#x2265; 1 or Log2 (Fold Change) &#x2264; -1 and p-value &lt; 0.05 from t-test.</p>
</sec>
<sec id="s2_16">
<title>Western blot assay</title>
<p>The cells were harvested and lysed using RIPA lysis buffer at 4&#xb0;C. Following centrifugation, the protein concentration was determined with an Ultra Trace Ultraviolet Spectrophotometer. Equal amounts of cell lysate from each sample were then loaded onto SDS-PAGE. The proteins were subsequently transferred onto PVDF membranes (Millipore, USA), blocked with 5% skim milk, and incubated with antibodies targeting PKM2, PFKP, ENO1, TPI1, IL-10, &#x3b2;-actin etc. HRP-conjugated Goat Anti-mouse or Anti-rabbit IgG served as the secondary antibody. The signal was visualized using the Immobilon Western HRP Kit (Millipore, USA).</p>
</sec>
<sec id="s2_17">
<title>Patient-derived organoids construction</title>
<p>&#x200b;Patient-derived primary tissues from P17 were utilized for organoid generation. Collect primary tissue blocks and place them in a protective solution. Prepare the 24-well plate and 96-well plate required for the experiment, and preheat the culture medium and BME gel. Trim the tumor tissue under sterile conditions, remove non-epithelial components, cut into small pieces, and wash by centrifugation with a cleaning solution. Prepare a working solution of digestive enzymes and proceed with tissue digestion. Stop the digestion process at the appropriate time and centrifuge to collect the precipitate. If red blood cells are present, lyse them and centrifuge again. Resuspend cells in organoid culture medium, filter them through a cell strainer, and centrifuge once more. Resuspend the cells in a mixture of BME gel and culture medium at a ratio of 3:1, then quickly dispense it onto the preheated well plate, allowing it to solidify before adding more culture medium. Monitor and change the culture medium every 2&#x2013;3 days while observing the growth of the organoids.</p>
</sec>
<sec id="s2_18">
<title>CellTiter-Glo<sup>&#xae;</sup> 3D Cell Viability Assay</title>
<p>The CellTiter-Glo<sup>&#xae;</sup> 3D Cell Viability Assay is utilized for assessing the viability of cells cultured in a three-dimensional (3D) environment through the measurement of adenosine triphosphate (ATP) levels, which serve as an indicator of cellular metabolic activity. The unique composition of the CellTiter-Glo<sup>&#xae;</sup> 3D Cell Viability Assay reagent is tailored to efficiently lyse cells, specifically optimized for evaluating the viability of microtissues generated in 3D cell culture settings. Notably, this assay obviates the requirement for cell washing, medium removal, or intricate pipetting procedures, as a singular application of the CellTiter-Glo<sup>&#xae;</sup> 3D reagent enables uniform testing, compatible with serum, across various multi-well plate configurations, making it suitable for high-throughput screening applications. The CellTiter-Glo<sup>&#xae;</sup> 3D assay kit has been effectively employed in discerning the viability of 3D microtissues cultured using diverse methodologies, such as cell hanging-drop plates, ultra-low attachment cell culture plates, Matrigel&#x2122;-coated cell culture plates, agarose-coated cell plates, methylcellulose-covered culture medium, and 3D microtissues cultivated within Alvetex<sup>&#xae;</sup> three-dimensional cell culture systems.</p>
</sec>
<sec id="s2_19">
<title>Plasmid construction</title>
<p>The procedure of plasmid assembly involves the selection and design of plasmids, enzymatic digestion and ligation, bacterial transformation, screening and cultivation, as well as plasmid extraction and verification. Initially, the target fragment is isolated from 293T cells using the REL sequence (Forward: CGGAATTCAATGGCCTCCGGTGCGTATAAC; Reverse: CGGGATCCTTATACTTGAAAAAATTCATATGGAAAGGAGTCACTC), and the p3&#xd7;FLAG-CMV plasmid is chosen with the design of the insert gene sequence. Subsequently, the insert fragment is connected to the plasmid backbone through enzymatic digestion and ligation. Following this, the ligated plasmid is introduced into bacteria for the identification of strains containing the recombinant plasmid. Lastly, plasmid DNA is isolated from the selected strains and confirmed to ensure the accuracy of plasmid construction.</p>
</sec>
<sec id="s2_20">
<title>Analysis of c-REL Chip-seq data</title>
<p>After downloading the Chip-seq data of c-REL from the GEO database GSE55105, we loaded the reference genome of the corresponding species in IGV and import the properly formatted Chip-seq data. Following this, the IL-10 promoter region should be precisely located and the binding site of c-REL thoroughly analyzed to determine its binding status in this region. This step is essential for gaining a more comprehensive understanding of the specific role of c-REL in regulating IL-10 expression.</p>
</sec>
<sec id="s2_21">
<title>Statistical analyses</title>
<p>In the statistical analysis, we used t-tests to compare significant differences in extracellular matrix and chemokine gene set scores among different fibroblast cell populations. Additionally, we conducted t-test analyses on the expression levels of the transcription factor REL in various cell groups to assess the significance of its expression levels. Statistical significances were indicated by *P&lt;0.05, **P&lt;0.01, ***P&lt;0.001.</p>
</sec>
<sec id="s2_22">
<title>Code availability</title>
<p>Custom-written scripts used in this study are available from the corresponding author on reasonable request.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>Single-cell analysis reveals the transcriptomic landscape in CM</title>
<p>To elucidate CM pathogenesis and tumor microenvironment features, we enrolled echocardiography-confirmed left atrial CM patients for single-cell sequencing (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). Following stringent quality control, 55,793 cells (13,829 paratumors; 21,109 tumors) were processed using Seurat (<xref ref-type="bibr" rid="B13">13</xref>) (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>). Subsequent analyses identified 24 clusters, with Seurat revealing six cell types: cardiomyocytes (<italic>MYL7</italic>, <italic>ACTC1</italic>, <italic>NPPA</italic>), endothelial cells (<italic>PLVAP</italic>, <italic>ACKR1</italic>, <italic>CCL14</italic>), fibroblasts (<italic>BGN</italic>, <italic>FBLN1</italic>, <italic>EUN</italic>), lymphocytes (<italic>CCL5</italic>, <italic>NKG7</italic>, <italic>CD3D</italic>), myeloid cells (<italic>C1QC</italic>, <italic>C1QB</italic>, <italic>S100A9</italic>), and smooth muscle cells (<italic>ACTA2</italic>, <italic>MYH11</italic>, <italic>MYLK</italic>) (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1C, D</bold>
</xref>). The cellular distribution analysis demonstrated a distinct composition between CM and paratumor tissues: Immune cells (lymphocytes, myeloid cells) indicated greater tumor infiltration, while endothelial and smooth muscle cells predominated in adjacent tissues. Moreover, fibroblasts were distributed in both regions (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1E, F</bold>
</xref>). HE staining validated these microenvironmental differences (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1G</bold>
</xref>). Our ROGUE score (<xref ref-type="bibr" rid="B14">14</xref>) assessment revealed high purity in cardiomyocytes and endothelial cells (scores of &gt;0.8), with other types indicating lower purity (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1H</bold>
</xref>). In addition, the differential gene analysis conducted in this study identified upregulated pathways in CM (TNF&#x3b1;-NF&#x3ba;B signaling, EMT, and TGF&#x3b2; signaling), suggesting their potential roles in CM pathogenesis (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1I, J</bold>
</xref>). Collectively, these findings demonstrate distinct cellular and molecular profiles between CM and paratumor microenvironments.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Single-cell sequencing analysis of the composition of the microenvironment of CM. <bold>(A)</bold> Experimental design and workflow of scRNA-seq of CM. <bold>(B)</bold> Integration of single-cell sequencing samples for t-SNE dimensionality reduction plot. <bold>(C)</bold> t-SNE dimensionality reduction plot shows the infiltrating cell types in the microenvironment of CM. <bold>(D)</bold> Heatmap showing expression levels of specific markers in each cell type. <bold>(E)</bold> Histogram represents the proportional distribution of different cell types in different tissues and samples. <bold>(F)</bold> Sankey diagram showing the distribution of different cell populations. <bold>(G)</bold> HE staining reveals the pathological characteristics of tumor tissue and adjacent tissue. <bold>(H)</bold> Using the ROGUE algorithm to calculate the purity of infiltrating cells in the microenvironment of cardiac myxoma. <bold>(I)</bold> The volcano plot shows the differential gene expression between tumors and adjacent tissues. <bold>(J)</bold> The bar chart displays the enrichment of differential genes between two groups. Identical colors denote the same cell type in <bold>(C-F)</bold>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1652645-g001.tif">
<alt-text content-type="machine-generated">Multifaceted illustration of cardiac myxoma analysis. (A) Workflow illustrating tissue processing and analysis steps, including echocardiography and sequencing. (B, C) t-SNE plots depicting cell clustering by sample and cell type. (D) Heatmap showing gene expression levels across samples. (E) Bar graph detailing cell type ratios within samples. (F) Alluvial diagram linking group to cell type. (G) Histological images comparing normal and tumor tissues. (H) Graphs displaying expression entropy and ROUGE boxplots for cell type classification. (I) Volcano plot of gene expression changes between tumor and normal tissues. (J) Bar graph of pathway analysis highlighting significant biological processes.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_2">
<title>scRNA-seq reveals the origin and functional characteristics of CM</title>
<p>Our initial observations revealed that fibroblasts displayed broad tissue distribution and comparatively low purity (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1H</bold>
</xref>). To characterize fibroblast subtypes, we performed extraction, dimensionality reduction, and clustering. The conducted differential gene analysis distinguished three tumor-associated fibroblast populations: apCAF, vascular CAFs (vCAF), and myofibroblasts (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2A&#x2013;C</bold>
</xref>). Cellular distributions differed significantly between tumor and adjacent tissues&#x2014;apCAFs and tumor cells localized predominantly in tumor regions, while myofibroblasts and vCAFs were enriched in paratumor areas (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>). Further tumor cell subclustering yielded eight distinct groups (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2E</bold>
</xref>). All clusters showed restricted proliferative and metastatic potential based on <italic>MCM2</italic>, <italic>MKI67</italic>, <italic>VEGFA</italic>, and <italic>ERBB2</italic> expression&#x2014;consistent with the benign nature of CM (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2F</bold>
</xref>). Cluster-specific gene analysis revealed unique functional specializations during CM progression (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2G</bold>
</xref>), although all maintained active glucose and amino acid metabolism (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2H</bold>
</xref>). Given the fibroblast-like properties of tumor cells and their shared mesenchymal stem cell (MSC) origin with fibroblasts, we performed pseudotime analysis using MSC markers (<xref ref-type="bibr" rid="B15">15</xref>). This temporal clustering allowed us to organize tumor cells into seven developmental stages (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2I, J</bold>
</xref>). Our tracking of MSC marker expression revealed progressive CD34 upregulation alongside declining <italic>ALCAM</italic>, <italic>CD44</italic>, and <italic>ICAM1</italic> levels (<xref ref-type="bibr" rid="B16">16</xref>) (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2K</bold>
</xref>), indicating complex transcriptional reprogramming during MSC-to-tumor cell transitions.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>scRNA-seq reveals functional heterogeneity and origin of tumor cells. <bold>(A)</bold> Demonstration of the extraction, clustering, and dimensionality reduction effects of fibroblast cells. <bold>(B)</bold> t-SNE dimensionality reduction plot showing cell cluster annotation results. <bold>(C)</bold> Heatmaps are utilized to visually represent the expression levels of specific marker genes associated with four distinct subtypes of fibroblast cells. <bold>(D)</bold> t-SNE dimensionality reduction plot showing the distribution of fibroblast subpopulations. <bold>(E)</bold>, t-SNE dimensionality reduction plot shows that tumor cells have been extracted and divided into 8 clusters. <bold>(F)</bold> Featureplot displaying the gene score of proliferation and metastatic markers. <bold>(G)</bold> Analysis of the characteristic genes of each population of tumor cells reveals their functional heterogeneity. <bold>(H)</bold> KEGG metabolic pathway analysis reveals metabolic characteristics of CM. <bold>(I)</bold> pseudotime trajectory tree of all the tumor cells with different colors indicating different clusters, with darker colors indicating earlier appearance. <bold>(J)</bold> Temporal analysis reveals clustering situations. <bold>(K)</bold> Expression of mesenchymal stem cells marker genes in pseudotime branches.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1652645-g002.tif">
<alt-text content-type="machine-generated">The image contains multiple panels depicting a comprehensive analysis of cardiac myxoma. Panel A shows a t-SNE plot with distinct cell types. Panel B presents a heatmap of gene expression. Panel C is another t-SNE plot colored by clusters. Panel D illustrates a t-SNE plot with an undefined cell type. Panel E focuses on cardiac myxoma proliferation. Panel F distinguishes normal from tumor samples. Panel G is a t-SNE plot indicating clusters. Panel H displays gene expression related to proliferation and metastasis. Panel I presents a heatmap of cluster marker genes. Panel J shows KEGG metabolic pathways. Panel K depicts pseudotime analysis. Panel L is a density plot of pseudotime states. Panel M illustrates gene expression related to mesenchymal stem cell markers across pseudotime.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_3">
<title>Proteomics combined with organoid model reveals vigorous glycolysis in CM</title>
<p>While RNA sequencing offers valuable insights into CM characteristics, proteins serve as the primary functional molecules in biological processes. Consequently, we conducted a proteomic profiling of three CM and adjacent normal tissue pairs, with PCA analysis revealing high intragroup similarity and significant intergroup differences, confirming sample stability (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>). A differential protein analysis identified 194 upregulated and 572 downregulated proteins in the tumor tissues (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>), while a functional enrichment analysis linked upregulated proteins to complement/coagulation cascades, glycolysis, cancer metabolism, and transcriptional dysregulation. In addition, downregulated proteins were associated with the TCA cycle, oxidative phosphorylation, and pyruvate metabolism (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>). We focused on glycolysis as a key cancer metabolic pathway and observed elevated pathway activity in tumor cells using &#x201c;HALLMARK_GLYCOLYSIS&#x201d; scoring (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3D</bold>
</xref>), corroborated by our western blot analysis, which showed upregulated glycolytic and pentose phosphate pathway enzymes (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3E</bold>
</xref>). Organoid models validated these findings, with HE staining confirming tissue fidelity (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3F</bold>
</xref>). Glycolysis inhibitors (MCL, ACT001, CA) and PPP inhibitor physcion effectively suppressed organoid growth and disrupted morphology (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3G</bold>
</xref>). Taken together, the above results indicate that glycolytic pathway activation supports CM survival and proliferation.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Proteomics reveals a robust glycolytic pathway in CM. <bold>(A)</bold> PCA plot shows the dimensionality reduction of tumor samples and adjacent tissue samples. <bold>(B)</bold> Volcano plot showing the differentially expressed genes between CM tissue and adjacent tissue. <bold>(C)</bold> The histogram displays the enrichment results of upregulated and downregulated genes, with the horizontal axis representing the enrichment score. <bold>(D)</bold> Violin reveals higher glycolysis scores in tumor cells. <bold>(E)</bold> Western blot experiment shows the protein expression levels of glycolysis and its bypass pentose phosphate pathway metabolic enzymes. <bold>(F)</bold> HE staining shows the similarity between cardiac myxoma tissue and organoids. <bold>(G)</bold> Detection of IC50 values of inhibitors targeting the glycolytic pathway and its bypass, the pentose phosphate pathway, in CM organoids.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1652645-g003.tif">
<alt-text content-type="machine-generated">Panel A shows a PCA plot with two distinct clusters: tumor samples in blue and control samples in orange. Panel B is a volcano plot displaying gene expression changes, highlighting significantly upregulated (red) and downregulated (blue) genes. Panel C illustrates enriched pathways, with pathways like glycolysis marked as upregulated and others like the citric acid cycle as downregulated. Panel D features a violin plot comparing glycolysis signature scores across different cell types. Panel E displays Western blot results for various proteins in tumor versus normal samples. Panel F shows images of 2D cultured PDOs and tumor tissue at 10 micrometer scale. Panel G presents dose-response curves for four different compounds, indicating their effect on cell viability with IC50 values.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_4">
<title>CAFs participate in reshaping the extracellular matrix environment and recruiting immune cells to infiltrate</title>
<p>While the distinct spatial distribution of CAF subtypes exhibits specialized features, though their functional consequences in CM microenvironment development remain poorly understood. Therefore, this study pursued a deeper characterization of CAF populations was pursued. Differential gene analysis revealed subtype-specific expression profiles across the CAF subgroups (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>). A pathway enrichment analysis of upregulated genes demonstrated functional specialization: Myofibroblasts showed strong associations with EMT, TGF-&#x3b2; signaling, and myogenesis; vCAFs were enriched for angiogenesis-related pathways; and apCAFs were linked to TNF&#x3b1; signaling, inflammatory responses, IL-6/JAK signaling, and complement activation (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>). These findings not only define CAF functional diversity but also highlight their crucial contributions to the formation and progression of CM microenvironments.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>CAF participates in remodeling the extracellular matrix environment and recruiting immune cells. <bold>(A)</bold> Multiple sets of volcano plots demonstrate variations in genetic profiles among different populations of CAFs. <bold>(B)</bold> Bar chart representing KEGG enrichment results, and different colors represent different CAFs. <bold>(C)</bold> Evaluation of CAF population function by scatter plot assessment of ECM and chemokine factor gene set scores. <bold>(D)</bold> Dotplot displaying the expression of ECM and chemokine factor gene sets. <bold>(E)</bold> Cell communication analysis reveals the strength of signal transmission between immune cell populations and CAF populations.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1652645-g004.tif">
<alt-text content-type="machine-generated">A series of data visualizations related to gene expression in different cells. Panel A shows log-fold change graphs comparing myFibroblast, vCAF, and apCAF cells. Panel B features a bar graph of up-regulated gene counts and their corresponding signaling pathways, with p-values indicated. Panel C presents box plots comparing ECM and chemokine scores among apCAF, myFibroblast, and vCAF. Panel D is a heatmap showing expression levels of cytokine and ECM-related genes across different cell types. Panel E illustrates interaction strengths of different cells, represented by differently sized and colored circles.</alt-text>
</graphic>
</fig>
<p>Previous studies have established that cancer-associated fibroblasts (CAFs) principally facilitate tumor microenvironment formation through extracellular matrix (ECM) protein and chemokine secretion. e developed ECM- and chemokine-related gene sets for functional evaluation to precisely characterize CAF populations in CM microenvironments (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4C</bold>
</xref>). Our analysis demonstrated that myofibroblasts exhibited significantly higher ECM gene scores than apCAF and vCAF, with the marked upregulation of collagen-forming genes (<italic>COL1A1</italic> and <italic>COL3A1</italic>) critically contributing to tissue rigidity (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4D</bold>
</xref>). Conversely, apCAFs displayed substantially elevated chemokine gene scores compared to other subtypes, featuring the prominent expression of <italic>MIF</italic>, <italic>CCL</italic>, and <italic>CXCL</italic> family members. Given that chemokines orchestrate immune cell recruitment, these findings suggest that apCAFs may serve as key mediators of immune cell infiltration in CM microenvironments.</p>
<p>We performed a comprehensive cell communication analysis (<xref ref-type="bibr" rid="B17">17</xref>) validate this hypothesis and quantify interaction strengths between CAF subtypes and immune cells (myeloid cells/lymphocytes) in CM microenvironments (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4E</bold>
</xref>). The activated protein CAFs exhibited markedly enhanced connectivity with immune cells, particularly myeloid populations. Through systematic evaluation of ligand-receptor pairs, we identified key cytokine networks (<italic>MIF</italic>, <italic>ANXA1</italic>, <italic>PTN</italic>, <italic>CXCL12</italic>, <italic>NAMPT</italic>, <italic>MDK</italic>, and <italic>C3</italic>) driving CM development, with MIF and ANXA1 showing predominant involvement (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A, B</bold>
</xref>). Mechanistically, activated CAFs secrete MIF and ANXA1, which engage CD44 and FPR1 receptors on immune cells (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5C, D</bold>
</xref>), orchestrating their recruitment into CM lesions. Collectively, these findings demonstrate that CAFs critically sustain the immune microenvironment through MIF/ANXA1-mediated immune cell recruitment.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>CAF participates in remodeling the extracellular matrix environment and recruiting immune cells. <bold>(A)</bold> The circle diagram illustrates the strength of interaction between immune cells and CAF populations. <bold>(B)</bold> Assessment of ligand-receptor interaction strength. <bold>(C)</bold> Heatmap showing the relative contribution of each cell type based on the computed four-network centrality measures of MIF and ANNEXIN signaling network. <bold>(D)</bold> Expression of MIF and ANXA1 signaling transduction network molecules.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1652645-g005.tif">
<alt-text content-type="machine-generated">Network diagrams, bar charts, heatmaps, and violin plots analyzing cell interactions in MIF and ANNEXIN signaling networks. Panel A shows interaction dynamics among apCAF, lymphocyte, myeloid cell, myFibroblast, and vCAF. Panel B illustrates relative contributions of ligand-receptor pairs. Panel C includes heatmaps of MIF and ANNEXIN networks. Panel D presents violin plots for gene expression in different cell types.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_5">
<title>Blocking the signal transmission in antigen-presenting cells leads to the failure of T cell activation</title>
<p>T cells play critical roles in infection defense, tumor cell elimination (<xref ref-type="bibr" rid="B18">18</xref>), and immune regulation. The functional diversity among T-cell subsets enables their comprehensive protection against diverse pathogens and malignant cells. Our analysis classified lymphocytes into 15 distinct clusters (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>), identifying T cells and NK cells using characteristic markers (<italic>CD3D/CD3E</italic> for T cells; <italic>GNLY/GZMB</italic> for NK cells) (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>). Given their predominance, we focused our subsequent analysis on T cell populations (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>), which were further subdivided into CD4+ and CD8+ subsets (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6D, E</bold>
</xref>). Marker-based annotation revealed that CD4+ T cells contained Memory (<italic>IL7R</italic>, <italic>CCL3</italic>, <italic>CCL4</italic>; <italic>LMNA</italic>, <italic>TGFB1</italic>, and <italic>ANXA1</italic>), Naive T cells (<italic>EEF1B2</italic>, <italic>EEF1A1</italic>, and <italic>CCR7</italic>), and Treg cells (FOXP3, TIGIT, and <italic>LTB</italic>; <italic>PDCD1</italic>, <italic>CREM</italic>, and <italic>CD59</italic>) (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6F</bold>
</xref>, left), whereas CD8+ T cells comprised Memory T cells (<italic>GZMK</italic>, <italic>GZMA</italic>, and <italic>CD44</italic>), Exhausted T cells (<italic>LYST</italic>, <italic>CCL4</italic>, <italic>TNFRSF9</italic>; <italic>PDCD1</italic>, <italic>DUSP4</italic>, and <italic>IGFBP4</italic>), Naive T cells (<italic>LTB</italic>, <italic>IL7R</italic>, and <italic>EEF1A1</italic>), and Effector T cells (<italic>ZFP36</italic>, <italic>LMNA</italic>, and <italic>FTH1</italic>) (<xref ref-type="bibr" rid="B19">19</xref>) (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6F</bold>
</xref>, right). This functional heterogeneity not only reflects specialized T-cell activities but also implies significant impacts on overall immune system dynamics.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>scRNA-seq uncovers the diversity and functional states of T cell subpopulations. <bold>(A)</bold> t-SNE dimensionality reduction graph displaying the distribution of lymphocyte. <bold>(B)</bold> The marker genes <italic>CD3D</italic>, <italic>CD3E</italic>, <italic>GNLY</italic>, and <italic>GZMB</italic> identify T cell and NK cell populations and indicate the proportions of cells. <bold>(C)</bold> The t-SNE graph plot demonstrates main clusters in T cells. <bold>(D)</bold> Featureplot displaying the gene expression of CD4 and CD8A. <bold>(E)</bold> t-SNE dimensionality reduction graph showing 5 subtype in CD4 T cells and CD8 T cells separately. <bold>(F)</bold> Heatmap displaying CD4 and CD8 T cell subtypes and their marker genes. <bold>(G)</bold> Dotplot illustrates the expression of T cell activation factors, activation markers, and immune co-stimulatory molecules. The depth of color represents the level of expression, and the size of the dots represents the percentage of cells expressing the gene.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1652645-g006.tif">
<alt-text content-type="machine-generated">t-SNE plots (A, C, D, E) display clustered data points representing cell populations, colored by groups or gene expression. The heatmaps (F) show gene expression levels across CD4 and CD8 T cell clusters. A bubble plot (G) indicates expression percentages and averages for key genes.</alt-text>
</graphic>
</fig>
<p>T-cell cytotoxic activity requires prior activation through a dual-signal mechanism. The first activation signal originates from T-cell receptor (TCR) engagement with MHC/antigen peptide complexes, delivering antigen-specific recognition. Costimulatory molecules on antigen-presenting cells concurrently provide the essential second signal. This coordinated dual-signal reception triggers characteristic T-cell activation markers (<xref ref-type="bibr" rid="B20">20</xref>).</p>
<p>We examined cytokine secretion profiles (<italic>IL-2</italic>, <italic>IL-4</italic>, <italic>IL-6</italic>, and <italic>IFNG</italic>) (<xref ref-type="bibr" rid="B21">21</xref>&#x2013;<xref ref-type="bibr" rid="B24">24</xref>) from activated T cells (<italic>CD69</italic>, <italic>IL-2RA</italic>, <italic>CD38</italic>, and <italic>HLA-DRB1</italic>) (<xref ref-type="bibr" rid="B25">25</xref>) to evaluate T-cell activation in the CM tumor microenvironment, revealing consistently low expression levels. A parallel assessment of costimulatory molecules showed similarly reduced expression across both activating (<italic>CD28</italic>, <italic>CD27</italic>, <italic>ICOS</italic>, <italic>TNFRSF4</italic>, and <italic>TNFRSF9</italic>) and inhibitory types (<italic>PDCD1</italic>, <italic>CTLA4</italic>, <italic>LAG3</italic>, and <italic>HAVCR2</italic>) (<xref ref-type="bibr" rid="B26">26</xref>) second signal components (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6G</bold>
</xref>). These findings strongly indicate a predominantly quiescent T-cell state in CM microenvironments.</p>
</sec>
<sec id="s3_6">
<title>The immunosuppressive landscape of myeloid cells and the SIRPA-CD47 immune checkpoint facilitate immune escape in CM</title>
<p>We performed a comprehensive clustering analysis of these cells to elucidate the mechanisms impairing myeloid cell-mediated T cell activation, identifying 17 functionally distinct subsets (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7A</bold>
</xref>). Tumor-associated macrophages (TAMs) emerged as the predominant population (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7B, C</bold>
</xref>), with specialized subtypes displaying unique functional profiles: Resident tissue macrophages (RTM-TAMs) showed elevated CCL18 expression linked to immunosuppression and tumor progression; Pro-angiogenic TAMs (Angio-TAMs) demonstrated marked expression of vascular factors (<italic>VCAN, FCN1, THBS1</italic>); Lipid-associated TAMs (LA-TAMs) exhibited lipid metabolism gene signatures (<italic>APOC1</italic>, <italic>APOE</italic>, <italic>ACP5</italic>); and Inflammatory TAMs (Inflam-TAM) secreted key cytokines (<italic>IL1B</italic>, <italic>CXCL1</italic>, <italic>CXCL3</italic>) that orchestrate immune cell recruitment in tumor-associated inflammation. Notably, antigen-presenting cells showed consistently diminished MHC and costimulatory molecule expression, corroborating our prior observations (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7D</bold>
</xref>).</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>scRNA-seq reveals the diversity of myeloid cell subpopulations and the mechanism of immune activation failure. <bold>(A)</bold> t-SNE dimensionality reduction plot showing clustering and grouping of myeloid cell populations. <bold>(B)</bold> Functional characteristics and marker gene heatmap display of subpopulations of myeloid cells. <bold>(C)</bold> Histogram shows the proportions of different cell types. <bold>(D)</bold> Dotplot graph displays the expression of immune co-stimulatory and MHC molecules in subpopulations of myeloid cells.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1652645-g007.tif">
<alt-text content-type="machine-generated">A composite image with five panels: (A) A t-SNE plot showing clusters of cells in different colors labeled from 1 to 16. (B) A stacked bar graph comparing cell type ratios between normal and tumor groups. (C) Four pie charts labeled T1, T2, T3, N2, and N3 showing proportions of different cell types. (D) A heatmap displaying the expression of marker genes in myeloid cells, with a color gradient indicating z-scores. (E) A dot plot illustrating expression levels of costimulatory molecules and MHC-I/II in various monocyte and TAM types, with dot size representing expression percentage.</alt-text>
</graphic>
</fig>
<p>Macrophages serve as pivotal antigen-presenting cells in immune responses, especially during tumor&#x2013;T-cell interactions (<xref ref-type="bibr" rid="B27">27</xref>). We systematically analyzed these cellular interactions through our comprehensive communication profiling of four distinct cell populations (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8A</bold>
</xref>). Our data revealed that merely 30% of tumor-associated macrophages (TAMs) participated in MHC-I/II-mediated signaling (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8B</bold>
</xref>), suggesting an insufficient antigen presentation capacity for effective T cell activation. Further ligand-receptor analysis identified critical immune checkpoint pairs (<italic>CLEC2D-KLRB1</italic> and <italic>SIRPA-CD47</italic>) contributing to cardiac mucinous tumor immune evasion (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8C</bold>
</xref>). CLEC2D-KLRB1 interactions mechanistically suppress T-cell effector functions, while SIRPA-CD47 engagement blocks macrophage phagocytic activity, collectively impairing immune signal transduction (<xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8D, E</bold>
</xref>).</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>scRNA-seq reveals the diversity of myeloid cell subpopulations and the mechanism of immune activation failure. <bold>(A)</bold> Cell communication analysis methods reveal the strength of interactions among T cell, TAM, and cardiac mucinous tumor cells. <bold>(B)</bold> MHC-I and II signal output, signal reception strength evaluation, with the horizontal and vertical axes representing the strength level, and the size of the dots indicating the number of cells involved in signal transduction. <bold>(C)</bold> Dotplot displaying of the expression of immune checkpoints in different organizations. <bold>(D)</bold> Histograms illustrating the involvement of specific ligand pairs. <bold>(E)</bold> Heatmap illustrating immune checkpoint signaling emission and reception.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1652645-g008.tif">
<alt-text content-type="machine-generated">The image contains multiple panels (A-E) depicting data on cardiac myxoma interactions and signaling networks. Panel A shows network diagrams for the number and weight of interactions among CD4, CD8, TAM, and cardiac myxoma. Panel B presents a scatter plot of MHC-II signaling network strengths. Panel C displays dot plots for gene expression in different cell types. Panel D includes a bar chart showing ligand-receptor contributions. Panel E illustrates heatmaps for CD47 and CLEC signaling networks, indicating communication probabilities.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_7">
<title>Macrophages tend to polarize toward M2</title>
<p>Macrophages exhibit plasticity in differentiating into distinct TAM subtypes, which are classically categorized as pro-inflammatory M1 and immunosuppressive M2 phenotypes (<xref ref-type="bibr" rid="B28">28</xref>), and are shaped by diverse tumor microenvironmental cues. M1 macrophages demonstrate tumoricidal properties through enhanced immune surveillance and antitumor responses, whereas M2 macrophages facilitate immune tolerance by supporting tissue remodeling and tumor progression (<xref ref-type="bibr" rid="B29">29</xref>). We established M1/M2 signature gene sets and implemented AUCell scoring analysis to characterize TAM polarization patterns in CM. A quantitative assessment revealed predominant M2 polarization across TAM populations in CM, with significantly elevated M2 scores compared to their M1 scores (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9A</bold>
</xref>). Because M2 macrophages typically mediate immunosuppression via IL-10 and TGFB1 secretion, we employed CellChat analysis to delineate TAM-mediated inhibitory networks (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9B</bold>
</xref>). Our western blot validation confirmed substantial IL-10 overexpression in tumors versus adjacent normal tissues (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9C</bold>
</xref>). These findings collectively identify the presence of an M2-polarized TAM dominance in CM that orchestrates IL-10-dependent immune suppression.</p>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>The response of REL to the products of glycolysis metabolism promotes the induction of TAM toward M2 polarization. <bold>(A)</bold> t-SNE dimensionality reduction plot reveals the degree of TAM M1 or M2 polarization via the AUCell scoring. <bold>(B)</bold> Cell communication analysis reveals the degree of interaction between T cells, cardiac myxoma, and TAM. <bold>(C)</bold> Western blot experiment reveals the expression of IL-10 in tumor tissue and adjacent tissue. <bold>(D)</bold> Featureplot displays the gene set of IL-4 and IL-13. <bold>(E)</bold> Observation of THP1 differentiation into M0 macrophages in morphology. <bold>(F)</bold> Evaluate the <italic>IL-10</italic> levels after treating M0 macrophages with conditional culture medium. <bold>(G)</bold> Venn diagram identification of differential genes in scRNA-seq, proteomics and transcription factors. <bold>(H)</bold> Violin plot showing the expression of REL in different subpopulations of myeloid cells. <bold>(I)</bold> ChIP-seq reveals the interaction between <italic>REL</italic> and the <italic>IL-10</italic> promoter. <bold>(J)</bold> Investigate the expression of <italic>IL-10</italic> in M0 macrophages under different conditions of the presence or absence of REL.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1652645-g009.tif">
<alt-text content-type="machine-generated">A multi-panel scientific figure displaying various analyses related to cardiac myxoma. Panel A shows two UCell score plots comparing M1 and M2 scores. Panel B illustrates network diagrams depicting interactions between T-cells, TAM, and cardiac myxoma, highlighting interaction weights and strengths. Panel C features a scatter plot of communication probabilities for different gene interactions. Panel D presents Western blots for IL-10 and &#x3b2;-actin in cardiac myxoma and normal samples. Panel E displays tSNE plots for IL4 and IL13 gene expression. Panel F shows microscopic images of THP-1 and M0 Macrophages. Panel G includes a Western blot for IL-10 in THP1 under different conditions. Panel H is a Venn diagram comparing scRNA and proteomics data. Panel I shows a violin plot for REL gene expression across various cell types. Panel J is a tSNE plot for REL expression. Panel K presents REL gene expression in a bed format graph. Panel L contains Western blots testing IL-10 and Flag-REL expression in 293T cells.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_8">
<title>Glycolytic metabolites induce the polarization of M2 macrophages</title>
<p>While IL-4 and IL-13 are established inducers of M0-to-M2 macrophage polarization (<xref ref-type="bibr" rid="B30">30</xref>), our single-cell analysis revealed remarkably low expression of these cytokines across all CM microenvironmental cell types (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9D</bold>
</xref>), implying the existence of alternative M2-polarizing mechanisms in CM. Given the established metabolic regulation of immune function, we noted CM&#x2019;s distinctive glycolytic hyperactivity (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3C, D</bold>
</xref>), which prompted our hypothesis that glycolytic metabolites drive TAM polarization and subsequent IL-10-mediated immune evasion. Our experimental validation involved PMA-induced THP-1-derived M0 macrophages (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9E</bold>
</xref>) exposed to 1) an untreated organoid-conditioned medium or 2) a medium pretreated with MCL/ACT001/CA/physcion (3:7 dilution with a fresh medium). IL-10 quantification via Western blot demonstrated that while the control medium robustly elevated IL-10 expression-indicative of M2 polarization, all drug-treated media significantly attenuated this effect (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9F</bold>
</xref>). These findings indicate that tumor-derived glycolytic metabolites are critical regulators of macrophage IL-10 production in CM.</p>
</sec>
<sec id="s3_9">
<title>REL up-regulates <italic>IL-10</italic> in response to glycolysis metabolites stimulation</title>
<p>Our prior proteomic studies identified transcriptional regulation as a key driver of CM pathogenesis (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>). To elucidate macrophage responses to glycolytic metabolites, we integrated proteomic and scRNA-seq datasets, identifying the transcription factor REL,with a highly expression in Myeloid cell (<xref ref-type="fig" rid="f9">
<bold>Figures&#xa0;9G, H</bold>
</xref>). ChIP-seq analysis uncovered REL&#x2019;s direct binding to the IL-10 promoter (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9I</bold>
</xref>), indicating its potential involvement in metabolite-sensing mechanisms. Functional validation using p-3&#xd7;flag-REL transfected HEK293T cells demonstrated REL&#x2019;s capacity to upregulate IL-10 expression, with the organoid-conditioned medium further amplifying this effect (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9J</bold>
</xref>). These findings suggest that REL is a critical mediator of glycolytic metabolite-induced macrophage polarization through IL-10 transcriptional activation.</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<p>This study leveraged scRNA-seq technology to conduct a comprehensive and in-depth analysis of CM tissue. Our work represents the first systematic characterization of CM&#x2019;s cellular architecture and uncovers its previously unknown heterogeneity and complexity. Moreover, we precisely delineated the biological properties and functional contributions of specific cell populations within this microenvironment, offering novel perspectives on cardiac homeostasis. We identified tumor cells residing within fibroblast populations, providing compelling evidence for a potential common lineage between CM and fibroblasts. To substantiate this hypothesis, we implemented sophisticated temporal analysis approaches to reclassify tumor cells along a developmental trajectory using mesenchymal stem cell markers. The temporal expression patterns of these markers notably showed remarkable concordance with our hypothesis, strongly suggesting that CM tumor cells originate from mesenchymal stem cells.</p>
<p>Investigations of tumor metabolism through the lens of metabolic reprogramming hold significant value in enhancing the current comprehension of tumor cell proliferation mechanisms (<xref ref-type="bibr" rid="B31">31</xref>). Our analysis of CM metabolic features revealed a notable discrepancy: the scRNA-seq data demonstrated TCA-cycle upregulation in tumor cells, while proteomic profiling indicated TCA-cycle downregulation. This divergence primarily stems from the distinct molecular layers these techniques examine&#x2014;while transcriptional changes may suggest pathway activation, subsequent translational regulation and post-translational modification can alter protein abundance (<xref ref-type="bibr" rid="B32">32</xref>). These apparent contradictions reflect complementary metabolic adaptations. Although tumor cells indicate TCA cycle activation at the transcriptional level, the overall tumor tissue (comprising multiple cell types) exhibits suppression at the protein level. Crucially, both methodologies consistently identified enhanced glycolytic activity in tumor cells. To confirm these findings, we developed a CM organoid model that recapitulates <italic>in vivo</italic> growth conditions. Treatment with glycolysis and pentose phosphate pathway inhibitors markedly reduced organoid viability, demonstrating tumor cells&#x2019; reliance on glycolytic metabolism for energy production and survival.</p>
<p>Our study further characterized fibroblast subpopulations, identifying three principal subtypes: apCAFs, vCAFs, and myofibroblasts. These cellular components are fundamentally responsible for preserving tissue integrity and mechanical strength. In CM specimens, we detected marked reductions in extracellular matrix production, particularly regarding collagen deposition, which critically compromises tissue firmness. This pathological softening predisposes to tissue fragmentation, raising the concerning possibility of embolic events when dislodged fragments enter cardiac circulation. Such emboli may subsequently cause devastating thromboembolic complications, including cerebrovascular accidents.</p>
<p>Our cell communication analysis revealed that apCAFs secrete MIF and ANXA1 to facilitate immune cell recruitment. Nevertheless, CM tissue demonstrates a partial capacity to evade immune surveillance. As primary mediators of immune cytotoxicity, T cells formed the basis for our exploration of CM&#x2019;s immune evasion mechanisms. Initial assessments showed diminished levels of T cell activation factors and markers, indicative of a quiescent state. Since T cell activation necessitates dual signaling, we noted that while the first signal initiates the process, secondary signal molecules typically become upregulated&#x2014;yet our data revealed uniformly low expression of these molecules. This observation suggests impaired first signal transmission as the likely cause of T cell dysfunction. Supporting this hypothesis, cell communication analysis demonstrated weak interactions between T cells and myeloid-lineage antigen-presenting cells (APCs). A further investigation identified as a tumor cell CD47 binding to APC surface SIRP&#x3b1; as a potential mechanism suppressing phagocytic activity, offering initial insights into CM&#x2019;s immune escape strategy. Additionally, our lymphocyte profiling confirmed the presence of NK and B cells, although their scarcity relative to T cells precluded detailed analyses in this study. Importantly, their limited abundance does not diminish their biological significance&#x2014;NK and B cells may play distinct roles in immune modulation and disease pathogenesis. Future studies should comprehensively examine these cells&#x2019; functional heterogeneity.</p>
<p>Tumor-associated macrophages (TAMs) represent the predominant population among antigen-presenting cells, with their dual polarization states dictating either protumoral or antitumoral effects. Our AUCell scoring analysis revealed a predominant M2 polarization state of TAMs within the CM microenvironment. Conventionally, M2-polarized TAMs facilitate tumor immune evasion through IL-10/TGFB1 secretion or ARG1 overexpression (<xref ref-type="bibr" rid="B33">33</xref>). Intriguingly, we identified that TGFB1 primarily targets tumor cells rather than immune cells (<xref ref-type="bibr" rid="B34">34</xref>), potentially reflecting tumor cell origins. ARG1 catalyzes arginine conversion to ornithine and urea, whereas ornithine directly suppresses T cell cytotoxicity (<xref ref-type="bibr" rid="B34">34</xref>) - contrasting with our earlier observation of TAM-mediated antigen presentation impairment. IL-10 exhibits broader immunosuppressive effects, inhibiting both T cell cytokine production and antigen presentation across macrophages, dendritic cells, and B cells (<xref ref-type="bibr" rid="B35">35</xref>), aligning perfectly with our findings. We subsequently investigated macrophage polarization in response to glycolytic metabolites. Proteomic profiling had previously implicated transcriptional dysregulation in CM pathogenesis. Further exploration identified REL as the predominant transcription factor in TAMs. Flag-REL transfection markedly upregulated IL-10 expression, an effect amplified by conditioned medium supplementation, unequivocally establishing the pivotal role of REL in IL-10 regulation.</p>
<p>This study on cardiac myxoma (CM) microenvironments has two key limitations: (1) Its restricted sample size affects its statistical power and generalizability, and (2) it may potentially have selection biases in patient recruitment. Future research should prioritize multicenter collaborations to address these concerns by expanding sample diversity and implementing standardized selection criteria. Advanced methodologies, including propensity score matching and multiomics integration, could enhance the reliability of future results. Validation through independent cohort studies and clinical trials remains essential. Emerging technologies, such as single-cell spatial transcriptomics, may provide deeper insights into CM&#x2019;s spatial architecture, while CRISPR-based functional assays could verify therapeutic targets. These improvements would strengthen the biological relevance of future findings and support translational applications. While the current work establishes a foundation for understanding CM pathophysiology, subsequent studies must overcome these constraints through rigorous design and innovative approaches to advance diagnostic and therapeutic development for this rare tumor type.</p>
</sec>
<sec id="s5" sec-type="conclusions">
<title>Conclusions</title>
<p>Collectively, our study has comprehensively characterized the cellular architecture and functional dynamics within the CM microenvironment. We have demonstrated that CM derives from mesenchymal stem cells and sustains its proliferation through glycolytic pathway activation. Moreover, we have uncovered multiple sophisticated strategies employed by tumor cells to circumvent immune surveillance. Notably, the CD47-SIRP&#x3b1; immune checkpoint axis effectively suppresses antigen-presenting cell phagocytosis, while M2-polarized TAMs and their IL-10 secretion collectively impair immune cell functionality. Crucially, we have delineated the intricate crosstalk between tumor metabolism and immune regulation, revealing that the REL transcription factor mediates glycolytic metabolite-induced IL-10 production in M2-TAMs (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10</bold>
</xref>) (<xref ref-type="bibr" rid="B36">36</xref>). These insights substantially advance our comprehension of CM immune evasion and establish a critical conceptual framework for future therapeutic developments.</p>
<fig id="f10" position="float">
<label>Figure&#xa0;10</label>
<caption>
<p>Glycolysis-derived metabolites enhance M2 macrophage polarization and IL-10 secretion, supporting tumor immune escape (<xref ref-type="bibr" rid="B36">36</xref>). <bold>(A)</bold> The tumor microenvironment of cardiac myxoma consists of diverse cell types. <bold>(B)</bold> Origin of Cardiac Myxoma Cells from Mesenchymal Stem Cells and Immune Cell Infiltration Induced by apCAF. <bold>(C)</bold> The CD47-SIRPA interaction suppresses macrophage phagocytosis of tumor cells, thereby inhibiting T cell activation. <bold>(D)</bold> Glycolysis affects M2 polarization via NF&#x3ba;B/C-rel signaling pathway.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1652645-g010.tif">
<alt-text content-type="machine-generated">Diagram illustrating the cellular interactions in cardiac myxoma. Panel A shows a network of cells including cardiac myocytes, fibroblasts, endothelial cells, cancer cells, and immune cells. Panel B depicts fibroblasts differentiating into myofibroblasts and CAFs, with cardiac myxoma influencing immune cells. Panel C illustrates interactions between cardiac myxoma, APC, and T cells, highlighting immune response markers. Panel D shows enhanced glycolysis in cardiac myxoma, activation of NF-kB, and interactions with M2 macrophages and APCs, affecting immune signaling pathways.</alt-text>
</graphic>
</fig>
</sec>
</body>
<back>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>
<p>The datasets presented in this study can be available from the corresponding author upon reasonable request. All unique/stable reagents generated in this study are available from the corresponding author with a completed Materials Transfer Agreement.</p>
</sec>
<sec id="s7" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The studies involving humans were approved by Tianjin Medical University General Hospital Ethics Committee with written informed consent from all subjects (IRB2024-YX-038-01). The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study.</p>
</sec>
<sec id="s8" sec-type="author-contributions">
<title>Author contributions</title>
<p>XZ: Investigation, Funding acquisition, Writing &#x2013; original draft, Data curation, Resources, Methodology. QG: Data curation, Methodology, Formal Analysis, Investigation, Software, Writing &#x2013; original draft. XD: Writing &#x2013; review &amp; editing, Data curation, Formal Analysis, Methodology, Investigation. BS: Formal Analysis, Funding acquisition, Investigation, Writing &#x2013; review &amp; editing. YL: Writing &#x2013; review &amp; editing, Formal Analysis. HZ: Investigation, Data curation, Funding acquisition, Writing &#x2013; review &amp; editing, Methodology. CS: Conceptualization, Writing &#x2013; review &amp; editing, Supervision, Writing &#x2013; original draft.</p>
</sec>
<sec id="s9" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare financial support was received for the research and/or publication of this article. This work was supported by grants from Tianjin Health Commission Project (TJWJ2024MS004), China International Medical Foundation Project (2022-N-01-18), Tianjin Excellent Science and Technology Specialists Project (23YDTPJC00460), and the Tianjin Natural Science Foundation (22JCZXJC00090 to Baofa Sun).</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>We are very grateful to Nankai University for providing an excellent test platform.</p>
</ack>
<sec id="s10" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>Authors XZ and HZ were employed by Tianjin Pharmaceutical Research Institute Co., LTD.</p>
<p>The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s11" sec-type="ai-statement">
<title>Generative AI statement</title>
<p>The author(s) declare that no Generative AI was used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p>
</sec>
<sec id="s12" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s13" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fimmu.2025.1652645/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fimmu.2025.1652645/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Table1.xlsx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"/>
<supplementary-material xlink:href="Table2.xlsx" id="SM2" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"/>
</sec>
<fn-group>
<title>Abbreviations</title>
<fn fn-type="abbr" id="abbrev1">
<p>CM, Cardiac myxoma; TAMs, Tumor-associated macrophages; scRNA-seq, single-cell transcriptomic sequencing; apCAF, antigen-presenting cancer-associated fibroblasts; TNF&#x3b1;, Tumor necrosis factor-&#x3b1;; EMT, Epithelial mesenchymal transformation; TGFb, Transforming growth factor Beta.</p>
</fn>
</fn-group>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rahouma</surname> <given-names>M</given-names>
</name>
<name>
<surname>Arisha</surname> <given-names>MJ</given-names>
</name>
<name>
<surname>Elmously</surname> <given-names>A</given-names>
</name>
<name>
<surname>El-Sayed Ahmed</surname> <given-names>MM</given-names>
</name>
<name>
<surname>Spadaccio</surname> <given-names>C</given-names>
</name>
<name>
<surname>Mehta</surname> <given-names>K</given-names>
</name>
<etal/>
</person-group>. <article-title>Cardiac tumors prevalence and mortality: A systematic review and meta-analysis</article-title>. <source>Int J Surg (London England)</source>. (<year>2020</year>) <volume>76</volume>:<page-range>178&#x2013;89</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ijsu.2020.02.039</pub-id>, PMID: <pub-id pub-id-type="pmid">32169566</pub-id></citation></ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Oktaviono</surname> <given-names>YH</given-names>
</name>
<name>
<surname>Saputra</surname> <given-names>PBT</given-names>
</name>
<name>
<surname>Arnindita</surname> <given-names>JN</given-names>
</name>
<name>
<surname>Afgriyuspita</surname> <given-names>LS</given-names>
</name>
<name>
<surname>Kurniawan</surname> <given-names>RB</given-names>
</name>
<name>
<surname>Pasahari</surname> <given-names>D</given-names>
</name>
<etal/>
</person-group>.. <article-title>Clinical characteristics and surgical outcomes of cardiac myxoma: A meta-analysis of worldwide experience</article-title>. <source>Eur J Surg Oncol</source>. (<year>2024</year>) <volume>50</volume>:<fpage>107940</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ejso.2023.107940</pub-id>, PMID: <pub-id pub-id-type="pmid">38219702</pub-id></citation></ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sugimoto</surname> <given-names>T</given-names>
</name>
<name>
<surname>Ogawa</surname> <given-names>K</given-names>
</name>
<name>
<surname>Asada</surname> <given-names>T</given-names>
</name>
<name>
<surname>Mukohara</surname> <given-names>N</given-names>
</name>
<name>
<surname>Nishiwaki</surname> <given-names>M</given-names>
</name>
<name>
<surname>Higami</surname> <given-names>T</given-names>
</name>
<etal/>
</person-group>. <article-title>Surgical treatment of cardiac myxoma and its complications</article-title>. <source>Cardiovasc Surg (London England)</source>. (<year>1993</year>) <volume>1</volume>:<page-range>395&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1177/096721099300100418</pub-id>
</citation></ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Villanueva</surname> <given-names>MT</given-names>
</name>
</person-group>. <article-title>Bacteria tag tumours for CAR-T cell attack</article-title>. <source>Nat Rev Drug Discovery</source>. (<year>2023</year>) <volume>22</volume>:<page-range>954&#x2013;</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/d41573-023-00181-y</pub-id>, PMID: <pub-id pub-id-type="pmid">37923843</pub-id></citation></ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Herring</surname> <given-names>CA</given-names>
</name>
<name>
<surname>Sheng</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Ping</surname> <given-names>J</given-names>
</name>
<name>
<surname>Simmons</surname> <given-names>AJ</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>B</given-names>
</name>
<etal/>
</person-group>. <article-title>Quantitative assessment of cell population diversity in single-cell landscapes</article-title>. <source>PLoS Biol</source>. (<year>2018</year>) <volume>16</volume>:<elocation-id>e2006687</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pbio.2006687</pub-id>, PMID: <pub-id pub-id-type="pmid">30346945</pub-id></citation></ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Suran</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>After the genome-A brief history of proteomics</article-title>. <source>JAMA</source>. (<year>2022</year>) <volume>328</volume>:<page-range>1168&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1001/jama.2022.7448</pub-id>, PMID: <pub-id pub-id-type="pmid">36044242</pub-id></citation></ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ruiz-Villalba</surname> <given-names>A</given-names>
</name>
<name>
<surname>Romero</surname> <given-names>JP</given-names>
</name>
<name>
<surname>Hern&#xe1;ndez</surname> <given-names>SC</given-names>
</name>
<name>
<surname>Vilas-Zornoza</surname> <given-names>A</given-names>
</name>
<name>
<surname>Fortelny</surname> <given-names>N</given-names>
</name>
<name>
<surname>Castro-Labrador</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>Single-cell RNA sequencing analysis reveals a crucial role for CTHRC1 (Collagen triple helix repeat containing 1) cardiac fibroblasts after myocardial infarction</article-title>. <source>Circulation</source>. (<year>2020</year>) <volume>142</volume>:<page-range>1831&#x2013;47</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1161/CIRCULATIONAHA.119.044557</pub-id>, PMID: <pub-id pub-id-type="pmid">32972203</pub-id></citation></ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yuan</surname> <given-names>P</given-names>
</name>
<name>
<surname>Cheedipudi</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Rouhi</surname> <given-names>L</given-names>
</name>
<name>
<surname>Fan</surname> <given-names>S</given-names>
</name>
<name>
<surname>Simon</surname> <given-names>L</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>Z</given-names>
</name>
<etal/>
</person-group>. <article-title>Single-cell RNA sequencing uncovers paracrine functions of the epicardial-derived cells in arrhythmogenic cardiomyopathy</article-title>. <source>Circulation</source>. (<year>2021</year>) <volume>143</volume>:<page-range>2169&#x2013;87</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1161/CIRCULATIONAHA.120.052928</pub-id>, PMID: <pub-id pub-id-type="pmid">33726497</pub-id></citation></ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Baysoy</surname> <given-names>A</given-names>
</name>
<name>
<surname>Bai</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Satija</surname> <given-names>R</given-names>
</name>
<name>
<surname>Fan</surname> <given-names>R</given-names>
</name>
</person-group>. <article-title>The technological landscape and applications of single-cell multi-omics</article-title>. <source>Nat Rev Mol Cell Biol</source>. (<year>2023</year>) <volume>24</volume>:<fpage>695</fpage>&#x2013;<lpage>713</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41580-023-00615-w</pub-id>, PMID: <pub-id pub-id-type="pmid">37280296</pub-id></citation></ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname> <given-names>D</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>N</given-names>
</name>
<name>
<surname>Li</surname> <given-names>X</given-names>
</name>
<name>
<surname>Gou</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Duan</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>B</given-names>
</name>
<etal/>
</person-group>. <article-title>Advances in single-cell RNA sequencing and its applications in cancer research</article-title>. <source>J Hematol Oncol</source>. (<year>2023</year>) <volume>16</volume>:<fpage>98</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s13045-023-01494-6</pub-id>, PMID: <pub-id pub-id-type="pmid">37612741</pub-id></citation></ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>H</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>F</given-names>
</name>
<name>
<surname>Li</surname> <given-names>T</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Q</given-names>
</name>
<etal/>
</person-group>. <article-title>Resolving the heterogeneous tumour microenvironment in cardiac myxoma through single-cell and spatial transcriptomics</article-title>. <source>Clin Trans Med</source>. (<year>2024</year>) <volume>14</volume>:<elocation-id>e1581</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/ctm2.1581</pub-id>, PMID: <pub-id pub-id-type="pmid">38318640</pub-id></citation></ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vandereyken</surname> <given-names>K</given-names>
</name>
<name>
<surname>Sifrim</surname> <given-names>A</given-names>
</name>
<name>
<surname>Thienpont</surname> <given-names>B</given-names>
</name>
<name>
<surname>Voet</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>Methods and applications for single-cell and spatial multi-omics</article-title>. <source>Nat Rev Genet</source>. (<year>2023</year>) <volume>24</volume>:<fpage>494</fpage>&#x2013;<lpage>515</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41576-023-00580-2</pub-id>, PMID: <pub-id pub-id-type="pmid">36864178</pub-id></citation></ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Natarajan</surname> <given-names>KN</given-names>
</name>
<name>
<surname>Miao</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>M</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>H</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Comparative analysis of sequencing technologies for single-cell transcriptomics</article-title>. <source>Genome Biol</source>. (<year>2019</year>) <volume>20</volume>:<fpage>70</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s13059-019-1676-5</pub-id>, PMID: <pub-id pub-id-type="pmid">30961669</pub-id></citation></ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>B</given-names>
</name>
<name>
<surname>Li</surname> <given-names>C</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>D</given-names>
</name>
<name>
<surname>Ren</surname> <given-names>X</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Z</given-names>
</name>
</person-group>. <article-title>An entropy-based metric for assessing the purity of single cell populations</article-title>. <source>Nat Commun</source>. (<year>2020</year>) <volume>11</volume>:<fpage>3155</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-020-16904-3</pub-id>, PMID: <pub-id pub-id-type="pmid">32572028</pub-id></citation></ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Trapnell</surname> <given-names>C</given-names>
</name>
<name>
<surname>Cacchiarelli</surname> <given-names>D</given-names>
</name>
<name>
<surname>Grimsby</surname> <given-names>J</given-names>
</name>
<name>
<surname>Pokharel</surname> <given-names>P</given-names>
</name>
<name>
<surname>Li</surname> <given-names>S</given-names>
</name>
<name>
<surname>Morse</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>The dynamics and regulators of cell fate decisions are revealed by pseudotemporal ordering of single cells</article-title>. <source>Nat Biotechnol</source>. (<year>2014</year>) <volume>32</volume>:<page-range>381&#x2013;6</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nbt.2859</pub-id>, PMID: <pub-id pub-id-type="pmid">24658644</pub-id></citation></ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Lan</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Quan</surname> <given-names>F</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>E</given-names>
</name>
<name>
<surname>Deng</surname> <given-names>C</given-names>
</name>
<etal/>
</person-group>. <article-title>CellMarker: a manually curated resource of cell markers in human and mouse</article-title>. <source>Nucleic Acids Res</source>. (<year>2019</year>) <volume>47</volume>:<page-range>D721&#x2013;D8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gky900</pub-id>, PMID: <pub-id pub-id-type="pmid">30289549</pub-id></citation></ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jin</surname> <given-names>S</given-names>
</name>
<name>
<surname>Guerrero-Juarez</surname> <given-names>CF</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>I</given-names>
</name>
<name>
<surname>Ramos</surname> <given-names>R</given-names>
</name>
<name>
<surname>Kuan</surname> <given-names>CH</given-names>
</name>
<etal/>
</person-group>. <article-title>Inference and analysis of cell-cell communication using CellChat</article-title>. <source>Nat Commun</source>. (<year>2021</year>) <volume>12</volume>:<fpage>1088</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-021-21246-9</pub-id>, PMID: <pub-id pub-id-type="pmid">33597522</pub-id></citation></ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>C</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>P</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>S</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Regulatory T cells in tumor microenvironment: new mechanisms, potential therapeutic strategies and future prospects</article-title>. <source>Mol Cancer</source>. (<year>2020</year>) <volume>19</volume>:<fpage>116</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12943-020-01234-1</pub-id>, PMID: <pub-id pub-id-type="pmid">32680511</pub-id></citation></ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rahal</surname> <given-names>OM</given-names>
</name>
<name>
<surname>Wolfe</surname> <given-names>AR</given-names>
</name>
<name>
<surname>Mandal</surname> <given-names>PK</given-names>
</name>
<name>
<surname>Larson</surname> <given-names>R</given-names>
</name>
<name>
<surname>Tin</surname> <given-names>S</given-names>
</name>
<name>
<surname>Jimenez</surname> <given-names>C</given-names>
</name>
<etal/>
</person-group>. <article-title>Blocking interleukin (IL)4- and IL13-mediated phosphorylation of STAT6 (Tyr641) decreases M2 polarization of macrophages and protects against macrophage-mediated radioresistance of inflammatory breast cancer</article-title>. <source>Int J Radiat OncologyBiologyPhysics</source>. (<year>2018</year>) <volume>100</volume>:<page-range>1034&#x2013;43</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ijrobp.2017.11.043</pub-id>, PMID: <pub-id pub-id-type="pmid">29485045</pub-id></citation></ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xiao</surname> <given-names>S</given-names>
</name>
<name>
<surname>Najafian</surname> <given-names>N</given-names>
</name>
<name>
<surname>Reddy</surname> <given-names>J</given-names>
</name>
<name>
<surname>Albin</surname> <given-names>M</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>C</given-names>
</name>
<name>
<surname>Jensen</surname> <given-names>E</given-names>
</name>
<etal/>
</person-group>. <article-title>Differential engagement of Tim-1 during activation can positively or negatively costimulate T cell expansion and effector function</article-title>. <source>J Exp Med</source>. (<year>2007</year>) <volume>204</volume>:<page-range>1691&#x2013;702</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1084/jem.20062498</pub-id>, PMID: <pub-id pub-id-type="pmid">17606630</pub-id></citation></ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Moynihan</surname> <given-names>KD</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>MP</given-names>
</name>
<name>
<surname>Sultan</surname> <given-names>H</given-names>
</name>
<name>
<surname>Pappas</surname> <given-names>DC</given-names>
</name>
<name>
<surname>Park</surname> <given-names>T</given-names>
</name>
<name>
<surname>Chin</surname> <given-names>SM</given-names>
</name>
<etal/>
</person-group>. <article-title>IL-2 targeted to CD8+ T cells promotes robust effector T cell responses and potent antitumor immunity</article-title>. <source>Cancer Discov</source>. (<year>2024</year>) <volume>14</volume>(<issue>7</issue>):<page-range>1206&#x2013;25</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/2159-8290.c.7309449</pub-id>, PMID: <pub-id pub-id-type="pmid">38563906</pub-id></citation></ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sch&#xfc;ler</surname> <given-names>T</given-names>
</name>
<name>
<surname>Kammertoens</surname> <given-names>T</given-names>
</name>
<name>
<surname>Preiss</surname> <given-names>S</given-names>
</name>
<name>
<surname>Debs</surname> <given-names>P</given-names>
</name>
<name>
<surname>Noben-Trauth</surname> <given-names>N</given-names>
</name>
<name>
<surname>Blankenstein</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>Generation of tumor-associated cytotoxic T lymphocytes requires interleukin 4 from CD8(+) T cells</article-title>. <source>J Exp Med</source>. (<year>2001</year>) <volume>194</volume>:<page-range>1767&#x2013;75</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1084/jem.194.12.1767</pub-id>, PMID: <pub-id pub-id-type="pmid">11748278</pub-id></citation></ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname> <given-names>E</given-names>
</name>
<name>
<surname>Pereira</surname> <given-names>MMA</given-names>
</name>
<name>
<surname>Karakasilioti</surname> <given-names>I</given-names>
</name>
<name>
<surname>Theurich</surname> <given-names>S</given-names>
</name>
<name>
<surname>Al-Maarri</surname> <given-names>M</given-names>
</name>
<name>
<surname>Rappl</surname> <given-names>G</given-names>
</name>
<etal/>
</person-group>. <article-title>Temporal and tissue-specific requirements for T-lymphocyte IL-6 signalling in obesity-associated inflammation and insulin resistance</article-title>. <source>Nat Commun</source>. (<year>2017</year>) <volume>8</volume>:<fpage>14803</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/ncomms14803</pub-id>, PMID: <pub-id pub-id-type="pmid">28466852</pub-id></citation></ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hodny</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Reinis</surname> <given-names>M</given-names>
</name>
<name>
<surname>Hubackova</surname> <given-names>S</given-names>
</name>
<name>
<surname>Vasicova</surname> <given-names>P</given-names>
</name>
<name>
<surname>Bartek</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Interferon gamma/NADPH oxidase defense system in immunity and cancer</article-title>. <source>Oncoimmunology</source>. (<year>2016</year>) <volume>5</volume>:<elocation-id>e1080416</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/2162402X.2015.1080416</pub-id>, PMID: <pub-id pub-id-type="pmid">27057461</pub-id></citation></ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shipkova</surname> <given-names>M</given-names>
</name>
<name>
<surname>Wieland</surname> <given-names>E</given-names>
</name>
</person-group>. <article-title>Surface markers of lymphocyte activation and markers of cell proliferation</article-title>. <source>Clin Chim Acta</source>. (<year>2012</year>) <volume>413</volume>:<page-range>1338&#x2013;49</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cca.2011.11.006</pub-id>, PMID: <pub-id pub-id-type="pmid">22120733</pub-id></citation></ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Takeuchi</surname> <given-names>M</given-names>
</name>
<name>
<surname>Miyoshi</surname> <given-names>H</given-names>
</name>
<name>
<surname>Semba</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Yamada</surname> <given-names>K</given-names>
</name>
<name>
<surname>Nakashima</surname> <given-names>K</given-names>
</name>
<name>
<surname>Sato</surname> <given-names>K</given-names>
</name>
<etal/>
</person-group>. <article-title>Co-stimulatory and immune checkpoint molecules are important in the tumor microenvironment of Hodgkin-like adult T-cell leukemia/lymphoma</article-title>. <source>Haematologica</source>. (<year>2023</year>) <volume>108</volume>:<page-range>3496&#x2013;501</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.3324/haematol.2023.283163</pub-id>, PMID: <pub-id pub-id-type="pmid">37439334</pub-id></citation></ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lu</surname> <given-names>M</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>B</given-names>
</name>
<name>
<surname>Hanash</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Onuchic</surname> <given-names>JN</given-names>
</name>
<name>
<surname>Ben-Jacob</surname> <given-names>E</given-names>
</name>
</person-group>. <article-title>Modeling putative therapeutic implications of exosome exchange between tumor and immune cells</article-title>. <source>Proc Natl Acad Sci U S A</source>. (<year>2014</year>) <volume>111</volume>:<page-range>E4165&#x2013;74</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.1416745111</pub-id>, PMID: <pub-id pub-id-type="pmid">25246552</pub-id></citation></ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Epelman</surname> <given-names>S</given-names>
</name>
<name>
<surname>Lavine Kory</surname> <given-names>J</given-names>
</name>
<name>
<surname>Randolph Gwendalyn</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Origin and functions of tissue macrophages</article-title>. <source>Immunity</source>. (<year>2014</year>) <volume>41</volume>:<fpage>21</fpage>&#x2013;<lpage>35</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.immuni.2014.06.013</pub-id>, PMID: <pub-id pub-id-type="pmid">25035951</pub-id></citation></ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Coburn</surname> <given-names>LA</given-names>
</name>
<name>
<surname>Singh</surname> <given-names>K</given-names>
</name>
<name>
<surname>Asim</surname> <given-names>M</given-names>
</name>
<name>
<surname>Barry</surname> <given-names>DP</given-names>
</name>
<name>
<surname>Allaman</surname> <given-names>MM</given-names>
</name>
<name>
<surname>Al-Greene</surname> <given-names>NT</given-names>
</name>
<etal/>
</person-group>. <article-title>Loss of solute carrier family 7 member 2 exacerbates inflammation-associated colon tumorigenesis</article-title>. <source>Oncogene</source>. (<year>2019</year>) <volume>38</volume>:<page-range>1067&#x2013;79</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41388-018-0492-9</pub-id>, PMID: <pub-id pub-id-type="pmid">30202097</pub-id></citation></ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Scott</surname> <given-names>TE</given-names>
</name>
<name>
<surname>Lewis</surname> <given-names>CV</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>M</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>C</given-names>
</name>
<name>
<surname>Samuel</surname> <given-names>CS</given-names>
</name>
<name>
<surname>Drummond</surname> <given-names>GR</given-names>
</name>
<etal/>
</person-group>. <article-title>IL-4 and IL-13 induce equivalent expression of traditional M2 markers and modulation of reactive oxygen species in human macrophages</article-title>. <source>Sci Rep</source>. (<year>2023</year>) <volume>13</volume>:<fpage>19589</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41598-023-46237-2</pub-id>, PMID: <pub-id pub-id-type="pmid">37949903</pub-id></citation></ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jiang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>B</given-names>
</name>
<name>
<surname>Lai</surname> <given-names>W</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Xiao</surname> <given-names>D</given-names>
</name>
<name>
<surname>Jia</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Repression of Hox genes by LMP1 in nasopharyngeal carcinoma and modulation of glycolytic pathway genes by HoxC8</article-title>. <source>Oncogene</source>. (<year>2015</year>) <volume>34</volume>:<page-range>6079&#x2013;91</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/onc.2015.53</pub-id>, PMID: <pub-id pub-id-type="pmid">25745994</pub-id></citation></ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname> <given-names>B</given-names>
</name>
<name>
<surname>Yin</surname> <given-names>H</given-names>
</name>
<name>
<surname>Dong</surname> <given-names>C</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>L</given-names>
</name>
<name>
<surname>Feng</surname> <given-names>W</given-names>
</name>
<name>
<surname>Pu</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>Biodegradable and excretable 2D W(1.33) C i-MXene with vacancy ordering for theory-oriented cancer nanotheranostics in near-infrared biowindow</article-title>. <source>Adv Sci (Weinh)</source>. (<year>2021</year>) <volume>8</volume>:<elocation-id>e2101043</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/advs.202101043</pub-id>, PMID: <pub-id pub-id-type="pmid">34716674</pub-id></citation></ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname> <given-names>W</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>X</given-names>
</name>
<name>
<surname>Ye</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Weng</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Pan</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>Characterization of hypoxia signature to evaluate the tumor immune microenvironment and predict prognosis in glioma groups</article-title>. <source>Front Oncol</source>. (<year>2020</year>) <volume>10</volume>:<elocation-id>796</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fonc.2020.00796</pub-id>, PMID: <pub-id pub-id-type="pmid">32500034</pub-id></citation></ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhong</surname> <given-names>A</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>T</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>T</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>TPD52L2 is a prognostic biomarker and correlated with immune infiltration in lung adenocarcinoma</article-title>. <source>Front Pharmacol</source>. (<year>2021</year>) <volume>12</volume>:<elocation-id>728420</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fphar.2021.728420</pub-id>, PMID: <pub-id pub-id-type="pmid">34744715</pub-id></citation></ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ashenafi</surname> <given-names>S</given-names>
</name>
<name>
<surname>Muvva</surname> <given-names>JR</given-names>
</name>
<name>
<surname>Mily</surname> <given-names>A</given-names>
</name>
<name>
<surname>Sn&#xe4;ll</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zewdie</surname> <given-names>M</given-names>
</name>
<name>
<surname>Chanyalew</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Immunosuppressive features of the microenvironment in lymph nodes granulomas from tuberculosis and HIV-co-infected patients</article-title>. <source>Am J Pathol</source>. (<year>2022</year>) <volume>192</volume>:<page-range>653&#x2013;70</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ajpath.2021.12.013</pub-id>, PMID: <pub-id pub-id-type="pmid">35092727</pub-id></citation></ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shuai</surname> <given-names>J</given-names>
</name>
<name>
<surname>Huiqin</surname> <given-names>L</given-names>
</name>
<name>
<surname>Luowanyue</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Weiping</surname> <given-names>M</given-names>
</name>
<name>
<surname>Ya</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Tianjian</surname> <given-names>C</given-names>
</name>
<etal/>
</person-group>. <article-title>Generic Diagramming Platform (GDP): a comprehensive database of high-quality biomedical graphics</article-title>. <source>Nucleic Acids Res</source>. (<year>2024</year>) <volume>53</volume>(<issue>D1</issue>):<elocation-id>D1670-D1676</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkae973</pub-id>, PMID: <pub-id pub-id-type="pmid">39470721</pub-id></citation></ref>
</ref-list>
</back>
</article>