RAW264.7 (ATCC TIB-71) murine macrophages were grown and maintained in complete DMEM, supplemented with 10% fetal bovine serum (FBS) and 1% penicillin and streptomycin, at 37°C and 5% CO_2. Salmonella Typhimurium strains UK-1 (χ3761) and ΔaroA (χ9099) were grown in lysogeny broth (LB) Miller with constant shaking at 250 rpm at 37°C overnight (14–16 hours). The OD₆₀₀ of the overnight culture was measured using a spectrophotometer and the culture was diluted to an OD600 of 0.05 in 20mL LB miller and grown up to an OD₆₀₀ of 0.5 to use for experiments. Based on a previously established growth curve, the reported OD corresponds to approximately 3.3 × 10⁸ CFU/mL for UK-1 and 6.5 × 10⁸ CFU/mL for ΔaroA Salmonella.

RAW264.7 macrophages were grown up to confluency in complete DMEM medium. Prior to infection, cells were washed with 1X phosphate buffered saline (PBS) to remove traces of FBS and antibiotics and replaced with DMEM containing 1% exosome-depleted FBS (exo-free DMEM). Cells were infected with S. Typhimurium UK-1 at a multiplicity of infection (MOI) of 5 for 2 hours. Media on cells was then replaced with exo-free DMEM containing 100 μg/mL gentamicin for 1 hour to remove any extracellular Salmonella. After one hour, the media was changed again and replaced with exo-free DMEM containing 25 μg/mL gentamicin and cells were allowed to incubate till the cell supernatant was collected for EV isolation 24 hours post infection, and the cell supernatant was replenished for collection 48 hours post infection.

Collected supernatants underwent sequential centrifugation at 500 × g and 4,000 × g for 10 minutes each, followed by 16,000 × g for 30 minutes to remove cell debris. The collected media was filtered through a 0.2 μm filter and ran at 100,000 x g for 3 hours using ultracentrifuge fitted with an SW32Ti rotor (Beckman Coulter Optima XPN-90). After the first run, the media was decanted and the EVs were resuspended in 400uL PBS with 1% protease inhibitor, and the rest of the ultracentrifuge tubes were balanced using sterile 1X PBS. The ultracentrifugation step was repeated and the EVs were finally resuspended in 1mL of PBS with 1% protease inhibitor. The protein concentration was determined using the Pierce BCA kit (Thermo Fisher Scientific). The particle concentration and size were determined using a ZetaView QUATT particle tracking analyzer (Particle Matrix). Three replicates of EVs (10 μg protein/each) from uninfected and infected macrophages were stained with MACSplex EV kit (Miltenyi Biotec Catalog no. 130122211) using manufacturer’s instructions to identify and compare tetraspanin markers. The EVs were analyzed using a flow cytometer (Beckman Coulter cytoFLEX) and FlowJo software.

Western blotting was carried out using 20 μg EVs per sample. Sample buffer containing beta-mercaptoethanol (BME), Deionized (DI) water, and 4 x XT-sample buffer was made and 25 μL sample was loaded per well in a 4-12% bis-tris gel (BioRad). The gel was run at 75V for 15 minutes, after which the voltage was increased to 200V, and the gel was run for another 45 minutes. The gel was then transferred to a blot and stained with primary antibody [1:800 dilution for anti-CD63 (System Biosciences), anti-CD9 (System Biosciences), anti-Alix (System Biosciences), and anti-OmpA (Vector Laboratories)] with overnight shaking at 4°C. The blot was then washed three times with PBST (PBS with 0.1% Tween-20) for 3 minutes each, after which it was stained with an HRP-conjugated goat anti-rabbit secondary antibody (1:500 dilution) for 1–2 hours with constant shaking. The blot was washed with PBST again and enhanced chemiluminescence (ECL) substrate was added for 5 minutes before imaging the blot using iBright Imaging System (Invitrogen).

Seven-week-old female BALB/c mice (Jackson Laboratory) were orally dosed with 40 μg sEVs from Salmonella-infected macrophages at week 0, 2, and 4. As a negative and positive control, mice were also immunized orally with sterile 1X PBS and S. Typhimurium ΔaroA (4.5 x 10⁶ CFUs) respectively. Prior to the administration of immunizations, mice were orally dosed with 50 μL of 0.3M sodium bicarbonate using a 22-gauge oral gavage needle to neutralize their stomach acid for standardized Salmonella infection. After waiting 10 minutes, another 22-gauge gavage needle was used to administer the appropriate dose resuspended in 100 μL of 1X PBS. For the survival study, mice were orally challenged with a lethal dose (4.5 x 10⁶ CFUs) of S. Typhimurium UK-1 following the abovementioned dosing protocol, 7 weeks after their first sEV dose, and their weights and body scores were assessed daily for 30 days or until endpoint. Mice were euthanized in a chamber using CO₂ at a 30-70% displacement rate, followed by a cervical dislocation as a secondary confirmation of death. For serological analysis, blood was collected via the saphenous vein at weeks 1, 3, 5, and 7. After centrifugation at 10,000 × g for 10 minutes, serum was collected and stored at –20°C until ELISA analysis.

To assess the bacterial burden, mice immunized with sEVs or PBS control were challenged with 4.5x10⁶ CFUs of S. Typhimurium given orally, 7 weeks after their first EV dose. 4 days post challenge with Salmonella, mice were euthanized, and their spleen and liver were collected. The organs were weighed and resuspended in 0.1% Triton-X in PBS and lysed using TissueLyser LT (Qiagen). Serial dilutions were made in PBS and 100 μL volume was plated on LB agar plates. The agar plates were incubated at 37°C overnight after which colonies were counted and CFU per gram of each organ was determined.

OmpA gene from S. Typhimurium UK-1 was amplified using polymerase chain reaction (PCR), using the forward primer TAAGCAGGATCCAATGAAACTTAAGTTAGTGGCAGTG and reverse primer TAAGCAAAGCTTTTAGAACTGGTAGTTCAGACCAAC. The amplified fragment was ligated into a pET28a plasmid which was digested using EcoRI and HindIII restriction enzymes. The ligated vector was transformed into E. coli DH5α cells after which the plasmid was purified and re-transformed into E. coli BL21(DE3) cells for protein purification. The 6X His-tagged OmpA was purified using Ni-NTA resin, for which a bacterial culture containing transformed BL21(DE3) cells was grown up to an OD600 of 0.6 which constant shaking at 200 rpm at 28°C. The protein was induced by adding 0.5 mM IPTG to the culture and leaving it overnight in a shaker incubator at 200 rpm at 19°C. After overnight induction the bacterial cells were lysed by sonication and the cell pellet was resuspended and left at room temperature for 15 minutes in 6M urea after centrifugation at 4200 rpm for 10 minutes. The suspension was centrifuged again at 4200 rpm for 20 minutes after which the supernatant was saved for purification of OmpA. Ni-NTA column affinity chromatography was conducted following manufacturer’s instructions (Thermo Fisher Scientific Cat. No. 88228). The eluted sample was run on an SDS-PAGE and was stained with GelCode Blue stain for 2 hours (Thermo Fisher Scientific) and destained with DI water overnight. The resulting OmpA band was excised from the gel, subjected to in-gel trypsin digestion according to standard protocols (11), and analyzed using a timsTOF flex mass spectrometer (Bruker). Peptides were identified via database searching using Mascot (version 2.7.0) against the Salmonella Typhimurium database with trypsin as the specified enzyme, a precursor ion tolerance of 20 ppm, and fragment ion tolerance of 0.50 Da. Carbamidomethylation of cysteine was set as a fixed modification, and variable modifications included methionine oxidation, N-terminal acetylation, pyro-Glu formation from glutamine, and deamidation of asparagine and glutamine. Protein identifications were validated using Scaffold (version 5.2.2, Proteome Software Inc.), with peptide and protein thresholds set at 95% confidence, and requiring a minimum of two unique peptides. Identified proteins were grouped by parsimony and confirmed using the Protein Prophet algorithm.

Nunc 96-well plates were coated with 2 μg LPS-detoxified Salmonella per well and left at room temperature overnight. On day two, excess antigen was removed from the wells by blotting the plate on paper towels. Blocking buffer (PBS with 1% BSA) was added to the wells and the plate was blocked for 2 hours at 37°C. The plate was washed three times with PBST followed by two washes with PBS. The plate was blotted dry after each wash. Serum dilutions were prepared in ELISA buffer (PBS with 0.5% BSA and 0.05% Tween20) and added to the wells containing Salmonella antigen. The plate was refrigerated overnight. On day three, plates were washed as previously described. HRP-conjugated goat anti-mouse IgG (Southern Biotech, Cat. No. 1030-05) diluted 1:2,000 in ELISA buffer was added (50 μL/well), and plates were incubated for 90 minutes at 37°C. After washing, 50 μL ABTS (2,2’-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)) substrate was added per well and developed for 30 minutes at room temperature. Absorbance was read at 415 nm using a Cytation 3 plate reader (BioTek).

GraphPad Prism 10.3.1 was used for figure rendering, and statistical results are denoted with ns for not significant * for p-value at <0.05, ** at <0.01, *** and **** at p<0.0001 in each graph. For comparing two groups with equal variances, students t-test was applied. For comparing three or more groups, one-way and two-way ANOVA with post hoc Tukey’s multiple comparison tests were performed. Schematic diagrams representing study design were created using Biorender.

In the present study, we evaluated the immunogenicity and protective efficacy of sEVs administered via the oral route. sEVs were isolated from S. Typhimurium-infected macrophages and characterized by standard methods. Western blotting confirmed the presence of canonical sEV tetraspanins CD63 and CD9, and Alix, a cytoplasmic marker. Furthermore, the presence of Salmonella antigen OmpA in sEVs was also confirmed ( Figure 1A ). Comparative analysis using the MACSplex EV kit revealed a significant reduction in the tetraspanins CD63, CD81 and CD9 in sEVs derived from Salmonella-infected macrophages (obtained at 24- and 48- hours post-infection) relative to uninfected controls. Notably, CD40 expression was upregulated in sEVs from infected cells, while MHCII showed a slight albeit insignificant increase ( Figure 1B ). Nanoparticle tracking analysis (NTA) showed consistent vesicle size distributions and yields across independent isolations ( Figures 1C–F ). The protein-to-particle ratio was determined using a BCA protein assay to calculate the sEV production per cell, which remained reproducible, confirming the reliability of our preparation protocol.

To evaluate the protective efficacy of the oral dose of sEVs derived from Salmonella-infected macrophages, 7-week-old BALB/c mice were immunized with sEVs (40 µg per dose) or phosphate-buffered saline (PBS) as a negative control. Our previous studies have already established a protective response to immunization with a positive control – an attenuated Salmonella strain – S. Typhimurium ΔaroA (χ9099), delivered orally (12). Mice received three doses at two-week intervals. Three weeks following the final booster, mice from both groups were challenged with a lethal dose of S. Typhimurium UK-1 (χ3761) delivered using oral gavage ( Figure 2A ). Clinical symptoms were monitored daily through body condition scoring and weight measurement. Upon challenge with virulent S. Typhimurium, sEV-immunized mice showed improved body condition scores ( Figure 2B ), reduced weight loss ( Figure 2C ), and significantly lower bacterial burdens in the liver at day 4 post-infection ( Figure 2D ), Moreover, survival analysis revealed a significantly higher survival rate in the sEV-treated group compared to controls over 30 days post-infection with Salmonella ( Figure 2E ).

Mice that received three oral doses of sEVs exhibited elevated serum IgG levels against LPS-detoxified Salmonella lysate compared to PBS controls. Additionally, sEV immunized mice showed comparable IgG production, beginning three weeks all the way up to seven weeks after immunization, to the positive control Salmonella ΔaroA, affirming the efficacy of our sEVs over a long period of time ( Figure 3A ). Due to various Salmonella antigens being encapsulated and enriched in sEVs from Salmonella-infected macrophages, we predicted that immunized mice could produce serum IgG to a known immunodominant protein OmpA. To demonstrate this, recombinant S. Typhimurium OmpA was purified using affinity chromatography and the sequence was confirmed via mass spectrometry ( Supplementary Figure S1 ). Mice immunized with sEVs produced significantly higher levels of OmpA-specific serum IgG as compared to the control group over a period of seven weeks ( Figure 3B ). These findings demonstrate that sEVs derived from S. Typhimurium-infected macrophages, when delivered orally, can confer significant protection against lethal Salmonella challenge. Results from our current study expand on previous work utilizing intranasal delivery and highlight the potential of sEVs as an orally deliverable vaccine platform.