<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2025.1627057</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Immunology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Identification and validation of expression and functions of ferroptosis-related gene HILPDA in early-onset preeclampsia placentas</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Wang</surname>
<given-names>Qianghua</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Wang</surname>
<given-names>Xuegu</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Fei</surname>
<given-names>Jiaojiao</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Jiang</surname>
<given-names>Chuanyue</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Tao</surname>
<given-names>Yafen</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Yang</surname>
<given-names>Nana</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1453530/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chen</surname>
<given-names>Huijuan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Dou</surname>
<given-names>Chengli</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Ding</surname>
<given-names>Biao</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Du</surname>
<given-names>Danli</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2104208/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Li</surname>
<given-names>Xiang</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3031056/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Laboratory of Department of Infectious Diseases, First Affiliated Hospital of Bengbu Medical University</institution>, <addr-line>Bengbu, Anhui</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Reproductive Medicine Center, First Affiliated Hospital of Bengbu Medical University</institution>, <addr-line>Bengbu, Anhui</addr-line>, <country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Molecular Diagnosis Center, Anhui Province Key Laboratory of Clinical and Preclinical Research in Respiratory Disease, First Affiliated Hospital of Bengbu Medical University</institution>, <addr-line>Bengbu, Anhui</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Simona W. Rossi, University of Basel, Switzerland</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Yusmaris Cariaco, University of Ottawa, Canada</p>
<p>Umida Ganieva, Rosalind Franklin University of Medicine and Science, United States</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Xiang Li, <email xlink:href="mailto:xiangli@bbmu.edu.cn">xiangli@bbmu.edu.cn</email>; Danli Du, <email xlink:href="mailto:dudanli0224@163.com">dudanli0224@163.com</email>
</p>
</fn>
<fn fn-type="equal" id="fn003">
<p>&#x2020;These authors have contributed equally to this work</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>11</day>
<month>08</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2025</year>
</pub-date>
<volume>16</volume>
<elocation-id>1627057</elocation-id>
<history>
<date date-type="received">
<day>12</day>
<month>05</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>25</day>
<month>07</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Wang, Wang, Fei, Jiang, Tao, Yang, Chen, Dou, Ding, Du and Li.</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Wang, Wang, Fei, Jiang, Tao, Yang, Chen, Dou, Ding, Du and Li</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>Early-onset preeclampsia (EOPE) is a severe form of preeclampsia that mainly contributes to maternal and perinatal morbidity and mortality worldwide. This study aimed to systematically analyze the expression and function of ferroptosis-related gene HILPDA in EOPE placentas.</p>
</sec>
<sec>
<title>Methods</title>
<p>We included five transcriptomic datasets (GSE148241, GSE44711, GSE74341, GSE114691, GSE10588) downloaded from the Gene Expression Omnibus (GEO) in this study. Using differential expression analysis, weighted gene co-expression network analysis (WGCNA), and machine learning models (LASSO, SVM-RFE, Random Forest), We identified hub genes and diagnostic biomarkers. We performed functional enrichment (GO and KEGG) and immune infiltration analysis to elucidate molecular mechanisms. Experimental validation included Western blot on clinical placental samples and siRNA-mediated knockdown in HTR-8/SVneo trophoblasts to assess migration.</p>
</sec>
<sec>
<title>Results</title>
<p>We observed HILPDA upregulation and confirmed its diagnostic accuracy (AUC=0.71) in EOPE placentas. Functional analysis revealed HILPDA-associated enrichment in immune regulation (leukocyte migration, MHC complexes) and cellular processes (collagen organization, HIF-1 signaling). Through WGCNA, we identified 171 HILPDA-associated DEGs. Machine learning prioritized PART1 as diagnostic biomarkers. Immune profiling highlighted HILPDA&#x2019;s correlation with activated dendritic cells, neutrophils and resting mast cells. Experimentally, we confirmed HILPDA up-regulation in EOPE placentas and its critical role in suppressing trophoblast migration.</p>
</sec>
<sec>
<title>Conclusions</title>
<p>Our study establishes HILPDA as a central mechanistic regulator involved in placental immune dysregulation and trophoblast migration in EOPE pathogenesis. The identified biomarkers PART1 and HILPDA-associated pathways may offer novel diagnostic and therapeutic targets for EOPE management, which contribute to reduce maternal morbidity and prevent perinatal mortality in this catastrophic pregnancy syndrome.</p>
</sec>
</abstract>
<kwd-group>
<kwd>early-onset preeclampsia</kwd>
<kwd>HILPDA</kwd>
<kwd>trophoblast migration</kwd>
<kwd>immune infiltration</kwd>
<kwd>ferroptosis</kwd>
</kwd-group>
<counts>
<fig-count count="8"/>
<table-count count="0"/>
<equation-count count="0"/>
<ref-count count="38"/>
<page-count count="16"/>
<word-count count="6362"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Immunological Tolerance and Regulation</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Preeclampsia (PE), a common obstetric complication specific to human, accounts for approximately 70,000 maternal and 500,000 fetal deaths annually, with a global incidence ranging from 5% to 7% of all pregnancies (<xref ref-type="bibr" rid="B1">1</xref>). PE is characterized by new-onset hypertension and proteinuria in the maternal host after the 20th week of gestation, often accompanied by organ damage such as hepatic and renal impairment. Based on the timing of clinical symptoms onset, PE is classified into two categories (<xref ref-type="bibr" rid="B2">2</xref>): early-onset preeclampsia (EOPE, &lt;34 gestational weeks) and late-onset preeclampsia (LOPE, &#x2265;34 gestational weeks). Compared to LOPE, EOPE exhibits an expeditious onset, swift progression, and an unfavorable prognosis. Despite its prevalence, the pathogenic mechanisms of PE remain unclear, and effective treatments and preventive strategies, aside from timely pregnancy termination, are lacking (<xref ref-type="bibr" rid="B3">3</xref>).</p>
<p>Recent studies have established a strong correlation between the occurrence of EOPE and placental ferroptosis. Ferroptosis is a novel form of programmed cell death, triggered by the catalysis of cell membrane unsaturated fatty acid lipids by ferrous iron or lipoxygenase. Unlike apoptosis, necrosis, and autophagy, ferroptosis is iron-dependent and closely associated with oxidative stress (<xref ref-type="bibr" rid="B4">4</xref>). During pregnancy, the increased maternal iron demand and reduced response to environmental iron exposure make pregnant individuals prone to iron overload, resulting in pregnancy complications (<xref ref-type="bibr" rid="B5">5</xref>). Previous studies have shown that serum iron and ferritin levels are significantly higher in patients with EOPE compared to those with LOPE and control groups, indicating a strong positive correlation with the severity of PE (<xref ref-type="bibr" rid="B5">5</xref>). This is supported by other studies that showed the significant role of ferroptosis in the pathogenesis of EOPE (<xref ref-type="bibr" rid="B6">6</xref>, <xref ref-type="bibr" rid="B7">7</xref>).</p>
<p>In preeclamptic patients, abnormal remodeling of uterine spiral arteries leads to placental ischemia and hypoxia, causing oxidative stress and elevated reactive oxygen species (ROS) in the placenta. Growing evidence suggests that iron-induced ferroptosis, driven by iron overload and placental hypoxia, plays a significant role in the pathogenesis of PE. In animal models of PE, inhibiting ferroptosis alleviates PE symptoms and improves fetal survival rates (<xref ref-type="bibr" rid="B8">8</xref>). Decreasing ferritin levels early in pregnancy or increasing them later exacerbates PE symptoms by promoting ferroptosis (<xref ref-type="bibr" rid="B9">9</xref>). A recent study indicates that ferroptosis caused by ferritin light chain deficiency can induce PE by disrupting the remodeling of uterine spiral arteries (<xref ref-type="bibr" rid="B7">7</xref>). While ferroptosis provides a mechanistic framework for placental damage, the upstream triggers remain incompletely defined.</p>
<p>Hypoxia-inducible lipid droplet-associated protein (HILPDA) is a small protein induced by hypoxia, consisting of 63 amino acids (<xref ref-type="bibr" rid="B10">10</xref>). It plays a critical regulatory role in the storage of triglycerides and the supply of intracellular fatty acids, thus promoting lipid storage in liver cells, macrophages, and cancer cells (<xref ref-type="bibr" rid="B10">10</xref>). A recent study suggests that the hypoxia-induced HIF-2&#x3b1; subtype can reshape the cell membrane&#x2019;s polyunsaturated lipids via HILPDA, thereby increasing the sensitivity of clear cell carcinoma cells to ferroptosis (<xref ref-type="bibr" rid="B11">11</xref>). However, the role of HILPDA in PE is still unknown.</p>
<p>In this study, we identified the ferroptosis-related gene HILPDA as a potential biomarker for EOPE. Using integrated computational and bioinformatics strategies, we analyzed HILPDA-related genes and signaling pathways in PE placentas. Additionally, we validated the expression of HILPDA in EOPE placentas and examined its regulatory role in cell migration within trophoblast cells <italic>in vitro</italic>. Our findings underscore the significant involvement of HILPDA in EOPE and offer new insights and potential therapeutic targets for managing this severe obstetric complication.</p>
</sec>
<sec id="s2">
<label>2</label>
<title>Methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Data acquisition</title>
<p>In this study six public transcriptomic datasets GSE148241 (<xref ref-type="bibr" rid="B12">12</xref>), GSE44711 (<xref ref-type="bibr" rid="B13">13</xref>), GSE74341 (<xref ref-type="bibr" rid="B14">14</xref>), GSE114691 (<xref ref-type="bibr" rid="B15">15</xref>), GSE10588 (<xref ref-type="bibr" rid="B16">16</xref>) and GSE75010 (<xref ref-type="bibr" rid="B17">17</xref>) (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S1</bold>
</xref>) were downloaded from the Gene Expression Omnibus database (GEO) (<xref ref-type="bibr" rid="B18">18</xref>) (<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/geo/">https://www.ncbi.nlm.nih.gov/geo/</ext-link>) based on: 1) Sample size &#x2265; 5 per group (EOPE vs. control); 2) Clinically confirmed EOPE diagnosis per ACOG criteria; 3) Exclusive use of placental tissue (no cell lines or other tissues). Platform-specific normalization pipelines were implemented: RNA-seq datasets (GSE114691) underwent median-of-ratios normalization using DESeq2, while microarray datasets (GSE148241, GSE10588, GSE44711, GSE74341, GSE75010) were processed with limma quantile normalization.</p>
<p>The ferroptosis-related gene sets were acquired from FerrDb (<ext-link ext-link-type="uri" xlink:href="http://www.zhounan.org/ferrdb/index.html">http://www.zhounan.org/ferrdb/index.html</ext-link>) (<xref ref-type="bibr" rid="B19">19</xref>). FerrDb contained 258 experimentally validated FRGs at time of access (2022). Database expansions since then include indirect regulators not analyzed here. The full list of FRGs was shown in <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Material</bold>
</xref>.</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>EOPE placenta collection</title>
<p>Placental specimens were obtained from six normal normotensive controls and six EOPE cases (determined through power analysis and clinical constraints) after obtaining informed consent (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S2</bold>
</xref>). EOPE diagnosis followed the American College of Obstetricians and Gynecologists (ACOG) criteria, requiring new-onset hypertension (systolic BP &#x2265;140 mmHg/diastolic &#x2265;90 mmHg) with proteinuria (&#x2265;300 mg/24h) or end-organ dysfunction, occurring after 20 weeks and before 34 weeks of gestation. Exclusion criteria include: pregnant women diagnosed with cardiovascular disease, metabolic syndrome, endocrine disorders, liver, or kidney diseases, as well as cases involving fetal malformations or chromosomal abnormalities. The samples were then cleansed with balanced salt solution to eliminate any blood, flash-frozen in liquid N<sub>2</sub> within 20 min of delivery, and stored at -80&#xb0;C for &#x2264;6 months before analysis for western blot analyses. The Ethics Committee of the First Affiliated Hospital of Bengbu Medical College granted approval for this study under protocol number ([2024]KY023).</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Cell culture and treatment</title>
<p>HTR-8/SVneo cells were cultured in RPMI-1640 complete medium (RPMI-1640 medium containing 10% fetal bovine serum (FBS, 164210, Procell Life Science &amp; Technology, Wuhan, Hubei, China), 100 U/ml penicillin, and 100 &#x3bc;g/ml streptomycin) at 37 &#xb0;C with 5% CO2. Cells were seeded in the RPMI-1640 complete medium for 24 hours and then transfected with siRNAs or negative control siRNA using Lipo3000 (Thermo Fisher Scientific, USA) for 48 hours and the knockdown efficiency was confirmed by real-time quantitative PCR and western blot. The siRNA sequences are shown as <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S3</bold>
</xref>.</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Real-time quantitative PCR</title>
<p>Total RNA from cells was extracted using TRIzol (Invitrogen, Carlsbad, CA). The concentration and purity of the extracted RNA were evaluated with a NanoDrop&#x2122; One/OneC (Thermo Fisher Scientific). cDNA was generated using a Novo-Scrip<sup>&#xae;</sup> Plus All-in-one 1st Strand cDNA Synthesis Kit (E042-01B, Novoprotein, China) at 42&#xb0;C for 5 minutes, 50&#xb0;C for 15 minutes, and 75&#xb0;C for 5 minutes. The qRT-PCR was performed using NovoStart<sup>&#xae;</sup> SYBR qPCR SuperMix Plus (E167-01A, Novoprotein, China) and the LightCycler 480 (Roche, Basel, Switzerland) was used for amplifications and quantifications. Primers were validated through melt curve analysis (single-peak confirmation) and the sequences were shown as follows (5&#x2032;&#x2013;3&#x2032;):</p>
<list list-type="simple">
<list-item>
<p>HILPDA-F: AAGCATGTGTTGAACCTCTAC</p>
</list-item>
<list-item>
<p>HILPDA-R: TGTGTTGGCTAGTTGGCTTCT</p>
</list-item>
<list-item>
<p>GAPDH-F: CAATATGATTCCACCCATGGCA</p>
</list-item>
<list-item>
<p>GAPDH-R: GCATCGCCCCACTTGATTTT</p>
</list-item>
</list>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Western blot</title>
<p>Cultured cells or pre-homogenized tissues were lysed with &#x200b;ice-cold RIPA buffer (Beyotime, P1005, China) containing 1&#xd7; protease inhibitor cocktail&#x200b;(Beyotime, P0013B, China) with gentle agitation at 4&#xb0;C for 30 min, followed by&#x200b;centrifugation at 12,000&#xd7;g for 15 min at 4&#xb0;C to collect clarified lysates. The total protein was quantified using the Total Protein Assay Kit (Beyotime, P0012, China) and subsequently denatured. Proteins (50 &#x3bc;g per lane) were separated on SDS&#x2013;polyacrylamide gels and then transferred onto polyvinylidene fluoride (PVDF) membranes. The membranes were incubated overnight at 4&#xb0;C with the following primary antibodies: anti-HILPDA (sc-376704, 1:100, Santa Cruz) and anti-&#x3b2;-actin (LF201, 1:5000, Epizyme, Shanghai, China). After being washed with TBST, the membranes were incubated for 2 hours at room temperature with HRP-labeled Goat Anti-Mouse IgG secondary antibodies (LF101, 1:5000, Epizyme, Shanghai, China). Protein bands were detected using a ChemiDoc Imaging System (UVP ChemStudio, Analytik Jena, Germany) and quantified with ImageJ software.</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Wound healing assay</title>
<p>HTR-8/SVneo cells transfected with siHILPDA or controls (scrambled siRNA) were scratched using 200-&#x3bc;l pipette tips when cells were cultured to approximately 90% confluency. After gently washing the cells twice with phosphate-buffered saline (PBS), the wells were replenished with serum-free RPMI 1640 medium (Thermo Fisher Scientific, USA) to eliminate proliferation bias. Microscopic images of the wound areas were captured at 0 h (baseline) and 24 h post-wounding using an inverted phase-contrast microscope (Motic, Xiamen, China). Quantitative analysis of cell migration was performed by measuring the residual scratch area at both time points with ImageJ software. The migration rate was calculated using the following formula: [(Initial area - Final area)/Initial area] &#xd7; 100%.</p>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Differentially expressed genes analysis and the screening and evaluation of candidate genes</title>
<p>The limma and DESeq2 packages in R were used to identify differentially expressed genes (DEGs). For RNA-seq count data, genes were filtered by requiring &#x2265;10 raw counts in a minimum of k samples, with k defined as the sample size of the smallest experimental group (EOPE or CON). DEGs were defined by p-value &lt;0.05 and |log<sub>2</sub>FC| &gt; 1. In GSE114691 datasets, all patients were stratified into HILPDA-high and HILPDA-low groups based on median HILPDA expression, with DEGs identified using p-value &lt;0.05 and |FC| &gt; 1. The VennDiagram package in R was used to identify common genes among DEGs in the GSE148241, DEGs in GSE44711 and ferroptosis-related gene sets. Receiver operating characteristic (ROC) curves and the area under the ROC curve (AUC) were calculated to evaluate the diagnostic potential of the candidate genes.</p>
</sec>
<sec id="s2_8">
<label>2.8</label>
<title>Machine learning algorithms for identification of candidate diagnostic biomarkers</title>
<p>Three machine learning models (LASSO, SVM-RFE, Random Forest) were trained on z-score normalized expression of the 171 WGCNA-selected genes. 10-fold cross-validation with 5 repeats was used for hyperparameter tuning and performance evaluation. The least absolute shrinkage and selection operator (LASSO) regression, random forest and support vector machine-recursive feature elimination (SVM-RFE) were performed on GSE114691(n=61: 21 EOPE/40 controls). Model discrimination was quantified by mean cross-validated AUC. External validation was performed on GSE75010.</p>
<p>The LASSO regression, implemented via the R package <italic>glmnet</italic> (<italic>v4.1-8)</italic>, employs L1 regularization to achieve high-dimensional data compression and feature selection. In this analysis, the algorithm effectively distilled 171 candidate genomic features into 5 non-zero biomarkers through an optimized &#x3bb; parameter (lambda.1se = 0.186) determined via 10-fold cross-validation.</p>
<p>The random forest algorithm was implemented using the <italic>randomForest</italic> (<italic>v4.7-1.2)</italic> package in R. Initial model training employed 1,000 decision trees (ntree = 1000) to capture feature interactions, with subsequent optimization using out-of-bag (OOB) error analysis. The optimal mtry (number of features per split) was determined via iterative testing (1&#x2013;20 features), selecting the value minimizing OOB error (mtry = 14).</p>
<p>The SVM-RFE algorithm integrates L2-norm regularization with backward feature elimination to identify optimal feature subsets for predictive modeling. Implemented via the <italic>e1071 (v1.7-16)</italic> and <italic>caret (v7.0-1)</italic> R packages. A 10-fold cross-validation (nfold&#xa0;= 10) was applied to partition samples into training/validation subsets.</p>
</sec>
<sec id="s2_9">
<label>2.9</label>
<title>Weighted gene co-expression network analysis</title>
<p>To identify the co-expression gene module associated with EOPE and the screened candidate gene HILPDA, WGCNA was performed in GSE114691 datasets using the WGCNA package in R. Specifically, hierarchical clustering analysis was first performed using <italic>hclust</italic> function, and then the suitable soft threshold power was determined using the pickSoftThreshold function and an adjacency cutoff value of 0.9. We selected a soft-thresholding power of 19 based on rigorous evaluation of the scale-free topology criterion. This power represented the minimum value achieving satisfactory scale-free model fit (R&#xb2; = 0.92) while maintaining biological interpretability. Finally, co-expression gene modules were constructed by set the minimum module size of 30.</p>
</sec>
<sec id="s2_10">
<label>2.10</label>
<title>Functional enrichment analysis</title>
<p>To perform functional enrichment analysis of screened genes associated with EOPE and HILPDA expression, Functional enrichment was performed using the clusterProfiler package (v4.10.0). Gene ontology (GO) terms (<xref ref-type="bibr" rid="B20">20</xref>) and Kyoto Encyclopedia of Genes and Genomes (KEGG) (<xref ref-type="bibr" rid="B21">21</xref>) analyses were conducted with enrichGO and enrichKEGG package respectively. The GO analysis encompassed biological processes (BPs), cellular components (CCs), molecular functions (MFs), and pathway analyses. The Benjamini-Hochberg method was employed to adjust the P values, with adjusted <italic>P</italic>-values &lt; 0.05 set as the threshold for significance.</p>
</sec>
<sec id="s2_11">
<label>2.11</label>
<title>Immune infiltration analysis</title>
<p>Immune cell infiltration analysis was performed using &#x200b;CIBERSORT (v1.03) (<xref ref-type="bibr" rid="B22">22</xref>).&#x200b;&#x200b; The LM22 gene signature&#x200b; (downloaded from CIBERSORT portal) containing 547 genes defining 22 human immune cell types. Gene expression matrices were formatted with unique gene symbols&#x200b; in row names (duplicates resolved by &#x200b;mean expression). We ensured &#x200b;no missing values&#x200b; by excluding genes with missing data and enabled &#x200b;quantile normalization (QN=TRUE)&#x200b;&#x200b; to minimize batch effects across samples. To investigate immunomodulatory relationships, Spearman&#x2019;s rank correlation analysis was systematically performed between HILPDA expression and immune subsets.</p>
</sec>
<sec id="s2_12">
<label>2.12</label>
<title>Gene set enrichment analysis</title>
<p>In the GSE114691 datasets, gene set enrichment analysis (GSEA) (<xref ref-type="bibr" rid="B23">23</xref>) was performed between low- and high-HILPDA expression (dichotomized at median expression) to identify the biological process (GO term) and pathways (KEGG) associated with HILPDA expression. Gene set permutations to compute log2 fold change. GSEA analysis was performed using the gseGO and gseKEGG methods of the clusterprofiler package in R.</p>
</sec>
<sec id="s2_13">
<label>2.13</label>
<title>Statistical analysis</title>
<p>Continuous variables between two groups were compared using unpaired Student&#x2019;s t-tests&#x200b;, implemented in GraphPad Prism 9. Bioinformatics analyses were conducted using R software (v4.3.1). The chi-squared tests were used for the analysis of count data between two groups. All data are presented as mean &#xb1; standard deviation (SD). A <italic>P</italic>-value of less than 0.05 was considered statistically significant.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Identification of HILPDA as a differentially expressed ferroptosis-related gene and diagnostic biomarker in EOPE placentas</title>
<p>To screen for the differentially expressed FRGs in EOPE, differential expression analysis between the placenta samples from EOPE and control patients was performed in GSE148241(32 controls, 9 EOPE) and GSE44711 (8 controls, 8 EOPE) datasets. The study workflow was shown in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>. Volcano plots identified 763 DEGs (432 upregulated) in GSE148241 placentas (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>) and 1,014 DEGs (597 upregulated) in GSE44711 (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>) based on p value &lt; 0.05 and |logFC| &gt; 1. Two differentially expressed FRGs (HILPDA and SCD) were identified in EOPE after intersection with DEGs in GSE148241 and GSE44711 datasets (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>). To verify the expression of the two screened genes in the placenta of PE subtypes, we further analyzed further the expression of HILPDA and SCD in GSE74341. The GSE74341 dataset was prioritized for validation due to its &#x200b;comprehensive stratification of PE subtypes: early-onset PE (n=7, &lt;34 weeks), late-onset PE (n=8, &gt;36 weeks), preterm controls (n=5, &lt;34 weeks), and term controls (n=5, &gt;36 weeks). This design enables rigorous comparison of HILPDA expression across gestation-matched pathological and physiological contexts. The HILPDA expression in EOPE placentas was significantly increased compared to the Preterm, Term and LOPE groups (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>). However, the expression of SCD in the EOPE placentas showed no significant difference in either the GSE74341 dataset (vs. preterm and term placentas; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;1A</bold>
</xref>) or the GSE114691 dataset (vs. normotensive controls; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;1B</bold>
</xref>). Additionally, ROC curve analysis demonstrated that HILPDA exhibited high diagnostic accuracy for EOPE (AUC = 0.812 in GSE114691 and AUC = 0.871 in GSE10588; <xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2E, F</bold>
</xref>), while the AUC of SCD was 0.655 in GSE10588 (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;1C</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>The workflow of the present study.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1627057-g001.tif">
<alt-text content-type="machine-generated">Flowchart depicting the analysis of ferroptosis-related genes (FAGs) and their correlation with preeclampsia. It includes dataset IDs, analysis methods like ROC and WGCNA, machine learning algorithms, functional enrichment analysis, and validation steps. Highlighted processes involve differentially expressed genes, preeclampsia-related gene identification, and immune infiltration analysis.</alt-text>
</graphic>
</fig>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Differentially expressed ferroptosis-related genes (FRGs) and the prognostic value of HILPDA in EOPE. <bold>(A)</bold> The volcano plot of differentially expressed genes (DEGs) in the placental samples of EOPE patients from GSE148241 and GSE44711(n); <bold>(B)</bold> The volcano plot of differentially expressed genes (DEGs) in the placental samples of EOPE patients from; <bold>(C)</bold> Intersection of DEGs from GSE148241 and GSE44711 with FRGs. <bold>(D)</bold> The expression of HILPDA in placentas from preterm, term, LOPE and EOPE patients in GSE74341. The ROC curve of HILPDA for diagnosing EOPE in GSE114691 <bold>(E)</bold> and GSE10588 <bold>(F)</bold> dataset. <sup>*</sup>
<italic>P</italic> less than 0.05; <sup>***</sup>
<italic>P</italic> less than 0.001; <sup>****</sup>
<italic>P</italic> less than 0.0001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1627057-g002.tif">
<alt-text content-type="machine-generated">A series of charts analyze gene expression and statistical data.   A and B: Volcano plots showing gene expression from datasets GSE148241 and GSE44711, highlighting upregulated (red) and downregulated (blue) genes.   C: Venn diagram showing overlap in different gene datasets.   D: Box plot comparing HILPDA expression levels across different conditions, with significant differences indicated.   E and F: ROC curves measuring sensitivity and specificity for HILPDA, with AUC values of 0.812 and 0.871, indicating model performance.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Identification of differentially expressed genes between HILPDA-high and -low groups</title>
<p>Given the elevated HILPDA expression in EOPE placentas and its strong diagnostic performance, additional genes correlated with HILPDA expression and associated with EOPE were identified in GSE114691 datasets. Stratification of GSE114691 samples (n=61) by median HILPDA expression yielded 33 HILPDA-high and 28 HILPDA-low placentas. As shown in <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>, in the GSE114691 dataset, HILPDA expression was significantly upregulated in EOPE placentas, consistent with results from the GSE148241 and GSE44711 datasets. Compared to the HILPDA-low expression group, 298 DEGs were identified in the HILPDA-high samples (logFC &gt; 1 and p value &lt; 0.05), comprising 241 upregulated and 57 downregulated genes (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>). The 30 most significantly upregulated and 30 downregulated genes (ranked by log2FoldChange) were displayed in a heatmap (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>). These findings suggested HILPDA may take important roles in regulating placenta transcriptome.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>The expression of HILPDA in EOPE placentas and differential expression gene analysis between HILPDA-high and -low group. <bold>(A)</bold> The expression of HILPDA in EOPE placentas of GSE114691 dataset; <bold>(B)</bold> Volcano plot of differentially expressed genes (DEGs) between HILPDA-high and -low group in GSE114691 dataset; <bold>(C)</bold> A heatmap of 30 most up-regulated and 30 most down-regulated genes between HILPDA-high and low group; <sup>**</sup>
<italic>P</italic> less than 0.01.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1627057-g003.tif">
<alt-text content-type="machine-generated">Box plot, volcano plot, and heatmap showing gene expression analysis. Panel A displays box plots comparing HILPDA expression in CON and EOPE groups, indicating statistical significance. Panel B is a volcano plot with 241 upregulated and 57 downregulated genes, based on a log fold change cutoff of 1. Panel C is a heatmap with hierarchical clustering, showing expression levels of various genes in CON and EOPE groups, using color gradients to represent expression intensity.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Functional enrichment analysis of genes associated with HILPDA expression</title>
<p>Functional enrichment analyses of all 298 DEGs between HILPDA-high and HILPDA-low groups were systematically conducted to elucidate the biological significance of HILPDA-associated genes. GO enrichment plots for BP, CC, and MF terms are shown in <xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4A&#x2013;C</bold>
</xref>, which revealed significant enrichment of differentially expressed genes (DEGs) between HILPDA-high and -low group across all three GO domains. The biological process (BP) category revealed prominent involvement in leukocyte migration and bacterial molecular pattern response, while cellular component (CC) analysis identified enrichment in collagen-rich extracellular matrix and MHC protein complexes (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4A, B</bold>
</xref>, <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;2</bold>
</xref>). Molecular function (MF) characterization further showed significant enrichment in immune receptor binding activity and humoral immune mediators (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4C</bold>
</xref>, <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;2</bold>
</xref>). Furthermore, the KEGG pathway analysis revealed that DEGs between HILPDA-high and -low group were significantly involved in pathways including cell adhesion molecules and HIF&#x2212;1 signaling pathway (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4D</bold>
</xref>). The results from GSEA showed that biological processes leukocyte migration and mononuclear cell migration were significantly enriched in HILPDA-low samples, while cell adhesion molecules, HIF-1 signaling pathway, and response to hypoxia pathway significantly enriched in HILPDA-high samples (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4E</bold>
</xref>). The enrichment of these pathways (immune dysregulation, matrix dysmorphia, and hypoxia adaptation) suggested HILPDA&#x2019;s role in EOPE pathogenesis.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Functional enrichment analysis of differentially expressed genes between HILPDA-high and -low group. Bubble plot showing the gene ontology (GO) analysis of biological process (BP) <bold>(A)</bold>, cellular component (CC) <bold>(B)</bold> and molecular function (MF) <bold>(C)</bold> for upregulated genes between HILPDA-high and &#x2013;low group. <bold>(D, E)</bold> Enrichment analyses via gene set enrichment analysis for HILPDA-related genes.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1627057-g004.tif">
<alt-text content-type="machine-generated">Five panels display gene set enrichment analysis. Panel A shows biological processes with significant terms like leukocyte migration. Panel B focuses on cellular components like extracellular matrix. Panel C highlights molecular functions such as binding activities. Panel D outlines pathways like cytokine interactions. Panel E presents enrichment plots for terms including leukocyte migration and hypoxia response, with p-values indicating significance. Each dot plot uses color gradients to denote statistical significance and dot size to indicate gene count.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>WGCNA-based identification of genes associated with EOPE and HILPDA expression</title>
<p>To determine the gene sets closely associated with EOPE, WGCNA was performed on the top 5,000 most variably expressed genes (selected by median absolute deviation to capture biologically relevant signals) across GSE114691 samples (n=61). As shown in <xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A, B</bold>
</xref>, a soft threshold of 11(Minimum value achieving scale-free topology and lower powers compromise network biological validity) was employed to achieve an adjacency cutoff value of 0.85. After setting the minimum gene module size to 30, a total of ten modules were identified (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>), with the blue module (enriched in immune regulation genes) showing the strongest positive correlation (cor = 0.85, <italic>P</italic> = 5.1&#xd7;10<sup>-192</sup>) with EOPE status&#x200b;. The overlap between genes in the blue module and DEGs in the HILPDA-low/high groups included 171 genes, potentially identified as EOPE-correlated genes associated with HILPDA expression (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5F</bold>
</xref>).</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Weighted correlation network analysis (WGCNA) for screening the genes related to EOPE and HILPDA expression. <bold>(A, B)</bold> WGCNA with 0.85 and 11 as adjacency cutoff value and soft threshold, respectively; <bold>(C)</bold> The co-expression gene dendrogram and modules with different color; <bold>(D)</bold> The heatmap showing the correlation between gene modules and EOPE; <bold>(E)</bold> Correlation analysis of genes and EOPE within the blue module. <bold>(F)</bold> Venn diagram of the blue module and differentially expressed genes between HILPDA-high and -low group in GSE114691 dataset.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1627057-g005.tif">
<alt-text content-type="machine-generated">Graphical representation of network analysis results in six panels. Panel A shows a plot of mean connectivity versus soft threshold power, with a decreasing curve. Panel B displays scale independence as a function of soft threshold power, indicating an increasing trend. Panel C presents a cluster dendrogram with colored module bars representing different clusters. Panel D is a heatmap of module-trait relationships, with varying color intensities. Panel E is a scatter plot showing the correlation between module membership and gene significance. Panel F is a Venn diagram comparing genes associated with High HILPDA versus Low HILPDA and the blue model of WGCNA.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_5">
<label>3.5</label>
<title>Integration of multi-machine learning approaches for biomarker identification</title>
<p>Three machine learning models were trained on the 171 HILPDA-associated genes using GSE114691 samples with stratified 10-fold cross-validation (repeated 5 times) to maintain class balance. LASSO regression (glmnet v4.1-8) analysis (lambda.1se = 0.186) identified 5 candidate diagnostic biomarkers (PART1 NRAD1, HTRA1, LOC107985906, HTRA4) (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>). Subsequent application of SVM-RFE with 10-fold cross-validation revealed 4 high-confidence genes (LOC105369957, PART1, MYO7B, CLDN9) demonstrating optimal classification performance (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>). Finally, parallel random forest analysis (1000 decision trees, Mean Decrease Accuracy (ranked exclusively by Mean Decrease Accuracy) and Gini impurity criterion) independently prioritized 21 candidate genes through variable importance scoring (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>). Intersection analysis of the three method-specific candidate pools (LASSO:5, SVM-RFE:4, RF:21) identified one consensus biomarker PART1 (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6D</bold>
</xref>). PART1 is a long noncoding RNA that has been reported to has important role in regulating cell proliferation and invasion (<xref ref-type="bibr" rid="B24">24</xref>, <xref ref-type="bibr" rid="B25">25</xref>). We validated the diagnostic performance of the identified biomarker PART1 using the independently selected external dataset GSE75010. Within this dataset, PE patients with a gestational age of less than 34 weeks were designated as the EOPE group. The ROC curve for PART1 was generated using raw expression values on a GSE75010 (49 EOPE, 77 controls) and present a good diagnostic performance for EOPE (AUC=0.889; 95% CI: 0.831-0.948) (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6E</bold>
</xref>).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Selection of candidate diagnostic biomarkers of EOPE from HILPDA-related and EOPE-related genes with machine learning approaches. <bold>(A)</bold> Constructed a coefficient path plot of regularization parameter &#x3bb; through 10 folds cross-validation to determine the optimal &#x3bb;; <bold>(B)</bold> Identified 4 diagnostic biomarkers using the SVM-RFE algorithm with recursive feature elimination based on SVM weight ranking; <bold>(C)</bold> Ranked 30 genes by importance scores (%IncMSE or Gini index) derived from random forest; <bold>(D)</bold> The Venn diagram showed the intersection of candidate gene PART1 selected by LASSO, SVM-RFE, and random forest; <bold>(E)</bold> ROC analysis of the PART1 in GSE75010 to validate their diagnostic efficacy for EOPE.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1627057-g006.tif">
<alt-text content-type="machine-generated">Image showing multiple charts used in data analysis:  A) A line chart displaying binomial deviance against Log(&#x3bb;) with error bars, showing a curve with a minimum point.  B) A line graph showing tenfold cross-validation error against the number of features, highlighting a point at four features with an error of 0.0423.  C) Two dot plots, one for Mean Decrease Accuracy and one for Mean Decrease Gini, listing features with individual scores.  D) A Venn diagram illustrating the overlap of selected features among LASSO, SVM-RFE, and RF, highlighting one feature (PART1) common to all.  E) A ROC curve displaying sensitivity versus specificity for PART1, achieving an area under the curve of 0.889.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_6">
<label>3.6</label>
<title>Placental immune landscape of EOPE and correlation analysis between HILPDA and infiltrating immune cells</title>
<p>Utilizing the CIBERSORT deconvolution algorithm, we quantitatively assessed immune cell infiltration patterns in normal and EOPE placentas (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;4</bold>
</xref>). Comparative analysis revealed distinct immunological profiles between groups (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7A</bold>
</xref>). Specifically, EOPE placentas exhibited significantly elevated proportions of plasma cells and activated NK cells compared to normal counterparts. Conversely, normal placental tissues demonstrated higher infiltration levels of resting NK cells, monocyte, and resting mast cells (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7A</bold>
</xref>). Furthermore, Spearman&#x2019;s rank correlation analysis uncovered significant associations between HILPDA expression and specific immune subsets (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7B&#x2013;E</bold>
</xref>, <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;5</bold>
</xref>, <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S4</bold>
</xref>). Notably, HILPDA demonstrated a strong positive correlation with activated dendritic cells and neutrophils, while showing an inverse relationship with resting mast cells.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Comprehensive immune infiltration landscape in normal vs. EOPE placentas and HILPDA correlation with immune cell infiltration. <bold>(A)</bold> Violin diagram for immune cell distribution in normal vs. EOPE placentas; <bold>(B)</bold> Lollipop diagram for HILPDA expression correlation with immune cell infiltration. <bold>(C)</bold> Scatter plots for correlation between HILPDA expression and activated dendritic cells; <bold>(D)</bold> Scatter plots for correlation between HILPDA expression and neutrophils; <bold>(E)</bold> Scatter plots for correlation between HILPDA expression and mast cells resting. *<italic>P</italic> less than 0.05; **<italic>P</italic> less than 0.01; ***<italic>P</italic> less than 0.001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1627057-g007.tif">
<alt-text content-type="machine-generated">Panel A shows a box plot comparing immune cell proportions between groups labeled CON and EPE. Panel B displays a correlation dot plot of HILPDA expression with various immune cells, highlighting significant p-values. Panels C, D, and E feature scatter plots with regression lines, illustrating the correlation between HILPDA expression and activated dendritic cells, neutrophils, and resting mast cells, respectively, with Pearson correlation coefficients and p-values annotated.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_7">
<label>3.7</label>
<title>Validation of HILPDA expression in EOPE placentas and its role in regulating trophoblasts cell migration</title>
<p>To evaluate the differential expression of HILPDA in placental pathophysiology, western blot analysis of 6 biological replicates per group was performed in placental tissues from EOPE and normotensive pregnancy. As shown in <xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8A, B</bold>
</xref>, western blot analyses showed that the levels of HILPDA (band intensities normalized to &#x3b2;-actin) were markedly elevated in EOPE placentas compared to those from normal pregnancies. Furthermore, to investigate the effect of HILPDA on trophoblast cell migration, siRNAs were used to silence HILPDA expression in HTR-8/SVneo cells and the result showed a good silencing efficiency of HILPDA at both the mRNA and protein levels (<xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8C&#x2013;E</bold>
</xref>). Wound healing assays quantified at 24 hours post-scratch demonstrated significantly enhanced migration in HILPDA-knockdown cells versus scrambled siRNA controls (<xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8F, G</bold>
</xref>). These findings suggested that HILPDA critically suppresses trophoblast migration capacity, and its pathological overexpression in EOPE placentas may directly contribute to impaired spiral artery remodeling, a hallmark defect in EOPE pathogenesis.</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>HILPDA expression in normal vs. EOPE placentas and its role in HTR-8/SVneo cell migration. Western blot analysis <bold>(A)</bold> and quantification <bold>(B)</bold> for HILPDA expression in normal (n=6) and EOPE placentas (n=6). <bold>(C)</bold> RT-qPCR for HILPDA mRNA levels in cells transfected with siHILPDA and negative control (NC) siRNA; Western blot analysis <bold>(D)</bold> and quantification <bold>(E)</bold> for HILPDA mRNA levels in cells from siHILPDA and NC group. Wound healing assay <bold>(F)</bold> and quantification <bold>(G)</bold> for cell migration in cells from siHILPDA (n=3) and NC group (n=3, Scale bar: 400 &#x3bc;m); <sup>*</sup>
<italic>P</italic> less than 0.05; <sup>**</sup>
<italic>P</italic> less than 0.01; <sup>****</sup>
<italic>P</italic> less than 0.0001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1627057-g008.tif">
<alt-text content-type="machine-generated">A collage of scientific data includes several panels: A) Western blot showing HILPDA and &#x3b2;-actin levels for control (CON) and EOPE samples. B) Bar graph showing relative density with a significant difference between CON and EOPE. C) Bar graph indicating relative mRNA expression for NC and siHILPDA samples, with significant differences. D) Another Western blot for HILPDA and &#x3b2;-actin comparing NC and siHILPDA. E) Bar graph of relative density, showing a significant decrease for siHILPDA. F) Microscopy images of wound healing assay at 0 and 24 hours for NC and siHILPDA, indicating different recovery rates. G) Bar graph of area recovery percentage, showing a significant difference between NC and siHILPDA.</alt-text>
</graphic>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>PE is a serious complication that affects both the mother and the unborn baby, potentially leading to life-threatening issues if not managed properly. EOPE and LOPE are subtypes of PE distinguished by their onset during pregnancy. Although both subtypes cause similar vascular problems, their pathogenesis and severity differ significantly. EOPE typically results from poor placental development early in pregnancy, causing inadequate blood supply and systemic issues such as inflammation and high blood pressure. In contrast, LOPE usually stems from maternal factors in later pregnancy stages, such as an inability to meet increased metabolic demands, leading to milder symptoms due to better placental development (<xref ref-type="bibr" rid="B2">2</xref>, <xref ref-type="bibr" rid="B3">3</xref>). Our previous study indicated that EOPE and LOPE have distinct underlying molecular mechanisms, with ferroptosis playing a more prominent role in the pathogenesis of EOPE (<xref ref-type="bibr" rid="B26">26</xref>).</p>
<p>In this study, we systematically analyzed the expression of ferroptosis-related genes in the EOPE placentas from various GEO datasets and identified HILPDA as a crucial ferroptosis-related gene in EOPE through multi-dataset analysis. Specifically, differential expression analysis across placental samples (GSE148241 and GSE44711) revealed 2 ferroptosis-related DEGs (HILPDA and SCD), with HILPDA showing consistent upregulation in EOPE across validation datasets (GSE74341, GSE114691, and GSE10588). HILPDA demonstrated superior diagnostic performance (AUC=0.871). Functional analysis of HILPDA-associated genes identified enrichment in immune regulation (leukocyte migration, MHC complexes) and cellular processes (collagen matrix organization, HIF-1 signaling pathway). WGCNA identified 171 HILPDA-associated DEGs exhibiting strong correlation with EOPE pathogenesis. Machine learning integration (LASSO, SVM-RFE, Random Forest) identified one high-performance diagnostic biomarker PART1 (AUC=0.993) from the 171 HILPDA-associated DEGs. Immune profiling showed EOPE placentas had increased plasma cells/activated NK cells and revealed HILPDA&#x2019;s correlation with dendritic cell activation. Experimental validation confirmed HILPDA overexpression in EOPE placentas and demonstrated its regulating role in trophoblast migration through siRNA knockdown in HTR-8/SVneo cells. The findings position HILPDA as a key regulator of placental immune dysregulation and trophoblast migration in EOPE pathogenesis.</p>
<p>In a healthy pregnancy, the maternal immune system undergoes adaptations to tolerate the semi-allogeneic fetus (<xref ref-type="bibr" rid="B27">27</xref>). Leukocytes, including macrophages, T cells, and dendritic cells, are crucial for these immune adaptations. In PE, there are evidences of increased leukocyte activation and altered migration patterns. For example, pro-inflammatory cytokines were found to be present in higher concentrations in women with PE (<xref ref-type="bibr" rid="B28">28</xref>); Activation of neutrophils and monocytes occurs in preeclamptic pregnancies, but not in normal pregnancies (<xref ref-type="bibr" rid="B29">29</xref>).</p>
<p>HILPDA is a protein associated with lipid droplets and regulated by hypoxia. Recently, increasing studies suggested that it plays several roles in immune regulation beyond its established function in lipid metabolism. The altered lipid metabolism due to HILPDA deletion may change the distribution and activity of T cells and B cells in the liver, altering immune response patterns (<xref ref-type="bibr" rid="B30">30</xref>). The other study demonstrates that HILPDA upregulate IL-10 to activate the STAT3 signaling pathway in NK cells, which promotes hepatocellular carcinoma immune evasion and progression (<xref ref-type="bibr" rid="B31">31</xref>). In breast cancer metastasis models, HILPDA expression in pulmonary mesenchymal cells promote lipid accumulation and metabolically reprogram lung-resident NK cells leading to NK cell dysfunction (<xref ref-type="bibr" rid="B32">32</xref>). This evidence positions HILPDA as a molecular mediator bridging immune-stromal crosstalk, actively reprogramming the tumor microenvironment through lipid metabolic remodeling. To further investigate the role of HILPDA in EOPE, we performed a functional enrichment analysis on the genes correlated with HILPDA expression and associated with EOPE. The results showed that EOPE- and HILPDA-related genes are significantly involved in the regulation of immune including leukocyte migration, mononuclear cell migration and MHC complexes. Moreover, our immune functional enrichment analysis further suggests that HILPDA may mediate abnormal immune cell infiltration in the placenta. The observed increase in activated NK cells and plasma cells in EOPE placentas indicates that the upregulation of HILPDA may contribute to the formation of a localized inflammatory environment, thereby disrupting maternal-fetal immune tolerance and normal placental function. While our immune correlation analyses and other studies in cancer suggest HILPDA may modulate NK cell dynamics, the HILPDA&#x2019;s role in placental immunobiology requires direct experimental validation in pregnancy-specific contexts since the different immunosuppressive microenvironment may exist between placenta and tumors.</p>
<p>At the same time, the integration of multiple datasets and machine learning approaches allowed us to identify one HILPDA-associated DEG PART1 as a potential high-performance diagnostic biomarker. This not only further underscores the importance of HILPDA in the pathogenesis of EOPE but also provides new molecular evidence for early diagnosis. The high diagnostic accuracy of the biomarker (with AUCs of 0.889) indicates that they hold promise for clinical use in assessing EOPE risk, thereby facilitating more precise individualized management and early intervention.</p>
<p>It is well known that EOPE arises from &#x200b;defective placental development&#x200b; initiated by impaired extravillous trophoblast invasion into maternal decidua, resulting in &#x200b;incomplete spiral artery remodeling. This leads to placental hypoperfusion and ischemia-reperfusion injury triggering a cascade of pathological events such as hypoxic stress, oxidative damage&#x200b;, immune dysregulation and &#x200b;endothelial dysfunction&#x200b; via VEGF signaling disruption (<xref ref-type="bibr" rid="B33">33</xref>). Trophoblast migration and invasion are essential for complete spiral artery remodeling during placental development (<xref ref-type="bibr" rid="B34">34</xref>, <xref ref-type="bibr" rid="B35">35</xref>). Cell-cell adhesion plays a crucial role in cell migration, influencing various biological processes such as embryonic development, wound healing, and cancer metastasis (<xref ref-type="bibr" rid="B36">36</xref>, <xref ref-type="bibr" rid="B37">37</xref>). It ensures cells maintain proper coordination, directional movement, and effective signaling, all of which contribute to force generation and cell survival (<xref ref-type="bibr" rid="B38">38</xref>). In this study, our functional enrichment analysis revealed that genes associated with HILPDA are significantly enriched in pathways governing cell adhesion and extracellular matrix organization suggesting that HILPDA may play a pivotal role in modulating cell-cell adhesion dynamics. Moreover, we demonstrated HILPDA protein levels significantly increased in EOPE placentas and our cell scratch assays demonstrated that altering HILPDA expression significantly affects the migration capacity of trophoblast cells. Cells with reduced HILPDA levels exhibited increased migration ability in trophoblast cells, indicating that HILPDA may influence the reorganization of adhesion complexes or cytoskeletal structures necessary for efficient cell movement, processes critical for proper placentation and pregnancy outcomes. In the course of placentation, inadequate endovascular invasion by trophoblasts, a process dependent on migration, leaves spiral arteries constricted and hypoxic, prone to atherosis (<xref ref-type="bibr" rid="B35">35</xref>). HILPDA overexpression in EOPE placentas likely contributes to this pathology by hindering trophoblast motility, thereby perpetuating the ischemic placental microenvironment that characterizes early-onset disease.</p>
<p>Integrated evidence in this study suggests that HILPDA may coordinate hypoxia response, immune dysregulation, and impaired trophoblast function in EOPE pathogenesis. Mechanistically, placental hypoxia potentially activates HIF signaling (particularly HIF-2&#x3b1;), inducing HILPDA overexpression (<xref ref-type="bibr" rid="B11">11</xref>). Upregulated HILPDA could subsequently operate through dual pathways: (1) It remodels lipid metabolism to promote ferroptosis susceptibility (<xref ref-type="bibr" rid="B11">11</xref>), amplifying placental damage under iron-rich/hypoxic conditions; (2) It orchestrates immune dysregulation by modulating leukocyte migration pathways (GO analysis) and correlating with specific immune infiltrates (activated dendritic cells, neutrophils, and resting mast cells; <xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>). This may create a pro-inflammatory milieu that further disrupts maternal-fetal tolerance. Crucially, HILPDA simultaneously suppresses trophoblast migration (<xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8F, G</bold>
</xref>), which may contribute to the abnormal spiral artery remodeling. The resulting failure in placental perfusion perpetuates hypoxia, forming a self-amplifying pathological cycle where HILPDA may integrate hypoxic stress, immune dysfunction, and cellular defects to drive EOPE progression.</p>
<p>Although this study provided new insights into the complex pathological mechanisms of EOPE, there were several limitations in this study. First, the promising diagnostic biomarker (PART1) identified through machine learning algorithms was validated only in silico using existing GEO datasets. Their diagnostic utility and clinical applicability require rigorous prospective validation in larger, independent patient cohorts with standardized sample collection and processing. Furthermore, while WGCNA provided high-resolution network insights, it was employed as an exploratory, unsupervised method to identify potential gene modules associated with EOPE and its results require biological validation due to sensitivity to parameter choices. In addition, the experimental validation using human placental tissues (Western blot) and functional assays (siRNA migration) involved relatively small sample sizes. While powered for initial validation, larger cohorts would strengthen the statistical robustness and generalizability of these key findings. Finally, although HILPDA knockdown demonstrated an effect on trophoblast migration <italic>in vitro</italic>, the precise molecular mechanisms linking HILPDA overexpression to cell migration, specific immune cell alterations, and impaired spiral artery remodeling <italic>in vivo</italic> remain incompletely defined. Future research should focus on elucidating the specific interactions between HILPDA and immune cells and its mechanism involved in regulating trophoblast migration, with the aim of providing theoretical and practical guidance for the development of new therapeutic strategies.</p>
</sec>
</body>
<back>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Material</bold>
</xref>. Further inquiries can be directed to the corresponding authors.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The studies involving humans were approved by The First Affiliated Hospital of Bengbu Medical University, Bengbu, China. The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>QW: Funding acquisition, Methodology, Writing &#x2013; original draft. XW: Writing &#x2013; original draft, Software. JF: Writing &#x2013; original draft, Validation. CJ: Validation, Writing &#x2013; review &amp; editing. YT: Validation, Writing &#x2013; review &amp; editing. NY: Resources, Supervision, Writing &#x2013; review &amp; editing. HC: Resources, Writing &#x2013; review &amp; editing. CD: Writing &#x2013; review &amp; editing. BD: Writing &#x2013; review &amp; editing. DD: Conceptualization, Writing &#x2013; review &amp; editing. XL: Conceptualization, Formal Analysis, Funding acquisition, Investigation, Visualization, Writing &#x2013; review &amp; editing.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare financial support was received for the research and/or publication of this article. This study was funded by Health Research Program of Anhui (AHWJ2023A30116), the Key Project of the Natural Science Foundation of Bengbu Medical College (2023byzd081), the First Affiliated Hospital of Bengbu Medical College Science Fund for Outstanding Young Scholars (2019byyfyyq10) and Key Program of Natural Science Research of Higher Education of Anhui Province (2023AH051928).</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>The authors would like to acknowledge the Anhui Province Key Laboratory of Basic and Translational Research of Inflammation-related Diseases and the Central laboratory of the First Affiliated&#xa0;Hospital of Bengbu Medical University for their technical assistance.</p>
</ack>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="ai-statement">
<title>Generative AI statement</title>
<p>The author(s) declare that Generative AI was used in the creation of this manuscript. The ChatGPT was used to improve readability and language in the writing process. After using this tool, the authors reviewed and edited the content as needed and take full responsibility for the content of the publication.</p>
</sec>
<sec id="s11" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s12" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fimmu.2025.1627057/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fimmu.2025.1627057/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="SupplementaryFile1.docx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
<supplementary-material xlink:href="SupplementaryFile2.xlsx" id="SM2" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rana</surname> <given-names>S</given-names>
</name>
<name>
<surname>Lemoine</surname> <given-names>E</given-names>
</name>
<name>
<surname>Granger</surname> <given-names>JP</given-names>
</name>
<name>
<surname>Karumanchi</surname> <given-names>SA</given-names>
</name>
</person-group>. <article-title>Preeclampsia: pathophysiology, challenges, and perspectives</article-title>. <source>Circ Res</source>. (<year>2019</year>) <volume>124</volume>:<page-range>1094&#x2013;112</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1161/CIRCRESAHA.118.313276</pub-id>, PMID: <pub-id pub-id-type="pmid">30920918</pub-id></citation></ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jung</surname> <given-names>E</given-names>
</name>
<name>
<surname>Romero</surname> <given-names>R</given-names>
</name>
<name>
<surname>Yeo</surname> <given-names>L</given-names>
</name>
<name>
<surname>Gomez-Lopez</surname> <given-names>N</given-names>
</name>
<name>
<surname>Chaemsaithong</surname> <given-names>P</given-names>
</name>
<name>
<surname>Jaovisidha</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>The etiology of preeclampsia</article-title>. <source>Am J Obstet Gynecol</source>. (<year>2022</year>) <volume>226</volume>:<page-range>S844&#x2013;66</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ajog.2021.11.1356</pub-id>, PMID: <pub-id pub-id-type="pmid">35177222</pub-id></citation></ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dimitriadis</surname> <given-names>E</given-names>
</name>
<name>
<surname>Rolnik</surname> <given-names>DL</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>W</given-names>
</name>
<name>
<surname>Estrada-Gutierrez</surname> <given-names>G</given-names>
</name>
<name>
<surname>Koga</surname> <given-names>K</given-names>
</name>
<name>
<surname>Francisco</surname> <given-names>RPV</given-names>
</name>
<etal/>
</person-group>. <article-title>Pre-eclampsia</article-title>. <source>Nat Rev Dis Primers</source>. (<year>2023</year>) <volume>9</volume>:<elocation-id>8</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41572-023-00417-6</pub-id>, PMID: <pub-id pub-id-type="pmid">36797292</pub-id></citation></ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jiang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Stockwell</surname> <given-names>BR</given-names>
</name>
<name>
<surname>Conrad</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Ferroptosis: mechanisms, biology and role in disease</article-title>. <source>Nat Rev Mol Cell Biol</source>. (<year>2021</year>) <volume>22</volume>:<page-range>266&#x2013;82</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41580-020-00324-8</pub-id>, PMID: <pub-id pub-id-type="pmid">33495651</pub-id></citation></ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Gan</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>M</given-names>
</name>
<name>
<surname>Du</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>H</given-names>
</name>
</person-group>. <article-title>Ferroptosis and its emerging role in pre-eclampsia</article-title>. <source>Antioxidants (Basel)</source>. (<year>2022</year>) <volume>11</volume>(<issue>7</issue>):<fpage>1282</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/antiox11071282</pub-id>, PMID: <pub-id pub-id-type="pmid">35883776</pub-id></citation></ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Park</surname> <given-names>C</given-names>
</name>
<name>
<surname>Alahari</surname> <given-names>S</given-names>
</name>
<name>
<surname>Ausman</surname> <given-names>J</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>R</given-names>
</name>
<name>
<surname>Nguyen</surname> <given-names>F</given-names>
</name>
<name>
<surname>Sallais</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Placental hypoxia-induced ferroptosis drives vascular damage in preeclampsia</article-title>. <source>Circ Res</source>. (<year>2025</year>) <volume>136</volume>:<page-range>361&#x2013;78</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1161/CIRCRESAHA.124.325119</pub-id>, PMID: <pub-id pub-id-type="pmid">39846172</pub-id></citation></ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Ding</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>L</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>M</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>P</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>Z</given-names>
</name>
<etal/>
</person-group>. <article-title>Ferritin light chain deficiency-induced ferroptosis is involved in preeclampsia pathophysiology by disturbing uterine spiral artery remodelling</article-title>. <source>Redox Biol</source>. (<year>2022</year>) <volume>58</volume>:<elocation-id>102555</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.redox.2022.102555</pub-id>, PMID: <pub-id pub-id-type="pmid">36446230</pub-id></citation></ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Deng</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Lai</surname> <given-names>W</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>L</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>W</given-names>
</name>
<name>
<surname>Ding</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>miR-2115-3p inhibits ferroptosis by downregulating the expression of glutamic-oxaloacetic transaminase in preeclampsia</article-title>. <source>Placenta</source>. (<year>2022</year>) <volume>129</volume>:<fpage>94</fpage>&#x2013;<lpage>103</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.placenta.2022.09.014</pub-id>, PMID: <pub-id pub-id-type="pmid">36279730</pub-id></citation></ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>R</given-names>
</name>
<name>
<surname>Ying</surname> <given-names>X</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>P</given-names>
</name>
</person-group>. <article-title>The role of ferritin and iron dextran in exacerbating preeclampsia in an L-NAME-treated rat model</article-title>. <source>Ann Transl Med</source>. (<year>2022</year>) <volume>10</volume>:<fpage>889</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.21037/atm-22-3675</pub-id>, PMID: <pub-id pub-id-type="pmid">36111025</pub-id></citation></ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>de la Rosa Rodriguez</surname> <given-names>MA</given-names>
</name>
<name>
<surname>Kersten</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Regulation of lipid droplet homeostasis by hypoxia inducible lipid droplet associated HILPDA</article-title>. <source>Biochim Biophys Acta Mol Cell Biol Lipids</source>. (<year>2020</year>) <volume>1865</volume>:<elocation-id>158738</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bbalip.2020.158738</pub-id>, PMID: <pub-id pub-id-type="pmid">32417386</pub-id></citation></ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zou</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Palte</surname> <given-names>MJ</given-names>
</name>
<name>
<surname>Deik</surname> <given-names>AA</given-names>
</name>
<name>
<surname>Li</surname> <given-names>H</given-names>
</name>
<name>
<surname>Eaton</surname> <given-names>JK</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>W</given-names>
</name>
<etal/>
</person-group>. <article-title>A GPX4-dependent cancer cell state underlies the clear-cell morphology and confers sensitivity to ferroptosis</article-title>. <source>Nat Commun</source>. (<year>2019</year>) <volume>10</volume>:<fpage>1617</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-019-09277-9</pub-id>, PMID: <pub-id pub-id-type="pmid">30962421</pub-id></citation></ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Liang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>S</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>Landscape of dysregulated placental RNA editing associated with preeclampsia</article-title>. <source>Hypertension</source>. (<year>2020</year>) <volume>75</volume>:<page-range>1532&#x2013;41</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1161/HYPERTENSIONAHA.120.14756</pub-id>, PMID: <pub-id pub-id-type="pmid">32306769</pub-id></citation></ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Blair</surname> <given-names>JD</given-names>
</name>
<name>
<surname>Yuen</surname> <given-names>RK</given-names>
</name>
<name>
<surname>Lim</surname> <given-names>BK</given-names>
</name>
<name>
<surname>McFadden</surname> <given-names>DE</given-names>
</name>
<name>
<surname>von Dadelszen</surname> <given-names>P</given-names>
</name>
<name>
<surname>Robinson</surname> <given-names>WP</given-names>
</name>
</person-group>. <article-title>Widespread DNA hypomethylation at gene enhancer regions in placentas associated with early-onset pre-eclampsia</article-title>. <source>Mol Hum Reprod</source>. (<year>2013</year>) <volume>19</volume>:<fpage>697</fpage>&#x2013;<lpage>708</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/molehr/gat044</pub-id>, PMID: <pub-id pub-id-type="pmid">23770704</pub-id></citation></ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liang</surname> <given-names>M</given-names>
</name>
<name>
<surname>Niu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Deng</surname> <given-names>H</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>W</given-names>
</name>
<etal/>
</person-group>. <article-title>Gene expression profiling reveals different molecular patterns in G-protein coupled receptor signaling pathways between early- and late-onset preeclampsia</article-title>. <source>Placenta</source>. (<year>2016</year>) <volume>40</volume>:<page-range>52&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.placenta.2016.02.015</pub-id>, PMID: <pub-id pub-id-type="pmid">27016783</pub-id></citation></ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Awamleh</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Gloor</surname> <given-names>GB</given-names>
</name>
<name>
<surname>Han</surname> <given-names>VKM</given-names>
</name>
</person-group>. <article-title>Placental microRNAs in pregnancies with early onset intrauterine growth restriction and preeclampsia: potential impact on gene expression and pathophysiology</article-title>. <source>BMC Med Genomics</source>. (<year>2019</year>) <volume>12</volume>:<fpage>91</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12920-019-0548-x</pub-id>, PMID: <pub-id pub-id-type="pmid">31248403</pub-id></citation></ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sitras</surname> <given-names>V</given-names>
</name>
<name>
<surname>Paulssen</surname> <given-names>RH</given-names>
</name>
<name>
<surname>Gronaas</surname> <given-names>H</given-names>
</name>
<name>
<surname>Leirvik</surname> <given-names>J</given-names>
</name>
<name>
<surname>Hanssen</surname> <given-names>TA</given-names>
</name>
<name>
<surname>Vartun</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>Differential placental gene expression in severe preeclampsia</article-title>. <source>Placenta</source>. (<year>2009</year>) <volume>30</volume>:<page-range>424&#x2013;33</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.placenta.2009.01.012</pub-id>, PMID: <pub-id pub-id-type="pmid">19249095</pub-id></citation></ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Leavey</surname> <given-names>K</given-names>
</name>
<name>
<surname>Benton</surname> <given-names>SJ</given-names>
</name>
<name>
<surname>Grynspan</surname> <given-names>D</given-names>
</name>
<name>
<surname>Kingdom</surname> <given-names>JC</given-names>
</name>
<name>
<surname>Bainbridge</surname> <given-names>SA</given-names>
</name>
<name>
<surname>Cox</surname> <given-names>BJ</given-names>
</name>
</person-group>. <article-title>Unsupervised placental gene expression profiling identifies clinically relevant subclasses of human preeclampsia</article-title>. <source>Hypertension</source>. (<year>2016</year>) <volume>68</volume>:<page-range>137&#x2013;47</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1161/HYPERTENSIONAHA.116.07293</pub-id>, PMID: <pub-id pub-id-type="pmid">27160201</pub-id></citation></ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Barrett</surname> <given-names>T</given-names>
</name>
<name>
<surname>Wilhite</surname> <given-names>SE</given-names>
</name>
<name>
<surname>Ledoux</surname> <given-names>P</given-names>
</name>
<name>
<surname>Evangelista</surname> <given-names>C</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>IF</given-names>
</name>
<name>
<surname>Tomashevsky</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>NCBI GEO: archive for functional genomics data sets&#x2013;update</article-title>. <source>Nucleic Acids Res</source>. (<year>2013</year>) <volume>41</volume>:<page-range>D991&#x2013;5</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gks1193</pub-id>, PMID: <pub-id pub-id-type="pmid">23193258</pub-id></citation></ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname> <given-names>N</given-names>
</name>
<name>
<surname>Bao</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>FerrDb: a manually curated resource for regulators and markers of ferroptosis and ferroptosis-disease associations</article-title>. <source>Database (Oxford)</source>. (<year>2020</year>) <volume>2020)</volume>:<fpage>baaa021</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/database/baaa021</pub-id>, PMID: <pub-id pub-id-type="pmid">32219413</pub-id></citation></ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ashburner</surname> <given-names>M</given-names>
</name>
<name>
<surname>Ball</surname> <given-names>CA</given-names>
</name>
<name>
<surname>Blake</surname> <given-names>JA</given-names>
</name>
<name>
<surname>Botstein</surname> <given-names>D</given-names>
</name>
<name>
<surname>Butler</surname> <given-names>H</given-names>
</name>
<name>
<surname>Cherry</surname> <given-names>JM</given-names>
</name>
<etal/>
</person-group>. <article-title>Gene ontology: tool for the unification of biology. The Gene Ontology Consortium</article-title>. <source>Nat Genet</source>. (<year>2000</year>) <volume>25</volume>:<page-range>25&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/75556</pub-id>, PMID: <pub-id pub-id-type="pmid">10802651</pub-id></citation></ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kanehisa</surname> <given-names>M</given-names>
</name>
<name>
<surname>Goto</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>KEGG: kyoto encyclopedia of genes and genomes</article-title>. <source>Nucleic Acids Res</source>. (<year>2000</year>) <volume>28</volume>:<fpage>27</fpage>&#x2013;<lpage>30</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/28.1.27</pub-id>, PMID: <pub-id pub-id-type="pmid">10592173</pub-id></citation></ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>B</given-names>
</name>
<name>
<surname>Khodadoust</surname> <given-names>MS</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>CL</given-names>
</name>
<name>
<surname>Newman</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Alizadeh</surname> <given-names>AA</given-names>
</name>
</person-group>. <article-title>Profiling tumor infiltrating immune cells with CIBERSORT</article-title>. <source>Methods Mol Biol</source>. (<year>2018</year>) <volume>1711</volume>:<page-range>243&#x2013;59</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/978-1-4939-7493-1_12</pub-id>, PMID: <pub-id pub-id-type="pmid">29344893</pub-id></citation></ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Langfelder</surname> <given-names>P</given-names>
</name>
<name>
<surname>Horvath</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>WGCNA: an R package for weighted correlation network analysis</article-title>. <source>BMC Bioinf</source>. (<year>2008</year>) <volume>9</volume>:<elocation-id>559</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1471-2105-9-559</pub-id>, PMID: <pub-id pub-id-type="pmid">19114008</pub-id></citation></ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ghafouri-Fard</surname> <given-names>S</given-names>
</name>
<name>
<surname>Harsij</surname> <given-names>A</given-names>
</name>
<name>
<surname>Hussen</surname> <given-names>BM</given-names>
</name>
<name>
<surname>Abdullah</surname> <given-names>SR</given-names>
</name>
<name>
<surname>Baniahmad</surname> <given-names>A</given-names>
</name>
<name>
<surname>Taheri</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>A review on the role of long non-coding RNA prostate androgen-regulated transcript 1 (PART1) in the etiology of different disorders</article-title>. <source>Front Cell Dev Biol</source>. (<year>2023</year>) <volume>11</volume>:<elocation-id>1124615</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fcell.2023.1124615</pub-id>, PMID: <pub-id pub-id-type="pmid">36875771</pub-id></citation></ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>R</given-names>
</name>
</person-group>. <article-title>lncRNA PART1 Promotes Breast Cancer Cell Progression by Directly Targeting miR-4516</article-title>. <source>Cancer Manag Res</source>. (<year>2020</year>) <volume>12</volume>:<page-range>7753&#x2013;60</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.2147/CMAR.S249296</pub-id>, PMID: <pub-id pub-id-type="pmid">32922076</pub-id></citation></ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>N</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Ding</surname> <given-names>B</given-names>
</name>
<name>
<surname>Gong</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Expression profiles and functions of ferroptosis-related genes in the placental tissue samples of early- and late-onset preeclampsia patients</article-title>. <source>BMC Pregnancy Childbirth</source>. (<year>2022</year>) <volume>22</volume>:<fpage>87</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12884-022-04423-6</pub-id>, PMID: <pub-id pub-id-type="pmid">35100981</pub-id></citation></ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Abu-Raya</surname> <given-names>B</given-names>
</name>
<name>
<surname>Michalski</surname> <given-names>C</given-names>
</name>
<name>
<surname>Sadarangani</surname> <given-names>M</given-names>
</name>
<name>
<surname>Lavoie</surname> <given-names>PM</given-names>
</name>
</person-group>. <article-title>Maternal immunological adaptation during normal pregnancy</article-title>. <source>Front Immunol</source>. (<year>2020</year>) <volume>11</volume>:<elocation-id>575197</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2020.575197</pub-id>, PMID: <pub-id pub-id-type="pmid">33133091</pub-id></citation></ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Teran</surname> <given-names>E</given-names>
</name>
<name>
<surname>Escudero</surname> <given-names>C</given-names>
</name>
<name>
<surname>Moya</surname> <given-names>W</given-names>
</name>
<name>
<surname>Flores</surname> <given-names>M</given-names>
</name>
<name>
<surname>Vallance</surname> <given-names>P</given-names>
</name>
<name>
<surname>Lopez-Jaramillo</surname> <given-names>P</given-names>
</name>
</person-group>. <article-title>Elevated C-reactive protein and pro-inflammatory cytokines in Andean women with pre-eclampsia</article-title>. <source>Int J Gynaecol Obstet</source>. (<year>2001</year>) <volume>75</volume>:<page-range>243&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/s0020-7292(01)00499-4</pub-id>, PMID: <pub-id pub-id-type="pmid">11728484</pub-id></citation></ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mellembakken</surname> <given-names>JR</given-names>
</name>
<name>
<surname>Aukrust</surname> <given-names>P</given-names>
</name>
<name>
<surname>Olafsen</surname> <given-names>MK</given-names>
</name>
<name>
<surname>Ueland</surname> <given-names>T</given-names>
</name>
<name>
<surname>Hestdal</surname> <given-names>K</given-names>
</name>
<name>
<surname>Videm</surname> <given-names>V</given-names>
</name>
</person-group>. <article-title>Activation of leukocytes during the uteroplacental passage in preeclampsia</article-title>. <source>Hypertension</source>. (<year>2002</year>) <volume>39</volume>:<page-range>155&#x2013;60</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1161/hy0102.100778</pub-id>, PMID: <pub-id pub-id-type="pmid">11799095</pub-id></citation></ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Povero</surname> <given-names>D</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Johnson</surname> <given-names>SM</given-names>
</name>
<name>
<surname>McMahon</surname> <given-names>CE</given-names>
</name>
<name>
<surname>Pan</surname> <given-names>M</given-names>
</name>
<name>
<surname>Bao</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>HILPDA promotes NASH-driven HCC development by restraining intracellular fatty acid flux in hypoxia</article-title>. <source>J Hepatol</source>. (<year>2023</year>) <volume>79</volume>:<page-range>378&#x2013;93</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jhep.2023.03.041</pub-id>, PMID: <pub-id pub-id-type="pmid">37061197</pub-id></citation></ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cui</surname> <given-names>C</given-names>
</name>
<name>
<surname>Fu</surname> <given-names>K</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Cen</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Meng</surname> <given-names>X</given-names>
</name>
<etal/>
</person-group>. <article-title>Hypoxia-inducible gene 2 promotes the immune escape of hepatocellular carcinoma from nature killer cells through the interleukin-10-STAT3 signaling pathway</article-title>. <source>J Exp Clin Cancer Res</source>. (<year>2019</year>) <volume>38</volume>:<fpage>229</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s13046-019-1233-9</pub-id>, PMID: <pub-id pub-id-type="pmid">31142329</pub-id></citation></ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gong</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>J</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>ET</given-names>
</name>
<name>
<surname>Shultz</surname> <given-names>LD</given-names>
</name>
<name>
<surname>Ren</surname> <given-names>G</given-names>
</name>
</person-group>. <article-title>Lipid-laden lung mesenchymal cells foster breast cancer metastasis via metabolic reprogramming of tumor cells and natural killer cells</article-title>. <source>Cell Metab</source>. (<year>2022</year>) <volume>34</volume>:<fpage>1960</fpage>&#x2013;<lpage>76.e9</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cmet.2022.11.003</pub-id>, PMID: <pub-id pub-id-type="pmid">36476935</pub-id></citation></ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Burton</surname> <given-names>GJ</given-names>
</name>
<name>
<surname>Redman</surname> <given-names>CW</given-names>
</name>
<name>
<surname>Roberts</surname> <given-names>JM</given-names>
</name>
<name>
<surname>Moffett</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>Pre-eclampsia: pathophysiology and clinical implications</article-title>. <source>BMJ</source>. (<year>2019</year>) <volume>366</volume>:<elocation-id>l2381</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1136/bmj.l2381</pub-id>, PMID: <pub-id pub-id-type="pmid">31307997</pub-id></citation></ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Staff</surname> <given-names>AC</given-names>
</name>
<name>
<surname>Fjeldstad</surname> <given-names>HE</given-names>
</name>
<name>
<surname>Fosheim</surname> <given-names>IK</given-names>
</name>
<name>
<surname>Moe</surname> <given-names>K</given-names>
</name>
<name>
<surname>Turowski</surname> <given-names>G</given-names>
</name>
<name>
<surname>Johnsen</surname> <given-names>GM</given-names>
</name>
<etal/>
</person-group>. <article-title>Failure of physiological transformation and spiral artery atherosis: their roles in preeclampsia</article-title>. <source>Am J Obstet Gynecol</source>. (<year>2022</year>) <volume>226</volume>:<page-range>S895&#x2013;906</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ajog.2020.09.026</pub-id>, PMID: <pub-id pub-id-type="pmid">32971013</pub-id></citation></ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname> <given-names>L</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>M</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Han</surname> <given-names>X</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>J</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>Z</given-names>
</name>
<etal/>
</person-group>. <article-title>Overexpressed trophoblast glycoprotein contributes to preeclampsia development by inducing abnormal trophoblast migration and invasion toward the uterine spiral artery</article-title>. <source>Hypertension</source>. (<year>2024</year>) <volume>81</volume>:<page-range>1524&#x2013;36</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1161/HYPERTENSIONAHA.124.22923</pub-id>, PMID: <pub-id pub-id-type="pmid">38716674</pub-id></citation></ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hirohashi</surname> <given-names>S</given-names>
</name>
<name>
<surname>Kanai</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Cell adhesion system and human cancer morphogenesis</article-title>. <source>Cancer Sci</source>. (<year>2003</year>) <volume>94</volume>:<page-range>575&#x2013;81</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1349-7006.2003.tb01485.x</pub-id>, PMID: <pub-id pub-id-type="pmid">12841864</pub-id></citation></ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kawauchi</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>Cell adhesion and its endocytic regulation in cell migration during neural development and cancer metastasis</article-title>. <source>Int J Mol Sci</source>. (<year>2012</year>) <volume>13</volume>:<page-range>4564&#x2013;90</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms13044564</pub-id>, PMID: <pub-id pub-id-type="pmid">22605996</pub-id></citation></ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Collins</surname> <given-names>C</given-names>
</name>
<name>
<surname>Nelson</surname> <given-names>WJ</given-names>
</name>
</person-group>. <article-title>Running with neighbors: coordinating cell migration and cell-cell adhesion</article-title>. <source>Curr Opin Cell Biol</source>. (<year>2015</year>) <volume>36</volume>:<fpage>62</fpage>&#x2013;<lpage>70</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ceb.2015.07.004</pub-id>, PMID: <pub-id pub-id-type="pmid">26201843</pub-id></citation></ref>
</ref-list>
</back>
</article>