<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2025.1624691</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Immunology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Single-cell and machine learning integration reveals ferroptosis-driven immune landscapes for melanoma stratification</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Lei</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1911031/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Jin</surname>
<given-names>Xueying</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2564242/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wu</surname>
<given-names>Yuchen</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Qiu</surname>
<given-names>Runing</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Wang</surname>
<given-names>Jianfang</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3048157/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Department of Oncology, Shaoxing People&#x2019;s Hospital, The First Affiliated Hospital of Shaoxing University</institution>, <addr-line>Shaoxing, Zhejiang</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Laboratory of Cancer Biology, Key Lab of Biotherapy in Zhejiang Province, Cancer Center of Zhejiang University, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University</institution>, <addr-line>Hangzhou, Zhejiang</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Xiaosheng Tan, Rutgers, The State University of New Jersey, United States</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Zunsong Hu, University of Tennessee Health Science Center (UTHSC), United States</p>
<p>Hui Wang, University of Pennsylvania, United States</p>
<p>Fumei Gao, Peking University People&#x2019;s Hospital, China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Jianfang Wang, <email xlink:href="mailto:sxwxdd@163.com">sxwxdd@163.com</email>
</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>01</day>
<month>08</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2025</year>
</pub-date>
<volume>16</volume>
<elocation-id>1624691</elocation-id>
<history>
<date date-type="received">
<day>07</day>
<month>05</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>27</day>
<month>06</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Wang, Jin, Wu, Qiu and Wang.</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Wang, Jin, Wu, Qiu and Wang</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>Ferroptosis, a regulated form of cell death, has emerged as a critical modulator of melanoma's tumor progression and immune evasion. However, its integration with the tumor immune microenvironment (TME) and clinical prognostication remains underexplored. This study aims to construct a multi-omics framework combining ferroptosis-related signatures, immune infiltration patterns, and machine-learning approaches to stratify melanoma patients and guide therapeutic decision-making.</p>
</sec>
<sec>
<title>Methods</title>
<p>We developed a multi-omics framework integrating bulk transcriptomics (TCGA/GEO), single-cell RNA sequencing, and machine learning to decode melanoma's ferroptosis-immune axis. Ferroptosis-immune subtypes were identified through consensus clustering and immune profiling, while prognostic models were constructed via LASSO/stepwise Cox regression and machine learning optimization.</p>
</sec>
<sec>
<title>Results</title>
<p>Three ferroptosis-immune subtypes exhibiting distinct survival outcomes and immune phenotypes were identified. A 40-gene prognostic signature (externally validated) effectively stratified patient survival risk and predicted chemotherapy sensitivity. Single-cell analysis revealed elevated ferroptosis activity within an immunosuppressive microenvironment, specifically implicating POSTN&#x2013;ITGB5 signaling in fibroblast-immune cell crosstalk. A clinically applicable nomogram integrating risk scores and clinical factors demonstrated robust predictive accuracy (AUC 0.829&#x2013;0.845). Machine learning refined a 4-gene prognostic signature (CLN6, GMPR, AP1S2, ITGA6), with functional validation confirming the role of CLN6 in proliferation and migration.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>This study establishes a prognostic framework and therapeutic roadmap for precision immuno-oncology in melanoma, bridging multi-omics discovery with clinical translation.</p>
</sec>
</abstract>
<kwd-group>
<kwd>ferroptosis</kwd>
<kwd>melanoma</kwd>
<kwd>immune microenvironment</kwd>
<kwd>single-cell RNA sequencing</kwd>
<kwd>machine learning</kwd>
</kwd-group>
<counts>
<fig-count count="13"/>
<table-count count="0"/>
<equation-count count="0"/>
<ref-count count="43"/>
<page-count count="20"/>
<word-count count="7560"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Cancer Immunity and Immunotherapy</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>Melanoma is the most aggressive form of skin cancer, characterized by high metastatic potential, pronounced heterogeneity, and resistance to conventional therapies. Its global incidence continues to rise, with the prevalence of cutaneous malignant melanoma (CMM) reaching 833,215 cases in 2021&#x2014;a 161.3% increase since 1990 (<xref ref-type="bibr" rid="B1">1</xref>). Although immunotherapies and targeted agents have improved survival outcomes, substantial interpatient variability in treatment response underscores the urgent need for molecular stratification frameworks to guide precision oncology (<xref ref-type="bibr" rid="B2">2</xref>, <xref ref-type="bibr" rid="B3">3</xref>).</p>
<p>Ferroptosis, an iron-dependent form of regulated cell death driven by lipid peroxidation, plays dual roles in melanoma progression and therapy resistance (<xref ref-type="bibr" rid="B4">4</xref>, <xref ref-type="bibr" rid="B5">5</xref>). Central to this process is the balance between lipid peroxide generation (via PUFA-PL synthesis/extracellular uptake and ACC-mediated biosynthesis) and detoxification by systems like GPX4, which neutralizes phospholipid hydroperoxides (<xref ref-type="bibr" rid="B6">6</xref>&#x2013;<xref ref-type="bibr" rid="B13">13</xref>). While ferroptosis susceptibility in dedifferentiated melanoma cells offers therapeutic potential, its context-dependent effects complicate treatment: GPX4/FSP1 preservation in CD8<sup>+</sup> T cells maintains anti-tumor immunity, whereas ACSL4 deficiency impairs T cell function despite conferring ferroptosis resistance (<xref ref-type="bibr" rid="B14">14</xref>&#x2013;<xref ref-type="bibr" rid="B16">16</xref>). Tumor-associated Tregs further evade ferroptosis through reduced lipid peroxidation, sustaining immunosuppression, and MITF downregulation promotes MDSC recruitment, linking melanocyte plasticity to immune evasion (<xref ref-type="bibr" rid="B17">17</xref>, <xref ref-type="bibr" rid="B18">18</xref>). These findings highlight the need for strategies that selectively induce ferroptosis in malignant cells while protecting immune effectors to optimize therapeutic outcomes.</p>
<p>Despite advances in characterizing ferroptosis regulators, critical gaps persist in translating these insights into clinical tools. First, the heterogeneity of ferroptosis-related gene expression across melanoma subtypes remains poorly defined, limiting the development of molecularly guided therapies. Second, existing prognostic models often neglect the integration of ferroptosis-immune crosstalk with clinical variables, resulting in suboptimal predictive accuracy. Third, single-cell resolution of ferroptosis activity and its spatial coordination within the tumor immune microenvironment (TME) is lacking, obscuring cell-type-specific vulnerabilities. Additionally, current molecular classifications of melanoma, often based on mutational status (e.g., BRAF, NRAS) or transcriptomic subtypes, insufficiently capture the dynamic crosstalk between regulated cell death pathways and the TME (<xref ref-type="bibr" rid="B19">19</xref>, <xref ref-type="bibr" rid="B20">20</xref>). Although single-cell RNA sequencing (scRNA-seq) has advanced our understanding of TME heterogeneity and stromal reprogramming, the spatial and cellular regulation of ferroptosis and its role in intercellular communication remain poorly defined.</p>
<p>This study presents a comprehensive multi-omics characterization of the ferroptosis-immune axis in melanoma. We integrate bulk RNA-seq, single-cell transcriptomics, and machine learning across TCGA and GEO datasets to define ferroptosis-driven molecular subtypes with distinct prognoses and immune landscapes. A core gene set was identified through WGCNA and cross-subtype differential analysis, and a machine learning&#x2014;based prognostic model was optimized through benchmarking over 100 algorithms. The model was externally validated and linked to immune checkpoint expression, chemotherapy response, and stromal interactions. Through scRNA-seq and CellChat-based ligand-receptor analysis, we further delineate cell type-specific ferroptosis activity and immunoregulatory signaling. Functional validation confirmed the role of CLN6 in proliferation and migration. This integrative approach reveals ferroptosis as a central orchestrator of melanoma heterogeneity, immune escape, and therapeutic vulnerability, offering new avenues for precision stratification and combinatorial targeting strategies.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and methods</title>
<sec id="s2_1">
<title>Data acquisition</title>
<p>GEO datasets: Gene expression data were obtained from the Gene Expression Omnibus (GEO) database (<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/geo/info/datasets.html">https://www.ncbi.nlm.nih.gov/geo/info/datasets.html</ext-link>). ScRNA-seq data from three melanoma samples were retrieved from GSE215120 for single-cell transcriptome analysis. Bulk RNA-seq data from 69 melanoma samples in GSE53118 and 71 samples in GSE54467 were used for transcriptomic profiling.</p>
<p>TCGA dataset: Processed transcriptomic profiles of 472 melanoma tumor samples were downloaded from The Cancer Genome Atlas (TCGA) via the Genomic Data Commons portal (<ext-link ext-link-type="uri" xlink:href="https://portal.gdc.cancer.gov/">https://portal.gdc.cancer.gov/</ext-link>). Data types included mRNA expression matrices for downstream analyses.</p>
</sec>
<sec id="s2_2">
<title>Consensus clustering for molecular subtyping</title>
<p>Consensus clustering was conducted to classify melanoma samples based on candidate gene expression levels. Using 50 iterations and subsampling 90% of samples per iteration, we identified the optimal number of clusters via cumulative distribution function (CDF) curves and consensus matrix heatmaps.</p>
</sec>
<sec id="s2_3">
<title>Differential expression analysis</title>
<p>Differential gene expression between melanoma and control samples was assessed using the limma package in R. Genes with adjusted <italic>p-values &lt; 0.05</italic> and |log2 fold change| &gt; 0.585 were considered significantly differentially expressed. Volcano plots were generated for visualization.</p>
</sec>
<sec id="s2_4">
<title>Functional enrichment analysis of molecular subtypes</title>
<p>Functional pathway enrichment across identified subtypes was evaluated using single-sample gene set enrichment analysis (ssGSEA) implemented via the <italic>GSVA</italic> R package. GO and KEGG gene sets were sourced from MSigDB (v7.5.1): c2.cp.kegg.v7.5.1.symbols and c5.go.v7.5.1.symbols.</p>
</sec>
<sec id="s2_5">
<title>Immune infiltration analysis</title>
<p>Immune cell composition was inferred using the CIBERSORT algorithm (<xref ref-type="bibr" rid="B21">21</xref>), a support vector regression-based method for deconvolution of bulk expression profiles. Using 547 signature genes, CIBERSORT quantified 22 immune cell types, including T cells, B cells, plasma cells, and myeloid subtypes. Pearson correlation analysis assessed associations between gene expression and immune cell proportions.</p>
</sec>
<sec id="s2_6">
<title>Weighted gene co-expression network analysis</title>
<p>Gene co-expression networks were constructed using the WGCNA R package (<xref ref-type="bibr" rid="B22">22</xref>). We selected the top 10,000 most variable genes by variance for analysis. A soft-thresholding power of 8 was applied to approximate scale-free topology. The adjacency matrix was transformed into a topological overlap matrix (TOM), followed by hierarchical clustering to identify gene modules. Module eigengenes were correlated with risk scores to determine biologically relevant modules.</p>
</sec>
<sec id="s2_7">
<title>Machine learning&#x2013;based prognostic model construction</title>
<p>A multi-algorithm screening process was used to construct and validate prognostic models based on candidate genes. Model development employed the Mime1 R package and the ML.Dev.Prog.Sig function, incorporating over 100 machine learning algorithms. Model performance was evaluated via concordance index (C-index) distribution and Kaplan&#x2013;Meier survival analyses. External validation was performed on independent datasets.</p>
</sec>
<sec id="s2_8">
<title>Drug sensitivity analysis</title>
<p>Chemotherapy response was forecast using the oncoPredict R package and training datasets sourced from the Genomics of Drug Sensitivity in Cancer (GDSC) database (<ext-link ext-link-type="uri" xlink:href="https://www.cancerrxgene.org/">https://www.cancerrxgene.org/</ext-link>). Half-maximal inhibitory concentrations (IC50s) were determined using a regression model that incorporated 10-fold cross-validation. Batch effects were corrected using the &#x201c;combat&#x201d; method, and low-variance and duplicated genes were filtered before modeling.</p>
</sec>
<sec id="s2_9">
<title>Gene set enrichment analysis</title>
<p>GSEA was performed to identify differentially enriched pathways between high- and low-risk groups. Gene sets from MSigDB v7.0 were used as the background. Pathways with an adjusted <italic>p-value &lt; 0.05</italic> were deemed significantly enriched and ranked by normalized enrichment scores (NES).</p>
</sec>
<sec id="s2_10">
<title>Gene set variation analysis</title>
<p>GSVA, an unsupervised, non-parametric enrichment method, was used to assess variation in pathway activity across samples. Gene sets from MSigDB were used as references. GSVA scores were calculated for each sample and pathway to evaluate functional state changes.</p>
</sec>
<sec id="s2_11">
<title>Nomogram construction</title>
<p>A final cohort of 337 melanoma samples from TCGA with complete clinical annotations was analyzed. A multivariable Cox regression model was used to construct a nomogram integrating clinical features and gene expression. Each variable was assigned a weighted score based on its regression coefficient, and the total score was mapped to predicted survival probabilities.</p>
</sec>
<sec id="s2_12">
<title>Single-cell quality control</title>
<p>Quality control for scRNA-seq data was performed using the <italic>Seurat</italic> R package. Filtering criteria included thresholds for total UMI counts, gene counts per cell, and mitochondrial/ribosomal gene content. Cells exceeding three median absolute deviations (MADs) from the median were excluded. DoubletFinder (v2.0.4) was used to remove doublets.</p>
</sec>
<sec id="s2_13">
<title>Single-cell data normalization and processing</title>
<p>Data normalization was performed using <italic>NormalizeData</italic> and identifying highly variable genes via <italic>FindVariableFeatures</italic>. The data were scaled with <italic>ScaleData</italic> to regress out mitochondrial/ribosomal gene effects and cell cycle variation. Dimensionality reduction was performed using PCA (<italic>RunPCA</italic>) and batch correction using <italic>Harmony</italic>. Clustering was conducted via FindClusters, and cell annotation was performed using CellMarker, literature curation, and the <italic>SingleR</italic> tool.</p>
</sec>
<sec id="s2_14">
<title>Ligand&#x2013;receptor interaction analysis</title>
<p>Intercellular communication was inferred using CellChat (<xref ref-type="bibr" rid="B23">23</xref>), a computational framework for analyzing ligand-receptor networks from scRNA-seq data. Standardized expression matrices and cell subtype annotations were input. Interaction strength and frequency were quantified, and communication networks were mapped to assess signaling patterns associated with risk phenotypes.</p>
</sec>
<sec id="s2_15">
<title>Random survival forest</title>
<p>The RSF, a machine learning algorithm designed for survival data analysis, was applied to screen feature genes and rank their prognostic importance. Using the randomForestSRC package in R, we implemented the RSF algorithm with nrep = 1000 (indicating 1000 iterations in Monte Carlo simulations for stability assessment). Genes were ranked based on their variable importance scores, and those with a relative importance &gt; 0.2 were selected as final candidate feature genes.</p>
</sec>
<sec id="s2_16">
<title>Cell culture, RNA extraction, and qRT-PCR</title>
<p>The human melanoma cell lines A375 (Stem Cell Bank, Chinese Academy of Sciences) and SKMEK28 were cultured in DMEM (GIBCO, USA) containing 10% fetal bovine serum (FBS) (GIBCO, USA), 1% penicillin-streptomycin (100 U/mL penicillin and 100 &#x3bc;g/mL streptomycin), and 5% CO2 in an incubator at 37 &#xb0;C, while normal human epithelial keratinocytes (NHEK) were maintained in DMEM/F12 (GIBCO, USA) supplemented with 10% FBS and 10 ng/mL epidermal growth factor (EGF) and 1% penicillin-streptomycin. The manufacturer&#x2019;s protocol extracted Total RNA using TRIzol (Invitrogen). RNA concentrations were measured with a Nanodrop 2000C (Thermo Fisher Scientific), and cDNA was synthesized using a ThermoFisher reverse transcription kit. qRT-PCR was performed in a 20 &#xb5;L reaction volume containing SYBR Green Master Mix (CW0957H, Kangwei) and gene-specific primers. The reaction conditions included 95&#xb0;C for 10 min followed by 45 cycles at 95 &#xb0;C for 10 s and 60 &#xb0;C for 30 s. Primer sequences for CLN6, GMPR, AP1S2, ITGA6, and the &#x3b2;-actin reference gene are listed in detail below. The gene primer sequences were: Forward 5&#x2019;- TGCCATGCTGGTATTCCCTC-3&#x2019;, reverse 5&#x2019; - TGATGACGTTGTAGGCCATGT-3&#x2019; for human CLN6; Forward 5&#x2019;- CTCAAGCTCGACTTCAAGGATG-3&#x2019;, reverse 5&#x2019;- GGGAATCCCTGAGTAGGTCTG-3&#x2019; for human GMPR; Forward 5&#x2019;- TTCAGACCGTTTTAGCACGGA-3&#x2019;, reverse 5&#x2019;- TGTCCTGATCCTCAATAGCACA-3&#x2019; for human AP1S2; Forward 5&#x2019;- GGCGGTGTTATGTCCTGAGTC -3&#x2019;, reverse 5&#x2019;- AATCGCCCATCACAAAAGCTC-3&#x2019; for human ITGA6; Forward 5&#x2019;-CACCAACTGGGACGACAT-3&#x2019;, reverse 5&#x2019;- ACAGCCTGGATAGCAACG-3&#x2019; for human &#x3b2;-actin. Relative expression levels were normalized to &#x3b2;-actin. The siRNA was purchased from GenePharma (Shanghai, China). siRNA sequences were as follows: siCLN6-1: sense: 5&#x2019;-GACCUCUGGUUCUACUUCATT-3&#x2019;, antisense: 5&#x2019;-UGAAGUAGAACCAGAGGUCTT-3&#x2019;; siCLN6-2: sense: 5&#x2019;-GAACCCCAUCAUCAAGAAUTT-3&#x2019;, antisense: 5&#x2019;-AUUCUUGAUGAUGGGGUUCTT-3&#x2019;. Cells were incubated in 6-well plates, and transfection was started when cell density reached 60%. Transfection was performed using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific) in all cells maintained in Opti-MEM. The culture medium was replaced with fresh medium supplemented with 10% FBS after 12 h post-transfection. Transfection efficiency was detected using qRT-PCR.</p>
</sec>
<sec id="s2_17">
<title>MTS assay</title>
<p>A cell proliferation assay was performed in 96-well plates, 1000 cells were added to each well after counting. 24, 48, 72, 96 h later, 10 &#x3bc;L MTS solution (3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H tetrazolium) (Promega, Madison, WI, USA) was added to each well, incubated for 3 h, and the absorbance at 495 nm (OD) was detected by an enzyme labeling instrument (Thermo Fisher Scientific) according with the manufacturer&#x2019;s guidelines.</p>
</sec>
<sec id="s2_18">
<title>Wound healing assay</title>
<p>Wound healing assay was used to assess the migration ability of the cells. Transfected cells (10&#xd7; 10<sup>4</sup>/well) were inoculated in 6-well plates with a monolayer of cells evenly distributed on the bottom of the plate. The cell layer was scraped with a 200 &#x3bc;l pipette tip, washed with PBS, and FBS-free medium was added to each well. Images were then taken under an inverted microscope at 0 and 24h.</p>
</sec>
<sec id="s2_19">
<title>Statistical analysis</title>
<p>All experimental analysis was represented as the mean &#xb1; standard deviation (SD) from three times of replicative experiments. Microsoft Excel and GraphPad Prism 5 were used to draw the charts. All statistical analyses were conducted in R version 4.3.0. A <italic>p-value &lt; 0.05</italic> was considered statistically significant unless stated otherwise.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>Molecular subtyping based on ferroptosis-associated gene expression</title>
<p>Ferroptosis is closely associated with melanoma and can be leveraged as a potential therapeutic strategy to overcome drug resistance, enhance the efficacy of chemotherapy and radiotherapy, and modulate the tumor immune microenvironment. Thus, we obtained 484 ferroptosis-related genes from the FerrDb database (<ext-link ext-link-type="uri" xlink:href="http://www.zhounan.org/ferrdb">http://www.zhounan.org/ferrdb</ext-link>) and performed consensus clustering to stratify melanoma patients based on their expression profiles (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1A&#x2013;C</bold>
</xref>). The optimal number of clusters was determined as K = 3, resulting in three molecular subtypes: C1 (N=158), C2 (N=251), and C3 (N=63). A heatmap illustrated distinct gene expression patterns across these subtypes (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1D</bold>
</xref>). Survival analysis revealed significant differences in overall survival (OS) among the clusters (log-rank <italic>P &lt; 0.0001</italic>), with cluster C1 showing the best prognosis and cluster C3 the worst (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1E</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Consensus clustering&#x2013;based molecular subtyping and survival analysis of melanoma. <bold>(A)</bold> Consensus matrix heatmap showing robust subtype separation (C1, C2, C3) based on 484 ferroptosis-related genes from FerrDb. <bold>(B)</bold> Cumulative distribution function (CDF) curves for consensus clustering (K = 2&#x2013;6). <bold>(C)</bold> Delta area plot indicating optimal cluster number (K = 3). <bold>(D)</bold> Heatmap displaying the expression of ferroptosis-related genes across clusters C1, C2, and C3. <bold>(E)</bold> Kaplan&#x2013;Meier curves showing significant differences in overall survival (OS) among clusters. Statistical significance was determined by the Log-rank test (<italic>P &lt; 0.0001</italic>). C1 exhibits the most favorable prognosis, while C3 correlates with poor clinical outcomes. <bold>(F, G)</bold> Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis for each subtype, highlighting distinct immune, mitochondrial, and lysosomal signatures. Red indicates high expression, and blue indicates low expression. <bold>(H)</bold> Box plots summarizing immune cell infiltration differences across clusters based on CIBERSORT deconvolution. Significance was assessed using ANOVA, which is specifically designed for multi-group comparisons (<italic>*P &lt; 0.05, **P &lt; 0.01, ***P &lt; 0.001</italic>).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1624691-g001.tif">
<alt-text content-type="machine-generated">Panel A shows a consensus matrix heatmap for k equal to 3, indicating clustering of data. Panel B presents a consensus cumulative distribution function (CDF) plot, with lines representing different cluster numbers. Panel C displays a line graph of delta area values across cluster counts. Panel D is a heatmap depicting gene expression across subtypes C1, C2, and C3. Panel E is a Kaplan-Meier survival curve comparing survival probabilities of clusters C1, C2, and C3. Panels F and G are heatmaps showing enrichment scores of gene sets for each subtype. Panel H is a box plot comparing cell content proportions across different immune cell types for subtypes C1, C2, and C3.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_2">
<title>Pathway enrichment profiles define subtype-specific biological features</title>
<p>To investigate the functional characteristics of each subtype, GSEA was performed. Subtype C1 exhibited enrichment in immune-related pathways, including T cell receptor complex, immunoglobulin complex gene sets (GO), and KEGG terms such as primary immunodeficiency and graft-versus-host disease. C2 showed upregulation of mitochondrial and translational programs, including mitochondrial gene expression and aminoacyl-tRNA biosynthesis. C3 was enriched for epithelial differentiation and lysosomal activity, including keratinization and glycan degradation (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1F, G</bold>
</xref>). These results confirm that each ferroptosis-immune subtype exhibits distinct molecular and functional signatures.</p>
</sec>
<sec id="s3_3">
<title>Immune landscape differences across ferroptosis subtypes</title>
<p>Immune infiltration analysis revealed subtype-specific variations in the tumor immune microenvironment. Significant differences were observed in the relative abundance of memory B cells, naive B cells, eosinophils, macrophage subtypes (M1/M2), resting mast cells, NK cells (activated/resting), plasma cells, CD4+ and CD8+ T cell subsets, follicular helper T cells, and regulatory T cells (Tregs) (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1H</bold>
</xref>). These findings highlight the immunological heterogeneity among ferroptosis-related molecular subtypes.</p>
</sec>
<sec id="s3_4">
<title>Differential gene expression across subtypes</title>
<p>Pairwise differential expression analysis using <italic>limma</italic> on TCGA data identified 1,876 DEGs between C1 and C2, 5,307 DEGs between C1 and C3, and 4,561 DEGs between C2 and C3 (|logFC| &gt; 0.585, adjusted <italic>P</italic> &lt; 0.05). Volcano plots and heat maps illustrated the distribution of DEGs (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2A&#x2013;F</bold>
</xref>). A Venn diagram identified 241 overlapping DEGs shared across all three comparisons, forming a core candidate gene set for downstream modeling (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2G</bold>
</xref>).</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Melanoma subtype-specific gene expression. <bold>(A&#x2013;F)</bold> Volcano plots and heatmaps showing DEGs between: <bold>(A, B)</bold> C1 vs. C2; <bold>(C, D)</bold> C1 vs. C3; <bold>(E, F)</bold> C2 vs. C3. Thresholds: |log2FC| &gt; 0.585, adjusted <italic>P &lt; 0.05</italic>. The color scale of heatmaps representing high expression in red and low expression in blue. <bold>(G)</bold> Venn diagram illustrating 241 overlapping DEGs common to all three pairwise comparisons.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1624691-g002.tif">
<alt-text content-type="machine-generated">A series of data visualizations depicting three volcano plots (A, C, E), three heatmaps (B, D, F), and a Venn diagram (G). The volcano plots display gene expression changes with log2 fold change on the x-axis and negative log10 p-values on the y-axis, highlighting upregulated and downregulated genes. The heatmaps visualize gene expression data across different groups, with color bars indicating expression levels. The Venn diagram shows overlapping gene sets among three comparisons labeled C1 vs C2, C1 vs C3, and C2 vs C3, with numbers indicating gene counts.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_5">
<title>Integrating DEGs with WGCNA modules to identify hub genes</title>
<p>WGCNA was used to construct gene co-expression networks. Seven modules were identified with a soft threshold (&#x3b2; = 7) (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3A&#x2013;C</bold>
</xref>). The turquoise module (n = 4,207) exhibited the strongest negative correlation with cluster C3 (cor = -0.83, <italic>P</italic> = 3e-121). Intersecting this module with the 241 core DEGs yielded 93 overlapping genes (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3D</bold>
</xref>), which were prioritized as high-confidence prognostic candidates (see <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table 1</bold>
</xref>).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Key prognostic genes with strong differential expression and co-expression patterns. <bold>(A)</bold> Scale-free topology model fit and mean connectivity plot used to select soft-thresholding power (&#x3b2; = 7). <bold>(B)</bold> Dendrogram of gene co-expression modules with merged color-coded branches. <bold>(C)</bold> Module-trait correlations between WGCNA modules and molecular subtypes. Heatmap of module&#x2013;trait correlations showing strongest association between the turquoise module and cluster C3 (cor = &#x2013;0.83, <italic>P = 3e&#x2212;121</italic>). <bold>(D)</bold> Venn diagram identifying 93 overlapping genes between the 241 DEGs and 4,207 genes in the turquoise module.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1624691-g003.tif">
<alt-text content-type="machine-generated">Panel A shows two graphs: one plotting scale independence against soft threshold power and the other displaying mean connectivity. Panel B features a cluster dendrogram with colored annotations for dynamic tree cuts and module merging. Panel C is a heatmap illustrating module-trait relationships with color-coded correlations and significance values. Panel D is a Venn diagram comparing &#x201c;Diff&#x201d; and &#x201c;Module genes,&#x201d; showing overlaps with numbers 148, 93, and 4118.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_6">
<title>Prognostic model optimization using machine learning</title>
<p>We constructed prognostic models using the 93 candidate genes via benchmarking over 100 machine-learning algorithms. The final set of 40 genes (see <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table 1</bold>
</xref>) incorporated into the model showed significant functional enrichment in pigment metabolism, apoptotic signaling, and specific cellular structures (<xref ref-type="supplementary-material" rid="SF2">
<bold>Supplementary Image 2</bold>
</xref>). The StepCox<sup>[both]</sup> + SuperPC model demonstrated the best performance, with C-index values of 0.7, 0.61, and 0.62 in TCGA and two GEO validation cohorts, respectively (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4A, B</bold>
</xref>). ROC analysis showed AUCs of 0.81, 0.77, and 0.8 for 1-, 3-, and 5-year survival prediction, respectively (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4C</bold>
</xref>). Stratification based on the model&#x2019;s risk score revealed significant OS differences in both training and validation cohorts (log-rank <italic>P</italic> &lt; 0.05, <xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4D</bold>
</xref>).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Selecting a best melanoma prognostic model via machine learning. <bold>(A)</bold> C-index distribution across 100+ machine learning algorithms. <bold>(B)</bold> Performance evaluation of 100+ machine learning algorithms identifying StepCox[both] + SuperPC as optimal based on C-index across datasets. <bold>(C)</bold> Time-dependent ROC curves evaluating predictive accuracy at 1, 3, and 5 years in TCGA set (AUCs: 0.81, 0.77, 0.8). The AUC values range between 0.5 and 1, where 0.5 indicates no discriminative ability and 1 represents perfect discriminative ability. <bold>(D)</bold> Kaplan&#x2013;Meier survival curves showing significant OS differences between high- and low-risk groups in training and validation cohorts.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1624691-g004.tif">
<alt-text content-type="machine-generated">Panel A shows a heatmap of C-index values for various models across three cohorts, with color-coded values indicating performance. Panel B displays a bar chart with C-index scores for &#x201c;StepCox[both] + SuperPC&#x201d; in GSE5467, GSE53118, and TCGA cohorts. Panel C presents bar charts of AUC values for one, three, and five-year predictions in the TCGA cohort using &#x201c;StepCox[both] + SuperPC&#x201d;. Panel D contains three Kaplan-Meier plots comparing survival probabilities for high and low-risk groups across TCGA, GSE53118, and GSE5467 cohorts, with hazard ratios and p-values noted.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_7">
<title>Immunotherapy response prediction and TME associations</title>
<p>To analyze the association between risk stratification and immunotherapy response/immune evasion mechanisms, we leveraged the TIDE algorithm to infer functional states of immune cells (e.g., T-cell dysfunction, macrophage immunosuppression) from transcriptomic profiles of high- and low-risk groups. Expression levels of immunotherapy-related biomarkers (Merck18, CD8, CD274, IFNG) significantly differ between high- and low-risk groups (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A&#x2013;D</bold>
</xref>). Among the four groups, the high-risk group showed a higher proportion of low-risk score (LScore) than high-risk score (HScore), whereas the low-risk group exhibited the opposite pattern (HScore &gt; LScore). This indicates that immune response status may be associated with risk stratification, with high-risk groups potentially linked to diminished immune activation and low-risk groups correlating with enhanced immune responsiveness. Immune infiltration analysis showed notable differences in resting dendritic cells, mast cells, NK cells, and CD4+ memory T cells between risk groups (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6A, B</bold>
</xref>). Correlation analyses revealed positive associations between risk score and activated NK cells, resting dendritic cells, mast cells, and Tregs, and negative associations with resting CD4+ memory T cells (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>). While weak correlations (|r| &#x2248; 0.2) require cautious interpretation, they remain biologically plausible in heterogeneous tumors. These results support the model&#x2019;s relevance to immune landscape remodeling.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Immunotherapy biomarker expression across risk subgroups. <bold>(A&#x2013;D)</bold> Bar plots comparing expression levels of immunotherapy-related markers between high-risk (orange) and low-risk (green) groups: <bold>(A)</bold> CD8; <bold>(B)</bold> CD274; <bold>(C)</bold> IFNG; <bold>(D)</bold> Merck18. Categorical associations (e.g., immune responder vs. non-responder status) were statistically validated using the Chi-squared test (&#x3c7;&#xb2;, <italic>P</italic> &lt; 0.05).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1624691-g005.tif">
<alt-text content-type="machine-generated">Four grouped bar charts labeled A to D show proportions of &#x201c;LScore&#x201d; (green) and &#x201c;HScore&#x201d; (orange) within two groups, Helix and LinkA. Chart A (CD8) shows 72% LScore in Helix, 29% in LinkA; Chart B (CD274) shows 77% LScore in Helix, 24% in LinkA; Chart C (IFNG) shows 77% LScore in Helix, 23% in LinkA; Chart D (Merck18) shows 74% LScore in Helix, 25% in LinkA. Statistical data and p-values are provided.</alt-text>
</graphic>
</fig>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Tumor microenvironment remodeling associated with the ferroptosis-based risk score. <bold>(A)</bold> Overall immune landscape comparisons between risk groups using CIBERSORT. <bold>(B)</bold> Boxplots of differentially abundant immune cell types (FDR &lt; 0.05) (*P &lt; 0.05, **P &lt; 0.01, ***P &lt; 0.001). <bold>(C)</bold> Lollipop plot illustrating associations between risk score and immune cell populations: Positive correlations with Resting dendritic cells, Resting Mast cells, Eosinophils, Macrophages M0, and Macrophages M2; negative correlations with Naive CD4<sup>+</sup> T cells, Plasma cells, T cells follicular helper, Macrophages M1, Activated CD4<sup>+</sup> memory T cells, and CD8<sup>+</sup> T cells.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1624691-g006.tif">
<alt-text content-type="machine-generated">Panel A shows a stacked bar chart detailing the relative percent of immune cell types categorized by &#x201c;HRisk&#x201d; and &#x201c;LRisk&#x201d; groups. Panel B features a boxplot comparing cell content between &#x201c;HRisk&#x201d; and &#x201c;LRisk&#x201d; subtypes. Panel C consists of a correlation plot illustrating cell type associations with colors indicating p-values and circle sizes representing correlation strength.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_8">
<title>Multi-dimensional biomarker analysis: immune regulation and drug sensitivity</title>
<p>We conducted subsequent analyses to explore the associations between the risk score and immunomodulators, as well as chemotherapy sensitivity. Differential analysis of immunomodulators from the TISIDB database revealed subtype-specific expression patterns among immunosuppressive genes, immunostimulants, chemokines, and receptors (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7A&#x2013;E</bold>
</xref>). Drug sensitivity prediction using <italic>oncoPredict</italic> showed significant associations between the risk score and sensitivity to several agents (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8A</bold>
</xref>). The low-risk score group exhibited lower IC50 values for SB216763, KU-55933, NU7441, Doramapimod, Camptothecin, and Axitinib (<italic>P &#x2264; 0.05</italic>), indicating heightened sensitivity to these agents. These findings provide clearer therapeutic selection criteria for melanoma based on risk stratification.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Immune regulatory gene differences between high- and low-risk subgroups. <bold>(A&#x2013;E)</bold> Box plots showing expression differences in five immune regulatory gene categories retrieved from the TISIDB database: <bold>(A)</bold> Chemokines; <bold>(B)</bold> Immunoinhibitors; <bold>(C)</bold> Immunostimulators; <bold>(D)</bold> MHC molecules; <bold>(E)</bold> Chemokine receptors (*P &lt; 0.05, **P &lt; 0.01, ***P &lt; 0.001).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1624691-g007.tif">
<alt-text content-type="machine-generated">Five panels labeled A to E display box plots comparing gene expression levels across two subtypes, Ulcak and Hisak, depicted in blue and pink respectively. Each panel shows different sets of genes on the x-axis and expression levels on the y-axis, with some genes showing significant differences indicated by asterisks. Panel A depicts a wide range of genes; Panel B focuses on a smaller set; Panel C shows another diverse group; Panel D highlights higher expression levels; Panel E contains fewer genes. Statistical significance varies across the genes, as annotated above the plots.</alt-text>
</graphic>
</fig>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Drug sensitivity and signaling pathway activation contrasting the high- and low-risk subgroups. <bold>(A)</bold> Predicted sensitivity to chemotherapeutic agents via oncoPredict, showing risk score associations with SB216763, KU-55933, NU7441, Doramapimod, Camptothecin, and Axitinib. Low-risk patients exhibit heightened sensitivity to SB216763, KU-55933, NU7441, Doramapimod, Camptothecin, and Axitinib (Wilcoxon <italic>P&#x2264; 0.05</italic>). <bold>(B)</bold> GSEA pathway enrichment analysis of high- versus low-risk groups. <bold>(C)</bold> The molecular interaction network cross pathways. <bold>(D)</bold> GSVA highlighting distinct enrichment of pathways (MYC_TARGETS_V2, MYC_TARGETS_V1, OXIDATIVE_PHOSPHORYLATION) in high- versus low-risk groups.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1624691-g008.tif">
<alt-text content-type="machine-generated">Panel A shows six violin plots comparing lamp and heep expression of risk scores across different markers. Panel B presents a line graph illustrating enrichment scores and ranked metrics for the Apelin signaling pathway, cornified envelope formation, and estrogen signaling pathway. Panel C features a circular network diagram depicting connections among these pathways. Panel D contains a bar chart comparing GSVA scores for high risk versus low risk groups of risk scores, highlighting specific gene sets.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_9">
<title>Pathway enrichment underlying the risk model</title>
<p>GSEA revealed significant pathway associations with the risk score, including positive enrichment of Apelin signaling pathway, Cornified envelope formation, and Estrogen signaling pathway (<xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8B, C</bold>
</xref>). GSVA analysis supported these findings, revealing enrichment of MYC_TARGETS_V2, MYC_TARGETS_V1, OXIDATIVE_PHOSPHORYLATION, and WNT_BETA_CATENIN_SIGNALING in high-risk groups, and negative enrichment of FATTY_ACID_METABOLISM and PI3K_AKT_MTOR_SIGNALING (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8D</bold>
</xref>). Samples with high-risk scores showed enrichment in pathways corresponding to the blue region, whereas those with low-risk scores were enriched in pathways associated with the green region. These results suggest that the risk score reflects coordinated reprogramming of metabolic and inflammatory signaling networks.</p>
</sec>
<sec id="s3_10">
<title>Prognostic nomogram development</title>
<p>Based on clinical data and key gene expression levels, we established univariate Cox regression models and generated forest plots (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9A</bold>
</xref>). Subsequently, factors with a <italic>p-value</italic> less than 0.05 were extracted for multivariate analysis. The results revealed that Age, T stage, N stage, and risk score had <italic>p-values</italic> less than 0.05 (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9B</bold>
</xref>). We therefore identified these as key clinical indicators and proceeded to construct a nomogram model. Using the risk score, we presented the results of the regression analysis in the form of a nomogram. The regression analysis indicated that the values of different clinical indicators for melanoma and the distribution of the risk score expression contribute variably to the overall scoring process.</p>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>Nomogram-based prognostic modeling. <bold>(A)</bold> Forest plot of univariate Cox regression analysis of clinical data and key gene expression levels in melanoma patients. <bold>(B)</bold> Key clinical indicators (Age, T stage, N stage, and risk score) identified through multivariate Cox regression analysis (<italic>P&lt;0.05</italic>). <bold>(C)</bold> Nomogram combining clinical variables and risk score developed using multivariable Cox regression. Points assigned to each variable are summed to calculate total risk, mapped to survival probability on the bottom axis. <bold>(D)</bold> Calibration plots showing predicted vs. observed OS at 1, 3, and 5 years. Diagonal dashed line represents perfect concordance. <bold>(E)</bold> ROC analysis demonstrating predictive performance. AUC values of 0.829 (1-year), 0.845 (3-year), and 0.841 (5-year) confirm robust discriminative capacity. Shaded regions denote 95% confidence intervals. <bold>(F)</bold> Decision curve analysis (DCA) indicating net clinical benefit over single-variable models.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1624691-g009.tif">
<alt-text content-type="machine-generated">A series of six panels show statistical and graphical analyses:  A. Hazard ratios for age, gender, stage, tumor (T), metastasis (M), node (N), and risk score with confidence intervals.  B. Hazard ratios for age, stage, tumor, node, and risk score with confidence intervals.  C. Nomogram predicting survival probabilities based on points for age, tumor, node, and risk score.  D. Calibration plot comparing observed versus predicted overall survival at one, three, and five years.  E. ROC curves displaying the area under the curve (AUC) for one, three, and five-year survival.  F. Decision curve analysis showing net benefit across risk thresholds for age, tumor, node, risk score, all, and none categories.</alt-text>
</graphic>
</fig>
<p>Furthermore, this study performed predictive analyses for overall survival (OS) at 1-year, 3-year, and 5-year time points. The results demonstrated a close agreement between the predicted OS and the observed OS, indicating that the nomogram model possesses good predictive performance (<xref ref-type="fig" rid="f9">
<bold>Figures&#xa0;9C, D</bold>
</xref>). ROC curves and DCA curves were also generated (<xref ref-type="fig" rid="f9">
<bold>Figures&#xa0;9E, F</bold>
</xref>).</p>
</sec>
<sec id="s3_11">
<title>Single-cell quality control and integration</title>
<p>After filtering low-quality or doublet cells (UMIs &lt; 200 or &gt;3 MAD), 24,111 high-quality cells remained (<xref ref-type="supplementary-material" rid="SF1">
<bold>Supplementary Images 1A, B</bold>
</xref>). Quality metrics were visualized using violin and scatter plots. HVG selection (n = 2,000) was followed by normalization, scaling, PCA, and Harmony-based batch correction to produce an integrated dataset for clustering (<xref ref-type="supplementary-material" rid="SF1">
<bold>Supplementary Images 1C&#x2013;F</bold>
</xref>). To tackle potential batch effects, we first applied the Harmony algorithm and then performed nonlinear dimensionality reduction using RunUMAP (Uniform Manifold Approximation and Projection).</p>
</sec>
<sec id="s3_12">
<title>Cell type annotation and TME composition</title>
<p>After UMAP dimensionality reduction, cell clustering using the Leiden algorithm resolved 12 distinct clusters (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10A</bold>
</xref>). These clusters were annotated into nine major cell populations&#x2014;Melanoma, T cells, NK cells, B cells, Endothelial cells, Fibroblasts, Pericyte, Mononuclear phagocytes, and Keratinocytes&#x2014;using marker genes defined by CellMarker and literature-curated signatures (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10B</bold>
</xref>). Marker gene expression across nine cell types was visualized via bubble plots (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10C</bold>
</xref>), while bar plots depicted sample-specific cellular proportions for these nine cell types (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10D</bold>
</xref>).</p>
<fig id="f10" position="float">
<label>Figure&#xa0;10</label>
<caption>
<p>Single-cell clustering, cell annotation, and ferroptosis activity quantification. <bold>(A)</bold> UMAP dimensionality reduction and Leiden algorithm - based cell clustering identified 12 distinct cell clusters. <bold>(B)</bold> Cell type annotation using canonical marker genes. Marker genes defining by CellMarker and literature-curated signatures. <bold>(C)</bold> A dot plot showing expression frequency and levels for lineage-specific markers. <bold>(D)</bold> Stacked bar plots showing cell type proportions across patient samples. <bold>(E)</bold> AUCell quantification of ferroptosis activity at single-cell resolution (****P&lt;0.0001).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1624691-g010.tif">
<alt-text content-type="machine-generated">Panel A displays a UMAP plot of cell clusters with various colors indicating different cell types. Panel B is a labeled version, identifying clusters as melanoma, T cells, NK cells, B cells, among others. Panel C is a dot plot showing gene expression levels across cell types, with dot size representing the percentage expressed and color indicating average expression. Panel D is a bar chart of cell type proportions across three samples. Panel E presents a UMAP plot highlighting a feature called &#x201c;Ferroptosis&#x201d; and a box plot comparing its expression across cell types.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_13">
<title>Ferroptosis activity and ligand&#x2013;receptor interactions</title>
<p>Using AUCell, we quantified ferroptosis activity per cell, identifying malignant cells as the most ferroptosis-enriched population (Mann-Whitney <italic>P &lt; 0.001</italic>, <xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10E</bold>
</xref>). Fibroblasts were stratified into high- and low-ferroptosis groups based on the median value of ferroptosis activity scores. To investigate ferroptosis-mediated intercellular communication, we employed CellChat to infer ligand-receptor interactions across distinct cellular subtypes. The analysis revealed complex multicellular interaction networks involving ferroptosis-associated signaling pathways (<xref ref-type="fig" rid="f11">
<bold>Figures&#xa0;11A, B</bold>
</xref>). The POSTN-(ITGAV+ITGB5) ligand-receptor pair exhibited higher communication probability from Lsco_Fibroblasts to Hsco_Fibroblasts, while GZMA-F2R showed elevated interaction likelihood from NK cells to Hsco_Fibroblasts (<xref ref-type="fig" rid="f11">
<bold>Figure&#xa0;11C</bold>
</xref>). These results probably implicate fibroblast-mediated crosstalk in ferroptosis-associated TME remodeling.</p>
<fig id="f11" position="float">
<label>Figure&#xa0;11</label>
<caption>
<p>Ligand&#x2013;receptor interactions mediating fibroblast&#x2013;melanoma crosstalk in ferroptosis context. <bold>(A)</bold> The network illustrating quantitative connectivity patterns among distinct cellular subpopulations, with line width representing interaction strength. Node size corresponds to cell population abundance, and edge color denotes directionality (from sender to receiver cells). <bold>(B)</bold> Bar plot showing the distribution of distinct cellular subpopulations. <bold>(C)</bold> Bubble chart representing the probability of signaling via specific ligand&#x2013;receptor pairs. Red indicates high interaction probability; blue indicates low. Notable pairs include POSTN&#x2013;(ITGAV+ITGB5) and GZMA&#x2013;F2R.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1624691-g011.tif">
<alt-text content-type="machine-generated">Diagram comparing cell interactions. Panel A shows two network graphs: one for the number of interactions and the other for interaction weights, connecting various cell types like melanoma, T cells, NK cells, and fibroblasts. Panel B is a bar chart displaying cell type counts, with Hsco_Fibroblasts showing the highest count. Panel C is a dot plot illustrating communication probabilities among different cell types with varying p-values represented by color.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_14">
<title>Identification of critical model genes in melanoma</title>
<p>To further identify key model genes influencing melanoma, we performed RSF analysis on the candidate genes obtained from the aforementioned analyses. Genes with a relative importance &gt; 0.2 were selected as final biomarkers, and the importance ranking of the top 6 genes is displayed in <xref ref-type="fig" rid="f12">
<bold>Figure&#xa0;12A</bold>
</xref>. Subsequent survival analysis of these 6 genes revealed that AP1S2, CLN6, GMPR, and ITGA6 exhibited statistically significant differences in survival outcomes (<xref ref-type="fig" rid="f12">
<bold>Figures&#xa0;12B-E</bold>
</xref>). Consequently, these four genes were identified as critical model genes for further investigation.</p>
<fig id="f12" position="float">
<label>Figure&#xa0;12</label>
<caption>
<p>Prognostic model genes associated with melanoma identified by random forest analysis. <bold>(A)</bold> Random forest analysis demonstrating the importance of ferroptosis-related model genes (CLN6, PNMA6A, ITGA6, AP1S2, LGI3, and GMPR). Genes with a relative importance &gt; 0.2. <bold>(B-E)</bold> Survival analysis was performed on the six identified genes, revealing that AP1S2, CLN6, GMPR, and ITGA6 were significantly associated with survival differences (<italic>P &#x2264; 0.05</italic>).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1624691-g012.tif">
<alt-text content-type="machine-generated">Panel A shows an error rate decreasing as the number of trees increases in a random forest model. Panel B to E display Kaplan-Meier survival curves comparing high and low expression groups for genes AP1S2, CLN6, GMPR, and ITGA6. Significant p-values indicate differences in survival probability over time between groups.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_15">
<title>Validation of prognostic gene expression</title>
<p>We confirmed the expression patterns of CLN6, GMPR, AP1S2, and ITGA6 in melanoma cells using gene-specific primers by qRT-PCR. CLN6, AP1S2, and ITGA6 were highly expressed in A375 and SK-MEL28 cells, whereas were abundant in HNEK cells (<xref ref-type="fig" rid="f13">
<bold>Figure&#xa0;13A</bold>
</xref>). However, we observed low expression of GMPR in A375 and SKMEL28 cells, which contradicted the predicted results. Since all analytical methods may carry inherent limitations or variability, we ultimately excluded GMPR from further investigation.</p>
<fig id="f13" position="float">
<label>Figure&#xa0;13</label>
<caption>
<p>CLN6 as a Critical Driver of Melanoma Proliferation and Migration. <bold>(A)</bold> qRT-PCR validation of the expression of four genes (CLN6, GMPR, AP1S2, and ITGA6) in A375, SK-MEL-28, and NHEK cells. <bold>(B)</bold> Box plots showing the expression of CLN6, GMPR and AP1S2 in 461 skin cutaneous melanoma tissues compared with 558 normal tissues through GEPIA (<ext-link ext-link-type="uri" xlink:href="http://gepia.cancer-pku.cn">http://gepia.cancer-pku.cn</ext-link>). <bold>(C)</bold> The knockdown efficiency of CLN6 in A375 and SKMEL28 cells transfected with siRNA1/2 was detected using qRT-PCR. <bold>(D)</bold> Proliferative capacity was detected by MTS assay. <bold>(E)</bold> Wound healing assay was used to detect the migration ability (*P &lt; 0.05, **P &lt; 0.01, ***P &lt; 0.001).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1624691-g013.tif">
<alt-text content-type="machine-generated">Figure with multiple panels displaying data analysis results:  A) Bar graphs showing relative expression levels of CLN6, GMPR, AP1S2, and ITGA6 in NHBE, A375, and SKMEL28 cell lines, with significant differences indicated.  B) Box plots for CLN6, GMPR, AP1S2, and ITGA6 expression levels, comparing two sample groups labeled S-SXCM and SXCM, with significance markers.  C) Bar graphs comparing relative expression of CLN6 between siNC and siCLN6 samples in A375 and SKMEL28 cell lines.  D) Line graphs showing OD values over time for A375 and SKMEL28, comparing siNC and siCLN6 conditions.  E) Images showing cell migration at 0 and 24 hours for A375 and SKMEL28 under siNC and siCLN6 conditions.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_16">
<title>CLN6 plays a critical role in melanoma proliferation and migration</title>
<p>Based on GEPIA (<ext-link ext-link-type="uri" xlink:href="http://gepia.cancer-pku.cn">http://gepia.cancer-pku.cn</ext-link>), the expression of CLN6, GMPR and AP1S2 was significantly up-regulated in 461 skin cutaneous melanoma tissues compared with 558 normal tissues (<xref ref-type="fig" rid="f13">
<bold>Figure&#xa0;13B</bold>
</xref>). Integrated analysis of survival data from the TCGA database, gene expression profiles, and qRT-PCR validation results indicated that CLN6 may serve as a critical prognosis-related gene in melanoma, warranting further investigation and validation. Subsequently, we performed CLN6 knockout and confirmed its efficacy via qRT-PCR (<xref ref-type="fig" rid="f13">
<bold>Figure&#xa0;13C</bold>
</xref>). siCLN6&#x2013;1 was selected for subsequent experiments. In the time-lapse proliferation assay, CLN6 knockdown (siCLN6-1) significantly suppressed cell proliferation at 12, 24, 48 and 96 hours compared to the siNC group (<xref ref-type="fig" rid="f13">
<bold>Figure&#xa0;13D</bold>
</xref>). Furthermore, in the scratch wound healing assay, siCLN6&#x2013;1 knockdown markedly inhibited melanoma cell migration ability (<xref ref-type="fig" rid="f13">
<bold>Figure&#xa0;13E</bold>
</xref>).</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<p>Melanoma remains the leading cause of skin cancer&#x2013;related mortality, with more than 833,000 cases reported globally in 2021 (<xref ref-type="bibr" rid="B1">1</xref>). Despite advances in targeted therapies (e.g., BRAF/MEK inhibitors) (<xref ref-type="bibr" rid="B24">24</xref>, <xref ref-type="bibr" rid="B25">25</xref>) and immunotherapies (e.g., anti-PD-1/PD-L1/CTLA-4) (<xref ref-type="bibr" rid="B26">26</xref>, <xref ref-type="bibr" rid="B27">27</xref>), clinical outcomes remain variable, particularly in metastatic disease, where 5-year survival rates drop below 30%. Current staging systems, such as the AJCC TNM classification, are limited by their reliance on clinicopathological parameters, which fail to capture the underlying molecular heterogeneity that drives therapeutic resistance and disease progression (<xref ref-type="bibr" rid="B28">28</xref>). To address this unmet need, we developed a ferroptosis-centric risk model that integrates bulk and single-cell transcriptomic data using a machine learning&#x2013;based framework. This model demonstrated robust prognostic performance, stratifying patients into clinically relevant subgroups with distinct survival outcomes (log-rank <italic>P &lt; 0.0001</italic>) and chemotherapy sensitivities. By linking ferroptosis-associated molecular subtypes with immunological features and clinical phenotypes, our approach contributes to precision oncology by enabling individualized therapeutic decision-making.</p>
<p>The tumor immune microenvironment plays a central role in shaping melanoma progression and therapy response. High infiltration of effector immune cells&#x2014;such as CD8<sup>+</sup> cytotoxic T lymphocytes, activated NK cells, and M1 macrophages&#x2014;has been correlated with improved survival and enhanced sensitivity to immune checkpoint inhibitors (ICIs) (<xref ref-type="bibr" rid="B29">29</xref>, <xref ref-type="bibr" rid="B30">30</xref>). In contrast, the increased presence of immunosuppressive populations, including regulatory T cells (Tregs), myeloid-derived suppressor cells (MDSCs), and M2-polarized macrophages, is associated with immune escape and poor prognosis (<xref ref-type="bibr" rid="B31">31</xref>&#x2013;<xref ref-type="bibr" rid="B33">33</xref>). Recent advances in single-cell and spatial transcriptomics have revealed substantial intratumoral heterogeneity, including immune &#x201c;hot&#x201d; and &#x201c;cold&#x201d; phenotypes, that further modulate ICI efficacy (<xref ref-type="bibr" rid="B34">34</xref>&#x2013;<xref ref-type="bibr" rid="B37">37</xref>). According to my study, the ferroptosis-immune axis drives melanoma progression through subtype-specific biological mechanisms and immune-metabolic crosstalk. C1 (immune-enriched), characterized by T cell receptor signaling and cytotoxic lymphocyte infiltration (B cells/CD8<sup>+</sup> T cells), may exhibit a favorable prognosis due to IFN-&#x3b3;&#x2013;mediated ACSL4 upregulation, which amplifies ferroptosis sensitivity while maintaining an immune-hot microenvironment responsive to checkpoint inhibitors. In contrast, C3 (lysosomal/epithelial) shows poor survival linked to immunosuppressive Treg/resting mast cell dominance, where TGF-&#x3b2;/IL-10 mediated suppression of cytotoxicity promotes ferroptosis resistance and immune evasion. Paradoxically, lysosomal membrane permeabilization in C3 may transiently enhance iron release via cathepsins, but this vulnerability is overridden by dominant immunosuppression. C2 (mitochondrial/translational) displays intermediate outcomes due to OXPHOS-driven metabolic competition, where nutrient depletion restricts both T cell activity and ferroptosis susceptibility, reflecting metabolic plasticity-driven therapy resistance. These subtypes highlight ferroptosis as a regulatory nexus: immune activation in C1 synergizes with ferroptosis to suppress tumors, while immunosuppression in C3 protects against it. Stromal interactions (e.g., POSTN&#x2013;ITGB5 signaling) further modulate therapeutic vulnerability, underscoring the need for subtype-tailored strategies-combining immunotherapy/ferroptosis inducers for C1 versus metabolic or stromal targeting for C2/C3.</p>
<p>Previous studies have explored the prognostic relevance of ferroptosis-related genes and long non-coding RNAs (lncRNAs) in melanoma (<xref ref-type="bibr" rid="B38">38</xref>, <xref ref-type="bibr" rid="B39">39</xref>). However, most of these models were constructed using univariate selection or limited feature integration strategies. In contrast, our model employed a systems biology approach, incorporating WGCNA-derived hub genes, immune infiltration metrics, and machine learning&#x2014;based optimization across over 100 algorithms. The resulting 93-gene signature exhibited improved prognostic accuracy and demonstrated predictive relevance for immunotherapy response and chemotherapy sensitivity. Notably, the risk score correlates negatively with cytotoxic T-cell infiltration but positively with immunosuppressive myeloid subsets, mirroring the immune landscape commonly observed in checkpoint-resistant melanomas. Although the StepCox<sup>[both]</sup> + SuperPC machine learning model achieved a C-index of 0.7 in the training set and 0.61-0.62 in the validation sets, the integration of the genetic risk score with clinical parameters within a prognostic nomogram model (AUC = 0.829-0.845) significantly enhanced the accuracy of prognostic stratification. This improvement underscores the necessity of multidimensional data integration for precision medicine. Future studies shall further validate the potential of the nomogram in guiding immunotherapy and targeted therapy, particularly the potential benefits of personalized interventions for high-risk subgroup patients.</p>
<p>Mechanistically, our data support the dual role of ferroptosis in melanoma&#x2014;acting both as a tumor-suppressive mechanism and as a modulator of immune escape. While ferroptotic cells can release damage-associated molecular patterns (DAMPs) that enhance antigen presentation, lipid peroxidation byproducts such as 4-hydroxynonenal (4-HNE) may simultaneously impair T cell function and promote Treg survival. Our single-cell analyses revealed that fibroblasts with high ferroptosis activity exhibited increased ligand-receptor interactions with malignant cells, probably through the POSTN&#x2013;ITGAV/ITGB5 axis. These findings suggest that fibroblast-mediated buffering of oxidative stress may create an immunosuppressive niche that enables tumor progression. Such complexity underscores the need for context-specific targeting of ferroptosis pathways to maximize therapeutic efficacy without compromising antitumor immunity. The four-gene signature (CLN6, GMPR, AP1S2, ITGA6) and their validated roles in proliferation/migration (e.g., CLN6 knockdown suppressing tumor growth) provide novel therapeutic targets. CLN6 is an endoplasmic reticulum (ER) membrane protein, and studies have reported that its functional defects lead to neuronal ceroid lipofuscinosis (NCL), with lysosomal dysfunction being a central hallmark of NCL (<xref ref-type="bibr" rid="B40">40</xref>). One key mechanism of ferroptosis involves iron overload-induced lipid peroxidation. As lysosomes are critical organelles for intracellular iron storage and recycling, their dysfunction may disrupt iron metabolism. Additionally, CLN6 deficiency causes impaired lysosomal enzyme trafficking, which could affect the synthesis or localization of GPX4. For example, GPX4 requires transport via the ER-Golgi pathway to reach mitochondria or the cytoplasm, and disrupted trafficking may result in loss of GPX4 function, exacerbating lipid peroxidation (<xref ref-type="bibr" rid="B41">41</xref>). A study focusing on glycolysis-related genes and their link to uveal melanoma prognosis identified CLN6 as a gene associated with the prognosis of uveal melanoma (<xref ref-type="bibr" rid="B42">42</xref>). In subsequent studies, we will focus on elucidating the mechanistic connections between CLN6 and ferroptosis-related pathways. Additionally, ITGA6 (a laminin receptor) promotes metastasis in multiple cancers, suggesting its inhibition could disrupt ferroptosis-ECM crosstalk. In a study on constructing a prognostic model for glioma based on ferroptosis-related genes, the model gene ITGA6 was verified to enhance cell proliferation, migration, and invasion (<xref ref-type="bibr" rid="B43">43</xref>).</p>
<p>Pathway enrichment analyses further elucidated potential mechanisms linking the risk score to disease progression. High-risk patients exhibited signatures of T-cell dysfunction, macrophage immunosuppression (via TIDE), reduced expression of immunotherapy biomarkers (CD274/PD-L1, IFNG), and enrichment in pathways associated with aggressive phenotypes (MYC targets, WNT/&#x3b2;-catenin). Conversely, low-risk scores correlated with enhanced immune responsiveness and sensitivity to specific chemotherapeutics (e.g., Camptothecin, Axitinib) and targeted agents (e.g., Doramapimod). These findings nominate rational combination strategies: for instance, co-administration of MYC inhibitors or WNT inhibitors (e.g., LGK974) with ferroptosis inducers (e.g., erastin) may overcome immune exclusion and sensitize tumors to iron-dependent cell death. On the other hand, the correlation of low - risk scores with enhanced immune responsiveness and sensitivity to certain chemotherapeutics and targeted agents opens up opportunities for personalized treatment strategies. This risk - score - based approach may allow for more precise patient stratification, enabling clinicians to tailor treatments to individual risk profiles and potentially improving clinical outcomes. Further validation in clinical trials is warranted to confirm these findings and pave the way for integrating such risk - score - guided strategies into routine clinical practice.</p>
<p>Several limitations merit consideration. First, this study relied on retrospective analysis of publicly available transcriptomic datasets (TCGA, GEO), and prospective clinical validation is required. Second, single-cell analyses were performed exclusively on primary tumors, potentially limiting generalizability to metastatic lesions with distinct ferroptosis-immune dynamics. Third, the inferred ligand-receptor interactions require experimental confirmation to establish causality. Future work could incorporate spatial transcriptomics to resolve microenvironmental architecture and test ferroptosis-immunotherapy combination regimens in organoid or patient-derived xenograft (PDX) models.</p>
<p>In summary, our study presents an integrative multi-omics framework that decodes melanoma&#x2019;s ferroptosis&#x2013;immunity axis. By leveraging bulk and single-cell transcriptomic data, we developed a machine learning&#x2014;optimized risk model that captures dynamic immunometabolic states and stratifies patients by prognosis, immunotherapy responsiveness, and drug sensitivity. These findings provide a molecular rationale for co-targeting ferroptosis regulators and immune checkpoint pathways to overcome therapeutic resistance in high-risk melanoma. Future translational studies are warranted to validate and extend these observations in clinical settings.</p>
</sec>
</body>
<back>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Material</bold>
</xref>.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>This research utilized published studies and consortia that have made their summary statistics publicly available. All original studies included in this research have obtained approval from their respective ethical review boards, and participants have provided informed consent. It is important to note that no individual-level data was utilized in this study. As a result, no new ethical review board approval was necessary for this research.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>LW: Funding acquisition, Formal analysis, Resources, Validation, Data curation, Conceptualization, Writing &#x2013; review &amp; editing, Methodology, Investigation, Writing &#x2013; original draft, Software. XJ: Conceptualization, Investigation, Methodology, Data curation, Writing &#x2013; original draft. YW: Formal analysis, Writing &#x2013; original draft, Software, Data curation, Investigation, Methodology, Project administration. RQ: Software, Writing &#x2013; review &amp; editing, Investigation, Writing &#x2013; original draft, Data curation, Methodology. JW: Conceptualization, Resources, Project administration, Visualization, Investigation, Validation, Funding acquisition, Formal analysis, Supervision, Writing &#x2013; original draft, Data curation, Software, Methodology, Writing &#x2013; review &amp; editing.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare that financial support was received for the research and/or publication of this article. This work was funded in part by the Research Start-up Fund Project of Shaoxing People&#x2019;s Hospital (No. 2023BHQDJ02) and the Science and Technology Innovation Project of Shaoxing (No. 2024SKY028).</p>
</sec>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="ai-statement">
<title>Generative AI statement</title>
<p>The author(s) declare that no Generative AI was used in the creation of this manuscript.</p>
</sec>
<sec id="s11" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s12" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fimmu.2025.1624691/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fimmu.2025.1624691/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Table2.docx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
<supplementary-material xlink:href="Image1.jpeg" id="SF1" mimetype="image/jpeg">
<label>Supplementary Image&#xa0;1</label>
<caption>
<p>Quality control and preprocessing of single-cell transcriptomic data. <bold>(A)</bold> Violin plots displaying distributions of UMIs, gene counts, and mitochondrial/ribosomal read percentages before and after filtering. <bold>(B)</bold> Scatter plots of mitochondrial vs. nuclear gene expression; doublets (red) removed using Scrublet v2.0.4. Final n = 24,111 cells. <bold>(C)</bold> Identification of top 2,000 highly variable genes (HVGs) via mean&#x2013;variance plot. <bold>(D)</bold> Log-normalized, z-score scaled expression matrix. <bold>(E, F)</bold> PCA (top 50 PCs) and Harmony-corrected latent space used for batch effect mitigation.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Image2.jpeg" id="SF2" mimetype="image/jpeg">
<label>Supplementary Image&#xa0;2</label>
<caption>
<p>GO enrichment analysis showing the enriched pathways of the 40 model genes.</p>
</caption>
</supplementary-material>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>C</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>L</given-names>
</name>
<name>
<surname>Li</surname> <given-names>X</given-names>
</name>
<name>
<surname>Xin</surname> <given-names>H</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Global, regional, and national burden of cutaneous Malignant melanoma from 1990 to 2021 and prediction to 2045</article-title>. <source>Front Oncol</source>. (<year>2024</year>) <volume>14</volume>:<elocation-id>1512942</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fonc.2024.1512942</pub-id>, PMID: <pub-id pub-id-type="pmid">39777336</pub-id></citation></ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dummer</surname> <given-names>R</given-names>
</name>
<name>
<surname>Brase</surname> <given-names>JC</given-names>
</name>
<name>
<surname>Garrett</surname> <given-names>J</given-names>
</name>
<name>
<surname>Campbell</surname> <given-names>CD</given-names>
</name>
<name>
<surname>Gasal</surname> <given-names>E</given-names>
</name>
<name>
<surname>Squires</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Adjuvant dabrafenib plus trametinib versus placebo in patients with resected, BRAFV600-mutant, stage III melanoma (COMBI-AD): exploratory biomarker analyses from a randomised, phase 3 trial</article-title>. <source>Lancet Oncol</source>. (<year>2020</year>) <volume>21</volume>:<page-range>358&#x2013;72</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S1470-2045(20)30062-0</pub-id>, PMID: <pub-id pub-id-type="pmid">32007138</pub-id></citation></ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luke</surname> <given-names>JJ</given-names>
</name>
<name>
<surname>Rutkowski</surname> <given-names>P</given-names>
</name>
<name>
<surname>Queirolo</surname> <given-names>P</given-names>
</name>
<name>
<surname>Del Vecchio</surname> <given-names>M</given-names>
</name>
<name>
<surname>Mackiewicz</surname> <given-names>J</given-names>
</name>
<name>
<surname>Chiarion-Sileni</surname> <given-names>V</given-names>
</name>
<etal/>
</person-group>. <article-title>Pembrolizumab versus placebo as adjuvant therapy in completely resected stage IIB or IIC melanoma (KEYNOTE-716): a randomised, double-blind, phase 3 trial</article-title>. <source>Lancet</source>. (<year>2022</year>) <volume>399</volume>:<page-range>1718&#x2013;29</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0140-6736(22)00562-1</pub-id>, PMID: <pub-id pub-id-type="pmid">35367007</pub-id></citation></ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pope</surname> <given-names>LE</given-names>
</name>
<name>
<surname>Dixon</surname> <given-names>SJ</given-names>
</name>
</person-group>. <article-title>Regulation of ferroptosis by lipid metabolism</article-title>. <source>Trends Cell Biol</source>. (<year>2023</year>) <volume>33</volume>:<page-range>1077&#x2013;87</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.tcb.2023.05.003</pub-id>, PMID: <pub-id pub-id-type="pmid">37407304</pub-id></citation></ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stockwell</surname> <given-names>BR</given-names>
</name>
</person-group>. <article-title>Ferroptosis turns 10: Emerging mechanisms, physiological functions, and therapeutic applications</article-title>. <source>Cell</source>. (<year>2022</year>) <volume>185</volume>:<page-range>2401&#x2013;21</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cell.2022.06.003</pub-id>, PMID: <pub-id pub-id-type="pmid">35803244</pub-id></citation></ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lei</surname> <given-names>G</given-names>
</name>
<name>
<surname>Zhuang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Gan</surname> <given-names>B</given-names>
</name>
</person-group>. <article-title>Targeting ferroptosis as a vulnerability in cancer</article-title>. <source>Nat Rev Cancer</source>. (<year>2022</year>) <volume>22</volume>:<page-range>381&#x2013;96</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41568-022-00459-0</pub-id>, PMID: <pub-id pub-id-type="pmid">35338310</pub-id></citation></ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tyurina</surname> <given-names>YY</given-names>
</name>
<name>
<surname>Kapralov</surname> <given-names>AA</given-names>
</name>
<name>
<surname>Tyurin</surname> <given-names>VA</given-names>
</name>
<name>
<surname>Shurin</surname> <given-names>G</given-names>
</name>
<name>
<surname>Amoscato</surname> <given-names>AA</given-names>
</name>
<name>
<surname>Rajasundaram</surname> <given-names>D</given-names>
</name>
<etal/>
</person-group>. <article-title>Redox phospholipidomics discovers pro-ferroptotic death signals in A375 melanoma cells <italic>in vitro</italic> and <italic>in vivo</italic>
</article-title>. <source>Redox Biol</source>. (<year>2023</year>) <volume>61</volume>:<fpage>102650</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.redox.2023.102650</pub-id>, PMID: <pub-id pub-id-type="pmid">36870109</pub-id></citation></ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hoy</surname> <given-names>AJ</given-names>
</name>
<name>
<surname>Nagarajan</surname> <given-names>SR</given-names>
</name>
<name>
<surname>Butler</surname> <given-names>LM</given-names>
</name>
</person-group>. <article-title>Tumour fatty acid metabolism in the context of therapy resistance and obesity</article-title>. <source>Nat Rev Cancer</source>. (<year>2021</year>) <volume>21</volume>:<page-range>753&#x2013;66</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41568-021-00388-4</pub-id>, PMID: <pub-id pub-id-type="pmid">34417571</pub-id></citation></ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname> <given-names>H</given-names>
</name>
<name>
<surname>Zhuang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Gan</surname> <given-names>B</given-names>
</name>
</person-group>. <article-title>Energy stress inhibits ferroptosis via AMPK</article-title>. <source>Mol Cell Oncol</source>. (<year>2020</year>) <volume>7</volume>:<fpage>1761242</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/23723556.2020.1761242</pub-id>, PMID: <pub-id pub-id-type="pmid">32944623</pub-id></citation></ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>W-H</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Ding</surname> <given-names>C-KC</given-names>
</name>
<name>
<surname>Murphy</surname> <given-names>SK</given-names>
</name>
<name>
<surname>Chi</surname> <given-names>J-T</given-names>
</name>
</person-group>. <article-title>A TAZ&#x2013;ANGPTL4&#x2013;NOX2 axis regulates ferroptotic cell death and chemoresistance in epithelial ovarian cancer</article-title>. <source>Mol Cancer Res</source>. (<year>2020</year>) <volume>18</volume>:<fpage>79</fpage>&#x2013;<lpage>90</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/1541-7786.MCR-19-0691</pub-id>, PMID: <pub-id pub-id-type="pmid">31641008</pub-id></citation></ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hassannia</surname> <given-names>B</given-names>
</name>
<name>
<surname>Vandenabeele</surname> <given-names>P</given-names>
</name>
<name>
<surname>Vanden Berghe</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>Targeting ferroptosis to iron out cancer</article-title>. <source>Cancer Cell</source>. (<year>2019</year>) <volume>35</volume>:<page-range>830&#x2013;49</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ccell.2019.04.002</pub-id>, PMID: <pub-id pub-id-type="pmid">31105042</pub-id></citation></ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Conrad</surname> <given-names>M</given-names>
</name>
<name>
<surname>Pratt</surname> <given-names>DA</given-names>
</name>
</person-group>. <article-title>The chemical basis of ferroptosis</article-title>. <source>Nat Chem Biol</source>. (<year>2019</year>) <volume>15</volume>:<page-range>1137&#x2013;47</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41589-019-0408-1</pub-id>, PMID: <pub-id pub-id-type="pmid">31740834</pub-id></citation></ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>WS</given-names>
</name>
<name>
<surname>SriRamaratnam</surname> <given-names>R</given-names>
</name>
<name>
<surname>Welsch</surname> <given-names>ME</given-names>
</name>
<name>
<surname>Shimada</surname> <given-names>K</given-names>
</name>
<name>
<surname>Skouta</surname> <given-names>R</given-names>
</name>
<name>
<surname>Viswanathan</surname> <given-names>VS</given-names>
</name>
<etal/>
</person-group>. <article-title>Regulation of ferroptotic cancer cell death by GPX4</article-title>. <source>Cell</source>. (<year>2014</year>) <volume>156</volume>:<page-range>317&#x2013;31</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cell.2013.12.010</pub-id>, PMID: <pub-id pub-id-type="pmid">24439385</pub-id></citation></ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Meng</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Dian</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zeng</surname> <given-names>F</given-names>
</name>
<name>
<surname>Deng</surname> <given-names>G</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>X</given-names>
</name>
</person-group>. <article-title>Ferroptosis: A targetable vulnerability for melanoma treatment</article-title>. <source>J Invest Dermatol</source>. (<year>2025</year>) <volume>145</volume>:<page-range>1323&#x2013;44</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jid.2024.11.007</pub-id>, PMID: <pub-id pub-id-type="pmid">39797894</pub-id></citation></ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Drijvers</surname> <given-names>JM</given-names>
</name>
<name>
<surname>Gillis</surname> <given-names>JE</given-names>
</name>
<name>
<surname>Muijlwijk</surname> <given-names>T</given-names>
</name>
<name>
<surname>Nguyen</surname> <given-names>TH</given-names>
</name>
<name>
<surname>Gaudiano</surname> <given-names>EF</given-names>
</name>
<name>
<surname>Harris</surname> <given-names>IS</given-names>
</name>
<etal/>
</person-group>. <article-title>Pharmacologic screening identifies metabolic vulnerabilities of CD8+ T cells</article-title>. <source>Cancer Immunol Res</source>. (<year>2021</year>) <volume>9</volume>:<page-range>184&#x2013;99</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/2326-6066.CIR-20-0384</pub-id>, PMID: <pub-id pub-id-type="pmid">33277233</pub-id></citation></ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Chaudhary</surname> <given-names>O</given-names>
</name>
<name>
<surname>Rodr&#xed;guez-Morales</surname> <given-names>P</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>X</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>D</given-names>
</name>
<name>
<surname>Zappasodi</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>Uptake of oxidized lipids by the scavenger receptor CD36 promotes lipid peroxidation and dysfunction in CD8+ T cells in tumors</article-title>. <source>Immunity</source>. (<year>2021</year>) <volume>54</volume>:<fpage>1561</fpage>&#x2013;<lpage>1577.e7</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.immuni.2021.05.003</pub-id>, PMID: <pub-id pub-id-type="pmid">34102100</pub-id></citation></ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname> <given-names>C</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>S</given-names>
</name>
<name>
<surname>Johnson</surname> <given-names>T</given-names>
</name>
<name>
<surname>Qi</surname> <given-names>R</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>S</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>The glutathione peroxidase Gpx4 prevents lipid peroxidation and ferroptosis to sustain Treg cell activation and suppression of antitumor immunity</article-title>. <source>Cell Rep</source>. (<year>2021</year>) <volume>35</volume>:<fpage>109235</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.celrep.2021.109235</pub-id>, PMID: <pub-id pub-id-type="pmid">34133924</pub-id></citation></ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname> <given-names>A</given-names>
</name>
<name>
<surname>Park</surname> <given-names>H</given-names>
</name>
<name>
<surname>Lim</surname> <given-names>S</given-names>
</name>
<name>
<surname>Lim</surname> <given-names>J</given-names>
</name>
<name>
<surname>Koh</surname> <given-names>J</given-names>
</name>
<name>
<surname>Jeon</surname> <given-names>YK</given-names>
</name>
<etal/>
</person-group>. <article-title>Novel role of microphthalmia-associated transcription factor in modulating the differentiation and immunosuppressive functions of myeloid-derived suppressor cells</article-title>. <source>J Immunother Cancer</source>. (<year>2023</year>) <volume>11</volume>:<fpage>e005699</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1136/jitc-2022-005699</pub-id>, PMID: <pub-id pub-id-type="pmid">36627143</pub-id></citation></ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Casadonte</surname> <given-names>R</given-names>
</name>
<name>
<surname>Kriegsmann</surname> <given-names>M</given-names>
</name>
<name>
<surname>Kriegsmann</surname> <given-names>K</given-names>
</name>
<name>
<surname>Streit</surname> <given-names>H</given-names>
</name>
<name>
<surname>Meli&#xdf;</surname> <given-names>RR</given-names>
</name>
<name>
<surname>M&#xfc;ller</surname> <given-names>CSL</given-names>
</name>
<etal/>
</person-group>. <article-title>Imaging mass spectrometry for the classification of melanoma based on BRAF/NRAS mutational status</article-title>. <source>IJMS</source>. (<year>2023</year>) <volume>24</volume>:<fpage>5110</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms24065110</pub-id>, PMID: <pub-id pub-id-type="pmid">36982192</pub-id></citation></ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bagaev</surname> <given-names>A</given-names>
</name>
<name>
<surname>Kotlov</surname> <given-names>N</given-names>
</name>
<name>
<surname>Nomie</surname> <given-names>K</given-names>
</name>
<name>
<surname>Svekolkin</surname> <given-names>V</given-names>
</name>
<name>
<surname>Gafurov</surname> <given-names>A</given-names>
</name>
<name>
<surname>Isaeva</surname> <given-names>O</given-names>
</name>
<etal/>
</person-group>. <article-title>Conserved pan-cancer microenvironment subtypes predict response to immunotherapy</article-title>. <source>Cancer Cell</source>. (<year>2021</year>) <volume>39</volume>:<fpage>845</fpage>&#x2013;<lpage>865.e7</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ccell.2021.04.014</pub-id>, PMID: <pub-id pub-id-type="pmid">34019806</pub-id></citation></ref>
<ref id="B21">
<label>21</label>
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>B</given-names>
</name>
<name>
<surname>Khodadoust</surname> <given-names>MS</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>CL</given-names>
</name>
<name>
<surname>Newman</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Alizadeh</surname> <given-names>AA</given-names>
</name>
</person-group>. <article-title>Profiling tumor infiltrating immune cells with CIBERSORT</article-title>. In: <person-group person-group-type="editor">
<name>
<surname>Von Stechow</surname> <given-names>L</given-names>
</name>
</person-group>, editor. <source>Cancer Systems Biology</source>. <publisher-name>Springer New York</publisher-name>, <publisher-loc>New York, NY</publisher-loc> (<year>2018</year>). p. <page-range>243&#x2013;59</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/978-1-4939-7493-1_12</pub-id>, PMID: <pub-id pub-id-type="pmid">29344893</pub-id></citation></ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Langfelder</surname> <given-names>P</given-names>
</name>
<name>
<surname>Horvath</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>WGCNA: an R package for weighted correlation network analysis</article-title>. <source>BMC Bioinf</source>. (<year>2008</year>) <volume>9</volume>:<fpage>559</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1471-2105-9-559</pub-id>, PMID: <pub-id pub-id-type="pmid">19114008</pub-id></citation></ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jin</surname> <given-names>S</given-names>
</name>
<name>
<surname>Plikus</surname> <given-names>MV</given-names>
</name>
<name>
<surname>Nie</surname> <given-names>Q</given-names>
</name>
</person-group>. <article-title>CellChat for systematic analysis of cell&#x2013;cell communication from single-cell transcriptomics</article-title>. <source>Nat Protoc</source>. (<year>2025</year>) <volume>20</volume>:<fpage>180</fpage>&#x2013;<lpage>219</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41596-024-01045-4</pub-id>, PMID: <pub-id pub-id-type="pmid">39289562</pub-id></citation></ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>SChadendorf</surname> <given-names>D</given-names>
</name>
<name>
<surname>Dummer</surname> <given-names>R</given-names>
</name>
<name>
<surname>Flaherty</surname> <given-names>KT</given-names>
</name>
<name>
<surname>Robert</surname> <given-names>C</given-names>
</name>
<name>
<surname>Arance</surname> <given-names>A</given-names>
</name>
<name>
<surname>De Groot</surname> <given-names>JWB</given-names>
</name>
<etal/>
</person-group>. <article-title>COLUMBUS 7-year update: A randomized, open-label, phase III trial of encorafenib plus binimetinib versus vemurafenib or encorafenib in patients with BRAF V600E/K-mutant melanoma</article-title>. <source>Eur J Cancer</source>. (<year>2024</year>) <volume>204</volume>:<fpage>114073</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ejca.2024.114073</pub-id>, PMID: <pub-id pub-id-type="pmid">38723373</pub-id></citation></ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Atkins</surname> <given-names>MB</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>SJ</given-names>
</name>
<name>
<surname>Chmielowski</surname> <given-names>B</given-names>
</name>
<name>
<surname>Tarhini</surname> <given-names>AA</given-names>
</name>
<name>
<surname>Cohen</surname> <given-names>GI</given-names>
</name>
<name>
<surname>Truong</surname> <given-names>T-G</given-names>
</name>
<etal/>
</person-group>. <article-title>Combination dabrafenib and trametinib versus combination nivolumab and ipilimumab for patients with advanced <italic>BRAF</italic> -mutant melanoma: the DREAMseq trial&#x2014;ECOG-ACRIN EA6134</article-title>. <source>JCO</source>. (<year>2023</year>) <volume>41</volume>:<page-range>186&#x2013;97</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1200/JCO.22.01763</pub-id>, PMID: <pub-id pub-id-type="pmid">36166727</pub-id></citation></ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>VanderWalde</surname> <given-names>A</given-names>
</name>
<name>
<surname>Bellasea</surname> <given-names>SL</given-names>
</name>
<name>
<surname>Kendra</surname> <given-names>KL</given-names>
</name>
<name>
<surname>Khushalani</surname> <given-names>NI</given-names>
</name>
<name>
<surname>Campbell</surname> <given-names>KM</given-names>
</name>
<name>
<surname>Scumpia</surname> <given-names>PO</given-names>
</name>
<etal/>
</person-group>. <article-title>Ipilimumab with or without nivolumab in PD-1 or PD-L1 blockade refractory metastatic melanoma: a randomized phase 2 trial</article-title>. <source>Nat Med</source>. (<year>2023</year>) <volume>29</volume>:<page-range>2278&#x2013;85</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41591-023-02498-y</pub-id>, PMID: <pub-id pub-id-type="pmid">37592104</pub-id></citation></ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Weber</surname> <given-names>JS</given-names>
</name>
<name>
<surname>D&#x2019;Angelo</surname> <given-names>SP</given-names>
</name>
<name>
<surname>Minor</surname> <given-names>D</given-names>
</name>
<name>
<surname>Hodi</surname> <given-names>FS</given-names>
</name>
<name>
<surname>Gutzmer</surname> <given-names>R</given-names>
</name>
<name>
<surname>Neyns</surname> <given-names>B</given-names>
</name>
<etal/>
</person-group>. <article-title>Nivolumab versus chemotherapy in patients with advanced melanoma who progressed after anti-CTLA-4 treatment (CheckMate 037): a randomised, controlled, open-label, phase 3 trial</article-title>. <source>Lancet Oncol</source>. (<year>2015</year>) <volume>16</volume>:<page-range>375&#x2013;84</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S1470-2045(15)70076-8</pub-id>, PMID: <pub-id pub-id-type="pmid">25795410</pub-id></citation></ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Garbe</surname> <given-names>C</given-names>
</name>
<name>
<surname>Amaral</surname> <given-names>T</given-names>
</name>
<name>
<surname>Peris</surname> <given-names>K</given-names>
</name>
<name>
<surname>Hauschild</surname> <given-names>A</given-names>
</name>
<name>
<surname>Arenberger</surname> <given-names>P</given-names>
</name>
<name>
<surname>Basset-Seguin</surname> <given-names>N</given-names>
</name>
<etal/>
</person-group>. <article-title>European consensus-based interdisciplinary guideline for melanoma. Part 1: Diagnostics - Update 2024</article-title>. <source>Eur J Cancer</source>. (<year>2025</year>) <volume>215</volume>:<fpage>115152</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ejca.2024.115152</pub-id>, PMID: <pub-id pub-id-type="pmid">39700658</pub-id></citation></ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tan</surname> <given-names>X</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>X</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>D</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>Targeting Setdb1 in T cells induces transplant tolerance without compromising antitumor immunity</article-title>. <source>Nat Commun</source>. (<year>2025</year>) <volume>16</volume>:<fpage>4534</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-025-58841-z</pub-id>, PMID: <pub-id pub-id-type="pmid">40374612</pub-id></citation></ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tan</surname> <given-names>X</given-names>
</name>
<name>
<surname>Qi</surname> <given-names>C</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>X</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>L</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>M</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>W</given-names>
</name>
<etal/>
</person-group>. <article-title>ERK inhibition promotes engraftment of allografts by reprogramming T-cell metabolism</article-title>. <source>Adv Sci (Weinh)</source>. (<year>2023</year>) <volume>10</volume>:<fpage>e2206768</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/advs.202206768</pub-id>, PMID: <pub-id pub-id-type="pmid">37013935</pub-id></citation></ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Saleh</surname> <given-names>R</given-names>
</name>
<name>
<surname>Elkord</surname> <given-names>E</given-names>
</name>
</person-group>. <article-title>Treg-mediated acquired resistance to immune checkpoint inhibitors</article-title>. <source>Cancer Lett</source>. (<year>2019</year>) <volume>457</volume>:<page-range>168&#x2013;79</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.canlet.2019.05.003</pub-id>, PMID: <pub-id pub-id-type="pmid">31078738</pub-id></citation></ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Qin</surname> <given-names>J</given-names>
</name>
<name>
<surname>Qian</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>C</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>N</given-names>
</name>
<etal/>
</person-group>. <article-title>FFAR2 expressing myeloid-derived suppressor cells drive cancer immunoevasion</article-title>. <source>J Hematol Oncol</source>. (<year>2024</year>) <volume>17</volume>:<fpage>9</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s13045-024-01529-6</pub-id>, PMID: <pub-id pub-id-type="pmid">38402237</pub-id></citation></ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>YJ</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>The prognostic role of M2 tumor-associated macrophages in non-small-cell lung cancer</article-title>. <source>Histol Histopathol</source>. (<year>2022</year>) <volume>37</volume>:<page-range>1167&#x2013;75</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.14670/HH-18-474</pub-id>, PMID: <pub-id pub-id-type="pmid">35638244</pub-id></citation></ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Connolly</surname> <given-names>KA</given-names>
</name>
<name>
<surname>Kuchroo</surname> <given-names>M</given-names>
</name>
<name>
<surname>Venkat</surname> <given-names>A</given-names>
</name>
<name>
<surname>Khatun</surname> <given-names>A</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>J</given-names>
</name>
<name>
<surname>William</surname> <given-names>I</given-names>
</name>
<etal/>
</person-group>. <article-title>A reservoir of stem-like CD8<sup>+</sup> T cells in the tumor-draining lymph node preserves the ongoing antitumor immune response</article-title>. <source>Sci Immunol</source>. (<year>2021</year>) <volume>6</volume>:<fpage>eabg7836</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/sciimmunol.abg7836</pub-id>, PMID: <pub-id pub-id-type="pmid">34597124</pub-id></citation></ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Cao</surname> <given-names>G</given-names>
</name>
<name>
<surname>Tan</surname> <given-names>X</given-names>
</name>
<name>
<surname>Orfanos</surname> <given-names>S</given-names>
</name>
<name>
<surname>Jude</surname> <given-names>J</given-names>
</name>
<name>
<surname>Barbet</surname> <given-names>G</given-names>
</name>
<etal/>
</person-group>. <article-title>Distinct mural cells and fibroblasts promote pathogenic plasma cell accumulation in idiopathic pulmonary fibrosis</article-title>. <source>Eur Respir J</source>. (<year>2025</year>) <volume>20</volume>:<fpage>2401114</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1183/13993003.01114-2024</pub-id>, PMID: <pub-id pub-id-type="pmid">39978854</pub-id></citation></ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kakavand</surname> <given-names>H</given-names>
</name>
<name>
<surname>Jackett</surname> <given-names>LA</given-names>
</name>
<name>
<surname>Menzies</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Gide</surname> <given-names>TN</given-names>
</name>
<name>
<surname>Carlino</surname> <given-names>MS</given-names>
</name>
<name>
<surname>Saw</surname> <given-names>RPM</given-names>
</name>
<etal/>
</person-group>. <article-title>Negative immune checkpoint regulation by VISTA: a mechanism of acquired resistance to anti-PD-1 therapy in metastatic melanoma patients</article-title>. <source>Modern Pathol</source>. (<year>2017</year>) <volume>30</volume>:<page-range>1666&#x2013;76</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/modpathol.2017.89</pub-id>, PMID: <pub-id pub-id-type="pmid">28776578</pub-id></citation></ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cheng</surname> <given-names>X</given-names>
</name>
<name>
<surname>Tan</surname> <given-names>X</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>W</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>R</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Long-chain acylcarnitines induce senescence of invariant natural killer T cells in hepatocellular carcinoma</article-title>. <source>Cancer Res</source>. (<year>2023</year>) <volume>83</volume>:<page-range>582&#x2013;94</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/0008-5472.CAN-22-2273</pub-id>, PMID: <pub-id pub-id-type="pmid">36512635</pub-id></citation></ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>L</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>Z</given-names>
</name>
<name>
<surname>An</surname> <given-names>R</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Identification and validation of a prognostic model for melanoma patients with 9 ferroptosis-related gene signature</article-title>. <source>BMC Genomics</source>. (<year>2022</year>) <volume>23</volume>:<fpage>245</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12864-022-08475-y</pub-id>, PMID: <pub-id pub-id-type="pmid">35354376</pub-id></citation></ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo</surname> <given-names>S</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>J</given-names>
</name>
<name>
<surname>Yi</surname> <given-names>X</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>W</given-names>
</name>
</person-group>. <article-title>Identification and validation of ferroptosis-related lncRNA signature as a prognostic model for skin cutaneous melanoma</article-title>. <source>Front Immunol</source>. (<year>2022</year>) <volume>13</volume>:<elocation-id>985051</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2022.985051</pub-id>, PMID: <pub-id pub-id-type="pmid">36248853</pub-id></citation></ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mirza</surname> <given-names>M</given-names>
</name>
<name>
<surname>Volz</surname> <given-names>C</given-names>
</name>
<name>
<surname>Karlstetter</surname> <given-names>M</given-names>
</name>
<name>
<surname>Langiu</surname> <given-names>M</given-names>
</name>
<name>
<surname>Somogyi</surname> <given-names>A</given-names>
</name>
<name>
<surname>Ruonala</surname> <given-names>MO</given-names>
</name>
<etal/>
</person-group>. <article-title>Progressive retinal degeneration and glial activation in the CLN6nclf mouse model of neuronal ceroid lipofuscinosis: A beneficial effect of DHA and curcumin supplementation. Swaroop A, editor</article-title>. <source>PloS One</source>. (<year>2013</year>) <volume>8</volume>:<fpage>e75963</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0075963</pub-id>, PMID: <pub-id pub-id-type="pmid">24124525</pub-id></citation></ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jia</surname> <given-names>M</given-names>
</name>
<name>
<surname>Qin</surname> <given-names>D</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>C</given-names>
</name>
<name>
<surname>Chai</surname> <given-names>L</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>W</given-names>
</name>
<etal/>
</person-group>. <article-title>Redox homeostasis maintained by GPX4 facilitates STING activation</article-title>. <source>Nat Immunol</source>. (<year>2020</year>) <volume>21</volume>:<page-range>727&#x2013;35</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41590-020-0699-0</pub-id>, PMID: <pub-id pub-id-type="pmid">32541831</pub-id></citation></ref>
<ref id="B42">
<label>42</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo</surname> <given-names>X</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>H</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>R</given-names>
</name>
<name>
<surname>Zeng</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>A novel glycolysis-related signature for predicting the prognosis and immune infiltration of uveal melanoma</article-title>. <source>Ophthalmic Res</source>. (<year>2023</year>) <volume>66</volume>:<fpage>692</fpage>&#x2013;<lpage>705</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1159/000529818</pub-id>, PMID: <pub-id pub-id-type="pmid">36858025</pub-id></citation></ref>
<ref id="B43">
<label>43</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jiang</surname> <given-names>M</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>T</given-names>
</name>
<name>
<surname>Ye</surname> <given-names>G</given-names>
</name>
<name>
<surname>Hong</surname> <given-names>S</given-names>
</name>
<name>
<surname>Qi</surname> <given-names>Z</given-names>
</name>
</person-group>. <article-title>Identification of a ferroptosis-related prognostic signature and validation of ITGA6-AS1 in enhancing cell proliferation, migration and invasion in glioma</article-title>. <source>Int Immunopharmacol</source>. (<year>2024</year>) <volume>137</volume>:<fpage>112438</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.intimp.2024.112438</pub-id>, PMID: <pub-id pub-id-type="pmid">38875999</pub-id></citation></ref>
</ref-list>
</back>
</article>