Animal studies were conducted under the approval of the Institutional Animal Protection Committee (CIPA) at the Centre de recherche du Centre hospitalier de l’Université de Montréal (CRCHUM). Il22ra1^-/- mice and their wild-type (Wt) littermates, of C57BL/6N background, were rederived originally as previously described (Dr Naglaa Shoukry, CRCHUM) (17) and were bred under specific pathogen-free conditions. All mice used for these experiments were females between 8 and 10 weeks old, and they were maintained on a 12-hour light/dark cycle with unlimited access to food (Inotiv Teklad Diets, TD2018, IN, USA) and water.

Acute colitis was induced in mice by subjecting Il22ra1^-/- and Wt to 12 days of 2.5% DSS (DB001; TdB Labs, Upsala, Sweden) treatment in sterile water while the control groups received sterile water. In some experiments, Wt mice received 2.5% DSS in water for 9 days, followed by 3 days of recovery with normal drinking water. The weight of the mice was monitored daily throughout the experiments and the disease activity index (DAI) was evaluated daily by scoring based on stool consistency and rectal bleeding, using the following scale: Stool consistency (Normal =0; Loose =2; Diarrhea =4); Rectal bleeding (Normal =0; Occult blood =2; Rectal bleeding =4) (18, 19). The difference between initial and testing weights was used to determine weight loss, and the presence of persistent watery fecal material in the colon and the lack of fecal pellet development were used to characterize diarrhea. Hemoccult sensa (Beckman Coulter inc, Brea, CA 92821 USA) was used to evaluate bleeding. At day 12, mice were euthanized by intraperitoneal injection of sodium pentobarbital, followed by cervical dislocation. The feces, liver, and colon were collected in 1.5 ml tubes and snap frozen in liquid nitrogen before being transferred to -80°C for further assays.

For IL-22 treatment, mice received intraperitoneal injection of recombinant murine IL-22 (rIL-22) (Peprotech, USA) at a dosage of 1 µg/mouse on days 3, 6 and 9 of DSS treatment. Intraperitoneal injections were used to treat mice with hemopexin (Athens Research & Technology, Athens, USA) at a dosage of 5 mg/kg body weight on day 7 of DSS administration, while control mice received an injection of phosphate buffered saline (PBS). For hemin treatment, hemin was dissolved in 0.2 mol/l NaOH and adjusted to pH 7.4 using HCl before being diluted with PBS (Wisent Inc., St-Bruno, QC, Canada). Mice were injected intraperitoneally with 75 µmol/kg of hemin (Sigma-AldrichCo, St Louis, MO, USA) or the vehicle, PBS, on day 5, 8 and 10 of DSS administration.

The colorimetric method as described by (20) was used with little modification. The assay is based on the chemical conversion of non-fluorescing heme to intensely fluorescent porphyrins (21) and is specific for fecal heme (22). Firstly, colonic contents from mice were promptly snap-frozen and maintained at -80°C until diluted in water 1:1 (w/w). After homogenization, samples were centrifuged for 10 minutes at 1500 × g. 10 µl of the supernatant was then added to 200 μL of glacial acetic acid (ACP Chemicals, Montreal, QC, Canada). Afterwards, 10 μL of fresh aqueous solution of FeSO4.7H₂O (Sigma-Aldrich, (0.12 mol/l)) and HC1 (Fisherscientific, (4.5 mol/l)) was added. Following an instant 30 minute incubation period at 60°C, 50 μl of the sample was added to 100 μl of a 1:1 2-propanol/water (v/v) mixture. Finally, fluorescence was measured at 360 nm excitation and 594 nm emission.

Fecal and colon samples were first digested by adding 20–30 g to 200 µL radioimmunoprecipitation assay (RIPA) buffer containing NaCl (150 mM), NP-40 (1%), deoxycholic acid (0.50%), SDS (0.10%), Tris pH 8.0 (50 mM) and protease inhibitors (cOmplete^™, Mini, EDTA free Protease Inhibitor Cocktail Roche) and vortexed for 5 minutes to yield a homogenous suspension. This process is followed by centrifugation (12,000 × g for 10 minutes at 4°C). An aliquot of the supernatant was prepared in a new tube and stored at -20°C until analysis. Protein concentrations were quantified using Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, CA, USA). For ELISA, adequate dilutions of homogenates and serum were prepared with PBS containing 0.1% Tween 20 (reagent diluent) or as directed by the manufacturers of the kit. The mouse lipocalin (Lcn)-2/NGAL ELISA kit, (R&D Systems, Minneapolis, MN) and the ELISA Max™ standard set mouse IL-6 and tumor necrosis factor (TNF)-α kits (BioLegend, San Diego, CA, USA; Cerdalane^® distributor) were used. Hemopexin concentration was quantified using a mouse hemopexin ELISA kit (Novus Biologicals Bio-Techne, Canada), and heme-oxygenase (HO) using a mouse heme-oxygenase ELISA kit (Abcam inc, Toronto ON, Canada). A multimode microplate reader (Tecan Spark, Morrisville USA) was used to read the absorbance of the plates.

Sections of the proximal and distal colon were fixed in 10% formalin (ChapTec, Montreal, QC, Canada). The samples were then embedded in paraffin and sectioned at 4 µm-thickness. To assess the severity of colitis, the sections were stained using hematoxylin (RICCA, VWR International, Mississauga, ON) and eosin (H&E; Leica Biosystems Richmond Inc. Richmond, IL).

Total RNA was isolated with Trizol reagent (Invitrogen, Burlington, ON). A second clean-up using the Qiagen mRNA Isolation Kit (Qiagen, Hilden, Germany) was employed to further purify the mRNA in order to prevent DSS from inhibiting downstream reactions. Reverse transcription was performed with Thermoscript RT-PCR System (Invitrogen). Hemopexin (Hpx) mRNA levels were measured by real-time PCR in a Rotor Gene 3000 Real Time DNA Detection System (Montreal Biotech, Kirkland, QC) with PowerUp^TM SYBR^TM Green Master Mix for qPCR (Thermo Fisher Scientific) as described (23). Expression levels were normalized to the housekeeping gene β-actin. The following primers were used: hemopexin Forward CAGCAGTGGCGCTAAATATCC and hemopexin Reverse ACTCTCCCGTTGGCAGTAGG; β-actin Forward TGTTACCAACTGGGACGACA and β-actin Reverse GGTGTTGAAGGTCTCAAA.

Graphpad Prism (Version 10.4.1), Graphpad software, San Diego, CA, USA) was used to analyze all data. Shapiro-Wilk was used for data normality check, while F test (two variances) and Barlett’s test (multiple variances) were used to check for homogeneity of variance. When the data did not pass the Shapiro–Wilk normality test, log(Y) transformation was applied to the data. Statistical significance was determined at P values less than 0.05.

Bleeding in the colonic mucosa is commonly seen in both patients and mice with ulcerative colitis, resulting in heme accumulation in the intestine (24). As a defense mechanism against reactive heme, hemopexin is induced (14). To understand the role of IL-22 in hemopexin induction in acute colitis, mice receiving DSS in water were treated with recombinant IL-22 (rIL-22), Figure 1A ). As shown in Figure 1B , no significant differences in body weights were observed between the groups. However, compared with the vehicle-treated control mice, rIL-22 significantly decreased DAI scores during DSS treatment ( Figure 1C ).

During DSS treatment, the epithelium becomes injured, causing increased cell death, thereby leading to the shortening of the colon (18). rIL-22 treatment significantly reduced this effect, with these mice presenting longer colons than PBS-treated mice ( Figure 1D ). In addition, mice treated with rIL-22 had decreased levels of inflammatory cytokines, namely Lcn-2 ( Figure 1E ), one of the most sensitive markers of inflammation in IBD patients (25), as well as TNF-α and IL-6 ( Figures 1F, G ). Most importantly, rIL-22 treatment enhanced hemopexin levels in fecal samples, resulting in reduced heme levels ( Figures 1H, I ).

These results indicate that hemopexin is induced by IL-22, and that it has a protective effect in acute colitis, limiting DSS-induced damage of colonic epithelial cells and lessening inflammation.

To further understand the role of hemopexin induced through IL-22 signaling, we next performed experiments in Il22ra1^-/- mice ( Figure 2A ). Following DSS treatment, Il22ra1^-/- mice showed significantly more weight loss ( Figure 2B ) and higher DAI scores at the endpoint than Wt mice ( Figure 2C ). In addition, DSS-treated Il22ra1^-/- mice had significantly shorter colon lengths compared to the Wt mice ( Figure 2D ). Furthermore, DSS-treated Il22ra1^-/- mice showed significantly higher levels of fecal Lcn-2, TNF-α, and IL-6 ( Figures 2E–G ). Conversely, compared to the DSS-treated Wt mice, DSS-treated Il22ra1^-/- mice had a significantly reduced ability to induce hemopexin mRNA in the liver, thus resulting in lower hemopexin levels in the serum ( Supplementary Figures S1A, B ) and, critically, in feces ( Figure 2H ). The reduction of hemopexin in Il22ra1^-/- mice was accompanied by an increase in fecal heme levels ( Figure 2I ).

Taken together, these results underscore the importance of IL-22ra1 signaling in mediating systemic and colonic hemopexin levels and reducing colitis severity in response to DSS.

To further evaluate the importance of IL-22-dependent hemopexin induction on the severity of DSS-induced acute colitis, we treated Il22ra1^-/- mice with exogenous hemopexin ( Figure 3A ). Despite similar body weights between PBS-treated (control) and hemopexin-treated Il22ra1^-/- mice during the experiment ( Figure 3B ), colitis severity was significantly attenuated by exogenous hemopexin treatment as indicated by lower DAI scores ( Figure 3C ) and improved colonic lengths when compared to PBS treatment ( Figure 3D ). DSS-treatment caused visible changes in pathological parameters including crypt distortion, epithelial damage, ulceration, and inflammatory cell infiltration. The overall histological damage was more severe in Il22ra1^-/- compared to Wt mice, and was attenuated by hemopexin treatment ( Supplementary Figure S2 ). Consistently, hemopexin administration significantly reduced fecal Lcn-2, TNF-α, and IL-6 levels in hemopexin-treated Il22ra1^-/- mice, which showed similar levels to DSS-treated Wt mice ( Figures 3E–G ). Finally, levels of fecal hemopexin were increased after exogenous hemopexin treatment, and concordantly, fecal heme levels significantly decreased ( Figures 3H, I ).

Together, these results show that exogenous hemopexin has a protective effect in acute colitis and further indicate that hemopexin induction during colitis is dependent on IL-22ra1 signaling.

Next, we investigated the role of IL-22 in hemopexin induction (14) by treating mice with hemin, the ferric form of heme with a chloride ligand, during experimental acute colitis ( Figure 4A ). Hemin is the substrate and primary inducer of heme-oxygenase (HO-1), the rate limiting enzyme that catalyzes the breakdown of heme to carbon monoxide (CO), biliverdin and free iron (26, 27). As such, hemin has both anti-inflammatory and anti-oxidant properties (28, 29). As seen in Figure 4B , body weights remained similar among all mouse groups. However, colitis severity was significantly reduced in Wt mice that received hemin compared to Wt mice that received the vehicle, as indicated by reduced DAI scores and increased colon lengths ( Figures 4C, D ). In marked contrast, hemin treatment in Il22ra1^-/- mice failed to attenuate colitis severity ( Figures 4C, D ). In addition, while hemin caused a significant reduction in fecal Lcn-2 and IL-6 levels in both Wt and Il22ra1^-/- mice ( Figures 4E–G ), levels in hemin-treated Il22ra1^-/- mice were significantly higher than those in hemin-treated Wt mice. Consistent with these effects, HO-1 production was significantly enhanced in the colon of Wt mice, but not in IL22ra1 ^-/- mice ( Figure 4H ). While hemopexin levels were enhanced in both the Wt and Il22ra1^-/- mice that received hemin, this elevation was much more modest in Il22ra1^-/- mice ( Figure 4I ).

These results suggest that the attenuation of acute colitis by hemin treatment depends on intact IL-22ra1 signaling, involving hemopexin induction and downstream antioxidant effects through HO-1 production.