This retrospective study uses anonymized genomic data from colorectal cancer (CRC) patients, obtained from The Cancer Genome Atlas (TCGA) via the Genomic Data Commons Portal (https://portal.gdc.cancer.gov/). The clinical and genetic data for TCGA cohorts are registered under the dbGaP study accession number phs000178.v11.p8, with all datasets publicly accessible through the portal. The corresponding authors of this study are not involved in TCGA data sharing decisions.

We focused on two datasets: colon adenocarcinoma (COAD) and rectal adenocarcinoma (READ). The COAD dataset comprised 275 tumor samples and 349 normal tissues, while the READ dataset included 92 tumor samples and 318 normal tissues. FASN expression levels were compared between tumor and normal groups.

All analyses adhered to the Declaration of Helsinki and the International Ethical Guidelines for Biomedical Research Involving Human Subjects. Ethics oversight for TCGA is detailed at https://www.cancer.gov/about-nci/organization/ccg/research/structural-genomics/tcga/history/policies, and informed consent was obtained from all TCGA participants. We followed the Standards for Reporting Diagnostic Accuracy Studies (STARD) guidelines to ensure comprehensive and transparent reporting of methods and results.

CRC cell lines (CACO-2, HCT116, SW480) and normal human intestinal epithelial cells (HIEC-6) were purchased from Procell Life Science & Technology Co., Ltd. All cell lines were officially authenticated, with confirmed mycoplasma-free status and cell line identity (STR profiling). The cells were cultured in complete medium containing 10% FBS (Excel Bio, China), 90% high-glucose DMEM (Gibco, China) and 1% penicillin G-streptomycin double antibody (MACKLIN, China) at 37°C in a 5% CO₂ atmosphere. When the cell density reached over 80%, the cells were digested with 0.25% trypsin (Gibco, China) for 1 min, terminated with 5 mL of complete medium, and passaged at a 1:3 ratio. For drug treatment, fatostatin (Sigma–Aldrich, USA) was added at 40 μM post-transfection, followed by 48 h co-incubated. 2 μM fer-1 (Sigma–Aldrich, USA) was added to the cells after transfection, and the mixture was coincubated for 24 h.

HCT116 cells were seeded in 6-well plates at 1×10⁶ cells per well. A pLK0.1 vector for sh-FASN-mediated knockdown of lentivirus expression was constructed by GenePharma Co., Ltd. (GenePharma, China). A total of 125 μL of each group of plasmid vectors, including sh-NC, sh-FASN1 and sh-FASN2, was added to 125 μL of diluted Lipofectamine™ 3000 reagent (Invitrogen, USA) and incubated for 15 min to form the carrier–lipid complex, which was then transfected into the cells.

All the animal experiments were approved by the Experimental Animal Welfare Ethics Review Committee. BALB/c nude mice (male, 5 weeks old) were purchased from Yangzhou University Center for Comparative Medicine (License No. SCXK (Su) 20220009) and housed under specific pathogen-free (SPF) conditions. A subcutaneous tumorigenic model was established by injecting 0.2 mL of HCT116 cells suspension (2×10⁶ cells, transfected with sh-FASN or sh-NC) into the flanks of nude mice. During the experiment, a Vernier caliper was used to measure the tumor size every three days at the same time, and the tumor growth curve was plotted. After 4 weeks of cell inoculation, all nude mice were euthanized, and tumors were photographed. The tumor tissue was carefully removed from the nude mouse body, and the final volume and weight of the tumors were measured. The tumor tissue was divided into two parts for preservation, one for low-temperature freezing at -80°C and the other for fixation with 4% paraformaldehyde solution for subsequent detection.

The total RNA of cells cultured in a six-well plate was extracted via a Cell/Tissue Total RNA Isolation Kit V2 (Vazyme, China), and purified RNA was obtained after chloroform phase separation, precipitation, and washing. The RNA concentration and purity were detected via a Nano 600 (Jiapeng, China), and RNA samples with A260/280 ratios between 1.9 and 2.1 were obtained as follows. cDNA was subsequently obtained with a HiScript lll 1st Strand cDNA Synthesis Kit (Vazyme, China). Next, a real-time quantitative PCR system including Taq Pro Universal SYBR qPCR Master Mix (Vazyme, China) was prepared, and the results were detected via a CFX96 Touch 185555195 real-time fluorescence quantitative PCR instrument (Bio-Rad, USA) according to the following procedure: predenaturation at 95°C for 10 min, denaturation at 95°C for 15 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, and a cycle count of 40; melting curve: 95°C for 15 s, 60°C for 60 s, and 95°C for 15 s. Relative primer (Shanghai Sangon Co., Ltd.) sequences were as follows: FASN (Forward: GTGTACGCCACCATCCTGAA; Reverse: CTGGTACAACGAGCGGATGA); β-actin (Forward: GGGACCTGACTGACTACCTC; Reverse: TCATACTCCTGCTTGCTGAT). The results were calculated via the 2^-ΔΔCt method. The expression of FASN was normalized to that of β-actin.

The expression levels of FASN and SREBP2 were detected via western blot analysis. Briefly, total protein was extracted via RIPA lysis buffer (Beyotime, China), and a BCA kit (NCM Biotech, China) was used to determine the protein concentration. The loading volume was determined with 20 μg as the loading amount. SDS–PAGE was used to separate proteins, which were then transferred to PVDF membranes (Millipore, USA). Next, after being blocked with 5% skim milk powder (BD, USA), the membrane was incubated with FASN polyclonal antibody (Proteintech, China), SREBP2 monoclonal antibody (Proteintech, China) and β-actin antibody (Bioss, China) overnight at 4°C. The corresponding secondary antibodies, including goat anti-rabbit IgG H&L/HRP or goat anti-mouse IgG H&L/HRP (Bioss, China), were incubated at room temperature for 1 h the next day after the membranes were washed. Finally, a chemiluminescence imaging system (Tanon, China) was used for development, and the results were analyzed via ImageJ software for grayscale analysis.

Cell proliferation ability was detected via a CCK8 Kit (Bioss, China). Logarithmically growing cells were collected. After counting, the cell suspension concentration was adjusted, and the cells were inoculated into a 96-well plate at a density of 2×10³ cells/well. In accordance with the instructions, 10 μL of CCK8 solution was added, and the mixture was incubated with the cells for 2 h. Absorbance at 450 nm was determined via an RT-6000 microplate reader (Rayto, China). Cell proliferation was expressed as the cell survival rate. The calculation formula was as follows: cell survival rate (%) = (OD value (sample) - OD value (PBS))/(OD value (control group) - OD value (PBS)) × 100%.

HCT116 cells whose FASN gene was successfully knocked down or treated with fatostatin were inoculated at a density of 1000 cells/well into a 6-well plate and cultured in a cell culture incubator for 14 d. Then, the cells were fixed with 4% paraformaldehyde (Beyotime, China) for 20 min and stained with 0.2% crystal violet (Sigma–Aldrich, USA) for 5 min. After washing and drying, the cells were photographed. The calculation formula was as follows: colony formation rate= number of clones/number of inoculated cells × 100%.

HCT116 cells were inoculated at a density of 1 × 10⁶ cells/well into a 6-well plate and incubated for 4 h. After adhering to the well, drug addition or transfection was performed. When the cells had grown to greater than 90% confluence, the tip of the pipette was used to press the line marked on the back of the plate vertically, causing scratches. The results were observed under a microscope, and the size of the cell scratch at 0 h was recorded, which was recorded again after 24 h of cultivation.

One hundred microliters of the HCT116 cell suspension at a density of 1–5 × 10⁵ cells/mL was added to a Transwell chamber lined with matrix gel, and 600 μL of culture medium containing 10% FBS was added to the lower chamber. For the fatostatin drug treatment group, the same concentration of fatostatin was added to the upper and lower chambers and further cultivated in a culture incubator for 24 h. After being washed with PBS, 4% paraformaldehyde was added to fix the cells for 10 min. Then, the upper chamber was removed, the fixation solution in the lower chamber was discarded, and crystal violet staining solution was added. The small chamber was placed in the staining solution for 10 min. After dyeing, the upper chamber was washed with a large amount of water and dried naturally. Finally, the results were observed under a microscope, and photos were taken.

The apoptosis rate of HCT116 cells was detected with an Annexin V-FITC kit (Beyotime, China). After growing to cover the monolayer bottle wall, the digested cells were centrifuged and resuspended at 1000 rpm for 5 min. Then, preprepared 1 × annexin V binding solution was added to prepare a cell suspension with a final concentration of 1×10⁶ cells/mL. Then, 5 μL of Annexin V-FITC complex and 5 μL of PI solution were added to 100 μL of the cell suspension and incubated at room temperature in the dark for 15 min. Next, 400 μL of 1 × Annexin V binding solution was added. Finally, the fluorescence was detected within 1 h via Attune NxT flow cytometry (Invitrogen, USA), and the results were analyzed via Flow Jo software.

Serum-free culture medium was prepared from DMEM/F12 (Gibco, China), 2% B27 (Gibco, China), epidermal growth factor (EGF; Sigma–Aldrich, USA), and fibroblast growth factor (bFGF; Sigma–Aldrich, USA). The cells were inoculated at a density of 1000 cells per well into a low-adhesion 6-well plate. After appropriate treatment was performed as needed, 3 mL of serum-free culture medium was added, and the mixture was incubated for 14 d. The results were observed and counted under a microscope.

The HCT116 cell suspension was centrifuged at 800 rpm for 5 min. After washing with 2 mL of PBS, the suspension was centrifuged again at 800 rpm for 5 min. After being resuspended in PBS, the cells were detected with a mouse anti-CD44/FITC-conjugated antibody and a rabbit anti-CD133/PE-conjugated antibody (Bioss, China) for detection via Attune NxT flow cytometry.

MDA, 4-HNE, total cholesterol and free cholesterol in cell supernatants were detected using respective kits. Briefly, logarithmic phase cell supernatants were centrifuged at 12,000×g (10 min, 4°C) for MDA/4-HNE or 10,000×g (15 min, 4°C) for cholesterol, then stored at -80°C. Standards were diluted: MDA (0-32 μmol/L with distilled water), 4-HNE (per kit instructions), cholesterol (0-3.2 mmol/L with diluent). Chromogenic reagents (TBA for MDA, 4-HNE chromogen, TC/FC reagents and enzyme working solution) were equilibrated to room temperature. MDA detection: 50 μL samples/standards/water + 150 μL TBA, boiled 30 min, ice-cooled 10 min, centrifuged (3,000×g, 10 min, 4°C), absorbance measured at 532 nm. 4-HNE detection: 96-well plate with samples/standards + chromogen, incubated at specified temperature, absorbance read at designated wavelength (e.g., 450 nm). Cholesterol-related detection: For total cholesterol detection, add 50 μL sample/standard/diluent (blank) and 150 μL chromogenic mixture (A+B) to each well, incubate at 37°C in the dark for 15 min; for free cholesterol detection, add 50 μL sample/standard/diluent and 150 μL enzyme working solution to each well, incubate at 37°C in the dark for 20 min, and measure the absorbance at 550 nm for both. Standard curves (concentration vs. absorbance) were used to calculate contents. Experiments were triplicated independently, with means used for analysis.

The detection of the cellular Fe²⁺ content was performed following the instructions of the E-BC-K773-M ferrous ion colorimetric test kit (Elabscience, China). The OD value was measured at 593 nm via an RT-6000 microplate reader.

The HCT116 cells were washed with 200 μL of PBS. The MitoSOX™ Red reagent (MSR) stock solution and working solution were prepared as follows. First, the MSR reagent (Invitrogen, USA) was dissolved in 13 µL of DMSO to produce a 5 mM MSR reagent stock solution. Then, 5 µL of 5 mM MSR stock solution was added to 50 mL of PBS to prepare a 500 nM working solution. The cells were incubated and stained with 2 mL of 500 nM MSR reagent for 30 min. Finally, within 2 h of staining, an EVOS M5000 fluorescence microscope (Thermo Fisher, USA) was used to select absorption and emission wavelengths of 396 nm and 610 nm for imaging.

A JC-1 fluorescent probe (Beyotime, China) was used to detect the mitochondrial membrane potential in the cells. The JC-1 working solution was prepared according to the reagent kit method. After the cells were washed with PBS, JC-1 working solution was added to cover the cell surface for staining, and the mixture was incubated at 37°C for 15 min. The cells were examined via an EVOS M5000 fluorescence microscope after being washed with PBS once more, and the staining solution was removed. The mitochondrial membrane potential increases as the red/green fluorescence intensity ratio increases.

The ROS content was detected via the use of a DCFH-DA fluorescent probe (Beyotime, China). DCFH-DA was diluted in serum-free culture medium at a ratio of 1:1000 to a final concentration of 10 µmol/L and incubated with the cells in a cell culture incubator for 20 min. The cells were washed three times with serum-free cell culture medium to fully remove the DCFH-DA that had not entered the cells. After the cells were digested and detached, an appropriate amount of culture medium was added to make a suspension of the cells, which were transferred to a centrifuge tube and then centrifuged at 1000 rpm for 5 min. Detection was performed by flow cytometry within 30 min at an excitation wavelength of 488 nm and an emission wavelength of 525 nm.

The experimental data are presented as the means ± SEMs, and all the data were processed and statistically analyzed via GraphPad Prism 8. ANOVA was used to compare the sample means of numerous groups, and t tests were used to compare the sample means of the two groups. A significant difference was indicated by a P value less than 0.05.

Initially, we examined the expression levels of Fatty Acid Synthase (FASN) in CRC utilizing data from The Cancer Genome Atlas (TCGA) (reference 36). Our analysis revealed an upregulation of FASN expression in patients with both colon adenocarcinoma and rectal cancer, thereby providing preliminary support for our hypothesis ( Figure 1A ). To further validate these findings, we selected three CRC cell lines (CACO-2, HCT116, SW480) alongside normal human intestinal epithelial cells (HIEC-6) for additional analysis. Real-time PCR and Western blot assays demonstrated significantly elevated FASN expression in the CRC cell lines compared to HIEC-6 cells, with the highest expression observed in HCT116 cells ( Figures 1B–D ). Consequently, HCT116 cells were chosen for subsequent experiments.

The development of three-dimensional (3D) tumor spheres has been employed to assess the CSC-related characteristics of solid tumors in vitro (37). To investigate the potential role of FASN in human colorectal CSCs, HCT116 cells were cultured using a 3D spheroidization approach ( Figure 2A ). Subsequently, real-time PCR was conducted to measure FASN expression in the tumor spheroids, revealing a significant upregulation of FASN in the spheroid cells ( Figure 2B ). Flow cytometry was then utilized to isolate CD133⁺CD44⁺ cells, indicative of CSC properties, and CD133^-CD44^- cells, representative of typical cancer cell characteristics, from HCT116 cells ( Figure 2C ). Consistent with expectations, FASN expression was markedly higher in CD133⁺CD44⁺ cells ( Figure 2D ). The impact of FASN on in vitro spheroid formation and in vivo tumor transplantation models was further evaluated through FASN knockdown. Following FASN downregulation, a significant reduction in the number of spherical cells was observed ( Figure 2E ). Moreover, in the sh-FASN group, the size, volume, and weight of the tumors were substantially diminished, accompanied by an increased tumor inhibition rate ( Figures 2F–I ). Additionally, the quantity of CD44⁺CD133⁺ cells was significantly reduced as a consequence of FASN silencing ( Figure 2J ). Collectively, these results indicate that FASN is highly expressed in colorectal CSCs and is crucial for maintaining CSC characteristics, promoting spheroid formation, in vivo tumor growth, and preserving the CD133⁺CD44⁺ CSC population, thus contributing to CRC progression.

To determine the biological role of FASN in CRC cells, a sh-FASN plasmid was transfected into HCT116 cells to stably knock down FASN, and Western blot was used to verify the transfection ( Supplementary Figure S1A ). To further confirm the effect of FASN on cholesterol metabolism, we then examined the expression of sterol-regulatory element binding protein 2 (SREBP2), a key transcription factor that affects cholesterol metabolism by regulating the expression of key enzymes involved in cholesterol synthesis. In comparison with sh-NC group, the expression levels of total cholesterol and free cholesterol in the sh-FASN1 group were significantly decreased ( Supplementary Figure S1B ). Western blot assays and quantitative analysis ( Supplementary Figures S1C ) revealed that sh-FASN increased the protein expression of f-SREBP2 and n-SREBP2, while decreasing the expression of FASN. These findings indicate that FASN is associated with abnormal cholesterol accumulation in CRC.

A series of rescue experiments utilizing fatostatin, a specific inhibitor of SREBP activation was conducted to investigate the role of FASN in CRC progression through its regulation of cholesterol metabolism. As anticipated, treatment with fatostatin resulted in a significant reduction in the protein expression levels of f-SREBP2 and n-SREBP2 forms of SREBP2, thereby confirming its inhibitory impact on SREBP2 activation ( Figure 3A ). In colony formation assays, the knockdown of FASN (sh-FASN1) led to a substantial decrease in the colony formation rate of HCT116 cells. However, co-treatment with fatostatin effectively mitigated this reduction, thereby restoring the cells’ colony-forming capacity ( Figure 3B ). Similarly, Cell Counting Kit-8 (CCK-8) assays demonstrated that sh-FASN1 significantly inhibited the proliferation of HCT116 cells, while co-treatment with fatostatin counteracted this inhibitory effect and promoted cell proliferation ( Figure 3C ). In wound healing assays, the knockdown of FASN impaired the migratory ability of HCT116 cells, but this impairment was alleviated by fatostatin, which restored the cells’ migratory potential ( Figure 3D ). Consistently, Transwell assays revealed that sh-FASN1 inhibited the invasive capacity of HCT116 cells, and this inhibitory effect was reversed upon treatment with fatostatin ( Figure 3E ). Furthermore, flow cytometry analysis revealed that FASN knockdown increased the apoptosis rate of HCT116 cells ( Figure 3F ). Taken together, these results indicate that FASN is involved in the malignant progression of CRC cells. More importantly, the ability of fatostatin to reverse the phenotypic changes induced by FASN knockdown confirms that FASN promotes CRC development by inhibiting the activation of the cholesterol metabolism regulator SREBP2, and thus inhibition of FASN impairs CRC progression by releasing this inhibitory effect on SREBP2.

Both total cholesterol and free cholesterol were decreased by FASN knockdown, which were increased by fatostatin ( Figure 4A ). We then determined the effect of FASN on ferroptosis in CRC. Colorimetric assay with biochemical kits revealed that FASN knockdown elevated the level of intracellular ferrous ions, but fatostatin reduced the content of ferrous ions which was up-regulated by sh-FASN transfection ( Figure 4B ). Ferroptosis mainly occurs in mitochondria and is characterized by mitochondrial destruction. Thus, we next evaluated the influence of sh-FASN and fatostatin on mitochondrial function and oxidative stress. Sh-FASN significantly increased the content of mitochondrial superoxide in cells ( Figure 4C ). Moreover, JC-1 fluorescence probe staining revealed that sh-FASN enhanced green fluorescence and weakened red fluorescence, indicating a decrease in the mitochondrial membrane potential (MMP) ( Figure 4D ). As illustrated by flow cytometry, sh-FASN also notably increased the content of intracellular ROS ( Figure 4E ). However, fatostatin reduced the intracellular superoxide and ROS, and increased the MMP. Consistent with the ferroptosis phenotype, Western blot analysis revealed a significant reduction in GPX4 protein expression in sh-FASN compared to sh-NC. Notably, Fatostatin exhibited a partial rescue of GPX4 expression ( Figure 4F ). The malondialdehyde (MDA) content, a marker of lipid peroxidation, was significantly elevated in sh-FASN group compared to sh-NC. Conversely, sh-FASN + Fatostatin showed a marked reduction in MDA levels. The content of 4-HNE, another lipid peroxidation product, showed the same trend ( Figure 4G ). These results indicate that FASN knockdown can promote ferroptosis by enhancing lipid peroxidation, while SREBP inhibition can partially reverse this effect.

We conducted rescue experiments using the ferroptosis inhibitor fer-1 to further explore the relationship between FASN regulation of cholesterol metabolism and ferroptosis. As shown in Figure 5A , compared with the sh-FASN1 group, fer-1 treatment abrogated FASN silencing-induced changes in the expression levels of f-SREBP2, and n-SREBP2. Furthermore, fer-1 significantly attenuated FASN silencing-mediated decrease in cholesterol content in HCT116 cells ( Figure 5B ), reduction in the content of ferrous ions ( Figure 5C ), and increase in the content of intracellular ROS ( Figure 5D ) and the mitochondrial membrane potential levels ( Figure 5E ). These findings collectively demonstrate that fer-1 treatment abrogates FASN silencing-mediated alterations in cholesterol metabolism and ferroptosis-related indicators in CRC cells, confirming FASN as a critical regulatory factor for cholesterol metabolism and ferroptosis in CRC cells. Co-immunoprecipitation (CO-IP) assays were performed to investigate whether FASN directly interacts with SREBP2. HCT116 cells overexpressing Flag-tagged FASN were lysed, and the cell lysates were incubated with Flag magnetic beads. Western blot analysis of the immunoprecipitated complexes showed that SREBP2 was co-precipitated with Flag-FASN ( Figure 5F ). In contrast, no SREBP2 signal was detected in the negative control group using IgG magnetic beads, confirming the specificity of the interaction. These results demonstrate that FASN directly binds to SREBP2 in HCT116 cells.