<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2025.1600863</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Immunology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Revealing the significance of tissue-resident memory T cells in lung adenocarcinoma through bioinformatic analysis and experimental validation</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Li</surname>
<given-names>Zhuoqi</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2259219/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Tian</surname>
<given-names>Mei</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Yang</surname>
<given-names>Yuanhui</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2833666/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Wang</surname>
<given-names>Yuanyuan</given-names>
</name>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Lu</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Huang</surname>
<given-names>Fujing</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wen</surname>
<given-names>Xiao</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2579257/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Yin</surname>
<given-names>Xiaoshu</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Lin</surname>
<given-names>Xiaoyan</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="aff" rid="aff5">
<sup>5</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3088535/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Tian</surname>
<given-names>Yuan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/776443/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Department of Radiotherapy Oncology, Affiliated Hospital of Shandong University of Traditional Chinese Medicine</institution>, <addr-line>Jinan</addr-line>,&#xa0;<country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Department of Respiratory and Critical Care Medicine, Affiliated Hospital of Shandong University of Traditional Chinese Medicine</institution>, <addr-line>Jinan</addr-line>,&#xa0;<country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Department of Pathology, Shandong Provincial Hospital, Shandong University</institution>, <addr-line>Jinan</addr-line>,&#xa0;<country>China</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>Department of Oncology, The Second Affiliated Hospital of Shandong University of Traditional Chinese Medicine</institution>, <addr-line>Jinan, Shandong</addr-line>,&#xa0;<country>China</country>
</aff>
<aff id="aff5">
<sup>5</sup>
<institution>Department of Pathology, Shandong Provincial Hospital Affiliated to Shandong First Medical University</institution>, <addr-line>Jinan</addr-line>,&#xa0;<country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Anand Rotte, Arcellx Inc, United States</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Hanjie Li, Chinese Academy of Sciences (CAS), China</p>
<p>Chao Yang, St. Jude Children&#x2019;s Research Hospital, United States</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Xiaoyan Lin, <email xlink:href="mailto:linxiaoyanyan@163.com">linxiaoyanyan@163.com</email>; Yuan Tian, <email xlink:href="mailto:tytytianyuan@aliyun.com">tytytianyuan@aliyun.com</email>
</p>
</fn>
<fn fn-type="equal" id="fn003">
<p>&#x2020;These authors have contributed equally to this work</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>26</day>
<month>06</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2025</year>
</pub-date>
<volume>16</volume>
<elocation-id>1600863</elocation-id>
<history>
<date date-type="received">
<day>27</day>
<month>03</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>12</day>
<month>06</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Li, Tian, Yang, Wang, Zhang, Huang, Wen, Yin, Lin and Tian</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Li, Tian, Yang, Wang, Zhang, Huang, Wen, Yin, Lin and Tian</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Purpose</title>
<p>To investigate the functions of lung T<sub>RM</sub> cells in the development and treatment of lung adenocarcinoma (LUAD).</p>
</sec>
<sec>
<title>Methods</title>
<p>R-language bioinformatics analysis was applied to obtain differentially expressed (DE) lung T<sub>RM</sub> cell-specific genes and a related prognostic signature, which were further validated using external datasets, immunohistochemical staining images, and biological experiments.</p>
</sec>
<sec>
<title>Results</title>
<p>A total of 130 DE lung T<sub>RM</sub> cell-specific genes were identified, 14 of which were involved in the prognostic signature, including <italic>SLC16A3</italic>, <italic>ARHGAP11A</italic>, <italic>PTTG1</italic>, <italic>DTL</italic>, <italic>GPRIN1</italic>, <italic>EXO1</italic>, <italic>GAPDH</italic>, <italic>TYMS</italic>, <italic>DAPK2</italic>, <italic>CCL20</italic>, <italic>HLA-DQA1</italic>, <italic>ADAM12</italic>, <italic>ALOX5AP</italic> and <italic>OASL</italic>. The signature was efficient and robust in predicting the overall survival and anti-PD-1/PD-L1 immunotherapeutic outcomes of patients with LUAD. The AUCs for predicting the 1-, 3-, and 5-year survival rates were 0.688, 0.698, and 0.648, respectively, in the training cohort, and were 0.867, 0.662, and 0.672, respectively, in the validation cohort. The signature also had predictive value for the sensitivity of patients to chemical drugs. <italic>TYMS</italic> was a hub gene in the prognostic signature, and was strongly associated with LUAD progression and cell proliferation in the experimental validation.</p>
</sec>
<sec>
<title>Conclusions</title>
<p>The lung T<sub>RM</sub> cell-related prognostic signature is an effective tool for predicting the prognosis and therapeutic outcomes of patients with LUAD.</p>
</sec>
</abstract>
<kwd-group>
<kwd>T<sub>RM</sub> cells</kwd>
<kwd>LUAD</kwd>
<kwd>prognostic signature</kwd>
<kwd>immunotherapeutic outcomes</kwd>
<kwd>TYMS</kwd>
</kwd-group>
<counts>
<fig-count count="12"/>
<table-count count="1"/>
<equation-count count="1"/>
<ref-count count="59"/>
<page-count count="22"/>
<word-count count="9936"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Cancer Immunity and Immunotherapy</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Tissue-resident memory T (T<sub>RM</sub>) cells are a special subpopulation of memory T cells that were recently discovered to reside in non-lymphoid tissues without entering the bloodstream (<xref ref-type="bibr" rid="B1">1</xref>). T<sub>RM</sub> cells can reside in a wide range of tissues, including epithelial barrier tissues, such as the lungs, gastrointestinal tract, and skin, as well as non-barrier tissues, such as the brain, kidneys, and joints (<xref ref-type="bibr" rid="B2">2</xref>&#x2013;<xref ref-type="bibr" rid="B4">4</xref>). T<sub>RM</sub> cells are also found in many types of tumor tissues, such as lung cancer, breast cancer, intestinal cancer, ovarian cancer, and melanoma tissues, and they play important roles in anti-tumoral immunology (<xref ref-type="bibr" rid="B5">5</xref>&#x2013;<xref ref-type="bibr" rid="B9">9</xref>). The infiltration of T<sub>RM</sub> cells is a favorable factor for the prognosis of cancer patients, and the abundance of CD103<sup>+</sup>CD8<sup>+</sup>T cells in tumor tissues is correlated with increased disease-free survival and overall survival in patients with lung, breast, endometrial, and ovarian cancers (<xref ref-type="bibr" rid="B10">10</xref>). However, the underlying mechanisms are not well understood.</p>
<p>Recently, it has been demonstrated that T<sub>RM</sub> cells in different organs and tissue sites are specific and play different roles (<xref ref-type="bibr" rid="B11">11</xref>). Through the integration of single-cell protein and transcriptome analyses, T<sub>RM</sub> cell-specific genes associated with major barrier sites in the human body, such as the lungs, skin, and jejunum, were identified, and these T<sub>RM</sub> cell-specific genes were closely related to the specific functions of each organ (<xref ref-type="bibr" rid="B11">11</xref>). Whether the T<sub>RM</sub> cell-specific genes of an organ can regulate T<sub>RM</sub> cells to exert specific immune responses against tumors at that tissue site is a question that needs to be addressed.</p>
<p>Lung cancer remains one of the most prevalent cancers worldwide and causes the most cancer-related deaths (<xref ref-type="bibr" rid="B12">12</xref>). Lung adenocarcinoma (LUAD) is a type of non-small-cell lung cancer that accounts for the highest percentage of lung cancer cases. LUAD is often accompanied by both genomic and morphological abnormalities. However, its pathogenesis is not well understood, and more effective treatments are currently being explored (<xref ref-type="bibr" rid="B13">13</xref>, <xref ref-type="bibr" rid="B14">14</xref>). The tumor immune microenvironment (TME) is an important cause of heterogeneity in lung adenocarcinoma and can influence disease progression and the response to therapy (<xref ref-type="bibr" rid="B15">15</xref>). T<sub>RM</sub> cells are important components of the tumor microenvironment, and the infiltration of CD103<sup>+</sup>CD8<sup>+</sup>T<sub>RM</sub> cells into the tumor microenvironment has been reported to be a favorable prognostic factor for patients with LUAD (<xref ref-type="bibr" rid="B16">16</xref>&#x2013;<xref ref-type="bibr" rid="B20">20</xref>). However, the underlying mechanisms have not yet been elucidated.</p>
<p>Although the role of T<sub>RM</sub> cells in lung cancer immunomodulation and immunotherapy has been partially reported in some studies, research methods have been limited mostly to experiments on cells and animals, and there are few reports on the use of bioinformatics methods to explore novel biomarkers that can regulate the functions of T<sub>RM</sub> cells and potentially become predictive and therapeutic biomarkers. In this study, the lung T<sub>RM</sub> cell-specific genes identified in previous studies were subjected to bioinformatics analysis in many LUAD samples to identify novel potential biomarkers related to the prognosis, TME landscape, and immunotherapy of patients with LUAD. The functions of key genes in LUAD were validated using <italic>in vitro</italic> experiments. These findings may help elucidate the roles of T<sub>RM</sub> cells in LUAD and identify novel biomarkers for personalized prediction and treatment of LUAD.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Data collection and preprocessing</title>
<p>The R package &#x201c;TCGAbiolinks&#x201d; was used to download the log-transformed FPKM expression profiles and clinical information from the TCGA-LUAD dataset. A total of 497 tumor samples with both expression data and survival information were retained for the construction of the prognostic signature. The GSE41271 and GSE42127 bulk expression datasets were downloaded from the Gene Expression Omnibus (GEO) database (<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/geo/">https://www.ncbi.nlm.nih.gov/geo/</ext-link>) and were used to validate the prognostic signature. The data processing standard of the GEO bulk expression dataset was as follows: the probes were converted to gene symbols according to the probe correspondence with the platform. If one probe corresponded to multiple genes, the probe was removed, and if multiple probes corresponded to the same symbol, the median value was taken. Single-cell RNA-seq data were obtained from the GSE131907 dataset of the GEO database. Fifteen primary LUAD samples from the GSE131907 dataset were used for the analyses. The clinical and transcriptomic data of the GSE126044 and GSE135222 cohorts, in which NSCLC patients were treated with the PD-1/PD-L1 blockade, were downloaded from the GEO database and used to evaluate the predictive efficacy of the prognostic signature. A total of 480 lung T<sub>RM</sub> cell-specific genes were obtained from a previous publication (<xref ref-type="bibr" rid="B11">11</xref>).</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Identification of differentially expressed lung T<sub>RM</sub> cell-related genes</title>
<p>The R package &#x201c;limma&#x201d; was used to identify the differentially expressed genes (DEGs) between LUAD and adjacent normal tissues, with thresholds set at |log2FC|&#x2265;1 and FDR&lt;0.05. The DEGs intersecting with the lung T<sub>RM</sub> cell-specific genes were regarded as differentially expressed (DE) T<sub>RM</sub> cell-related genes and were chosen for subsequent analysis.</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Construction of protein-protein interaction networks (PPIs) for DE lung T<sub>RM</sub> cell-related genes</title>
<p>The interactive relationships of the lung T<sub>RM</sub> cell-related genes were acquired from the STRING database (<ext-link ext-link-type="uri" xlink:href="https://www.string-db.org/">https://www.string-db.org/</ext-link>), and a protein-protein interaction (PPI) was constructed based on this information.</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Functional enrichment of the DE lung T<sub>RM</sub> cell-specific genes</title>
<p>The R package &#x201c;clusterProfiler&#x201d; was applied for the functional annotation of the DE lung T<sub>RM</sub> cell-related genes, with the p-value cutoff set at 0.05. Functional enrichment analysis was performed to predict the potential biological functions of these genes.</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Construction of the lung T<sub>RM</sub>-related prognostic signature</title>
<p>Univariate Cox regression analysis was used to determine the hazard ratios (HR) and prognostic significance. Genes with p values &lt; 0.05 were prognosis-associated genes. Least Absolute Shrinkage and Selection Operator (LASSO) regression analysis was applied to further identify key prognostic factors, and a risk score model for predicting survival was constructed by weighting the expression of each key prognostic gene with LASSO regression coefficients (&#x201c;exp&#x201d; represents the expression level of the genes, and &#x201c;coef&#x201d; represents the Cox regression coefficient):</p>
<disp-formula>
<mml:math display="block" id="M1">
<mml:mrow>
<mml:mtext>Risk&#xa0;score</mml:mtext>
<mml:mo>=</mml:mo>
<mml:mo>&#x2211;</mml:mo>
<mml:mtext>exp</mml:mtext>
<mml:mo>&#x2217;</mml:mo>
<mml:mtext>coef</mml:mtext>
</mml:mrow>
</mml:math>
</disp-formula>
<p>The patients were divided into high-risk and low-risk groups based on the median risk score. The &#x201c;Kaplan-Meier&#x201d; method was used to generate survival curves for the prognostic analysis, and the &#x201c;log-rank&#x201d; test was used to evaluate the significance of the differences in overall survival between groups. The receiver operating characteristic (ROC) curve was used to assess the predictive efficacy of the prognostic models. The R package &#x201c;timeROC&#x201d; was used to visualize the &#x201c;area under the curve&#x201d; (AUC). Univariate and multivariate Cox regression analyses were performed to evaluate the independent predictive value of the prognostic model.</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Evaluation of the TME landscape</title>
<p>The &#x201c;ESTIMATE&#x201d; algorithm was used to calculate the immunity score, stroma score, and tumor purity for each tumor sample, and then the &#x201c;Wilcoxon&#x201d; test was subsequently used to compare the differences in the immunity score, stroma score, and tumor purity among different subgroups of samples. The correlations between the risk score and the immunity score, stroma score, and tumor purity were calculated using Spearman analysis. Single-sample gene set enrichment analysis (ssGSEA) was used to evaluate the relative abundance of each infiltrating cell in the TME. The gene sets of the 28 types of immune cells used in the analysis were obtained from a previous publication (<xref ref-type="bibr" rid="B21">21</xref>). The R packages &#x201c;GSVA&#x201d; and &#x201c;GSEABase&#x201d; were used to compare the differences in biological pathways and immune functions.</p>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Prediction of drug sensitivity</title>
<p>The &#x201c;calcPhenotype&#x201d; function of the R package &#x201c;oncoPredict&#x201d; was used to assess the IC50 values of the samples for the drugs. The correlation coefficients between the risk score, the expression of genes included in the prognostic model, and the drug IC50 values were calculated using Spearman analysis.</p>
</sec>
<sec id="s2_8">
<label>2.8</label>
<title>Quality control for the scRNA-seq data</title>
<p>The R package &#x201c;Seurat&#x201d; (version 4.1.0) was used for quality control of the scRNA-seq data. To exclude some low-quality cells and genes expressed at low levels, we set the thresholds as follows (1): each gene was expressed in at least three cells (2); the number of features per cell was between 500 and 6000, and the number of counts per cell was between 1000 and 20,000; and (3) the number of mitochondrial and erythrocyte genes was less than 20% of the total number of genes in each cell. Next, the &#x201c;NormalizeData&#x201d; function was used for normalization, and the &#x201c;FindVariableFeatures&#x201d; function was used to identify highly variable genes on the basis of their average expression values (greater than 0.1 and less than 3) and dispersion (greater than 0.5). The R package &#x201c;Harmony&#x201d; was used to perform batch correction between the samples to avoid batch effects interfering with downstream analysis. The data were then scale transformed and downscaled via principal component analysis (PCA), and the top 50 principal components were selected for downstream analysis and visualized via the &#x201c;RunTSNE&#x201d; function.</p>
</sec>
<sec id="s2_9">
<label>2.9</label>
<title>Identification of the subtypes of malignant tumor cells</title>
<p>Malignant cells in which at least two model genes were detected were selected for subsequent analysis. After standardization, normalization, identification of highly variable genes, removal of batch effects and PCA, the first 50 principal components were selected at a resolution of 0.1. Three subtypes of tumor cells were subsequently identified by clustering and grouping again. The marker genes of each subtype of tumor cells were identified via the &#x201c;FindAllMarkers&#x201d; function (avg_log2fc &gt; 0.25, p_val_adj &lt; 0.05). The CellScore was calculated based on the genes included in the prognostic model via the &#x201c;AddModuleScore&#x201d; function of the &#x201c;Seurat&#x201d; package. The malignant cells were divided into high and low groups based on the median cell score.</p>
</sec>
<sec id="s2_10">
<label>2.10</label>
<title>Trajectory analysis and cellular communication analysis</title>
<p>The R package &#x201c;monocle2&#x201d; was used to conduct the trajectory analysis of the tumor cells. Different states reflect the internal transformation of tumor cells. The R package &#x201c;CellChat&#x201d; was used to analyze the communication between tumor cells and other cells.</p>
</sec>
<sec id="s2_11">
<label>2.11</label>
<title>Validation of the expression levels of genes via immunohistochemical staining images</title>
<p>The expression levels of the genes included in the lung T<sub>RM</sub> cell-related prognostic model were validated at the protein level using immunohistochemical staining images from the Human Protein Atlas database (<ext-link ext-link-type="uri" xlink:href="https://www.proteinatlas.org/">https://www.proteinatlas.org/</ext-link>). The staining intensity levels of each gene in normal lung tissues and LUAD tissues were observed and compared.</p>
</sec>
<sec id="s2_12">
<label>2.12</label>
<title>Clinical sample collection and immunohistochemistry</title>
<p>Lung adenocarcinoma samples were collected from the pathology department of Shandong Provincial Hospital from 2017 to 2021. Written informed consent was obtained from all participants. Tumor tissues were obtained from excised biopsies, fixed in formalin and embedded in paraffin (FFPE) for histological evaluation. After paraffin wax removal and rehydration, the sections were placed in citrate antigen retrieval solution and boiled for 15 minutes for antigen retrieval. An endogenous peroxidase blocker was then added to block the endogenous peroxidase activity in the sections. After incubation at room temperature for 30 min, 50 &#xb5;L of goat serum working solution was added to each sample, which was subsequently incubated at 37&#xb0;C for 20 min to block nonspecific staining. The sections were subsequently incubated with a primary antibody (rabbit anti-thymidylate synthase antibody, 1:100, ab108995, Abcam) for 1 h at 37&#xb0;C. After 3&#x2009;&#xd7;&#x2009;5-minute washes with PBS, the sections were incubated with a biotinylated secondary antibody at room temperature for 30 min, followed by subsequent washes (3&#x2009;&#xd7;&#x2009;5 min in PBS). The sections were subsequently dried with absorbent paper and incubated with 50 &#xb5;L horseradish peroxidase-labeled streptavidin for 20 min at 37&#xb0;C. The sections were then rinsed with PBS for 3&#x2009;&#xd7;&#x2009;5 min each. After immunostaining, the sections were visualized using an MBMbio Intelligence 400 scanner according to the manufacturer&#x2019;s protocol. The slides were independently examined by two experienced pathologists according to the WHO criteria. The expression levels of each gene were characterized using a scoring system. The staining intensity was graded into four levels: 0, no positive staining (negative), 1 point for light yellow (weakly positive), 2 points for brownish yellow (positive); and 3, dark brown (strongly positive). The percentage of positive cells was also classified into four levels: 1 point was given when it was &#x2264;25%, 2 points when it ranged from 26% to 50%, 3 points when it was between 51% and 75%, and 4 points when it was &gt;75%. The final scoring results were obtained by multiplying the scores of the above two items. Based on the results, the samples were divided into four grades: negative expression (0 points), low expression (1&#x2013;4 points), moderate expression (5&#x2013;8 points) and high expression (9&#x2013;12 points).</p>
</sec>
<sec id="s2_13">
<label>2.13</label>
<title>Cell lines and culture</title>
<p>The human cell line, H1395, was purchased from the National Laboratory Cell Resource Sharing Platform (Beijing, China) at the beginning of this study, with STR authentications. H1395 cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 100 U/mL penicillin/streptomycin (Invitrogen, Carlsbad, CA, USA) at 37&#xb0;C in a humidified incubator with 5% CO<sub>2</sub>.</p>
</sec>
<sec id="s2_14">
<label>2.14</label>
<title>siRNA design and transfection</title>
<p>The siRNA oligo sequences (5&#x2019;-3&#x2019;) against <italic>TYMS</italic> mRNAs (si-<italic>TYMS</italic>-1#: sense, GGGAUUCUCCACCAGAGAATT; antisense, UUCUCUGGUGGAGAAUCCCTT; si-<italic>TYMS</italic>-2#: sense, CCAACUGCAAAGAGUGAUUTT; antisense, AAUCACUCUUUGCAGUUGGTT) were synthesized by GenePharma Co. (Shanghai, China). H1395 cells were transfected with the siRNAs using Omifection-R (OMIGET, China) siRNA transfection reagent according to the manufacturer&#x2019;s instructions when the cells reached a confluence of 60&#x2013;80% confluence. The successful knockdown of <italic>TYMS</italic> expression was confirmed by quantitative RT-PCR (qRT-PCR) and western blotting 48 h post-transfection. Scramble siRNAs (sense: 5&#x2019;-UUCUCCGAACGUGUCACGUTT-3&#x2019;; antisense: 5&#x2019;-ACGUGACACGUUCGGAGAATT-3&#x2019;) were used as negative controls.</p>
</sec>
<sec id="s2_15">
<label>2.15</label>
<title>RNA extraction and quantitative real-time PCR</title>
<p>The total RNA of the cell lines was isolated using the Total RNA Isolation kit (TRIcom Reagent) of GenStone Biotech and then reverse-transcribed into cDNA using TransScript First-Strand cDNA Synthesis SuperMix (TransGen Biotech, China) according to the manufacturer&#x2019;s instructions. Next, qRT-PCR was performed using the FastStart Universal SYBR Green Master (ROX) (Roche, Germany) on an ABI-7500 Fast system (Applied Biosystems). <italic>ALU</italic> was used as the endogenous reference gene for the cultured cell lines. Each sample was analyzed quantitatively in six replicates. The relative expression levels of these genes were determined using the &#x394;&#x394;Ct method. The differences in target gene expression between different groups were analyzed using the Kruskal-Wallis test and plotted using GraphPad Prism 10.1.2. P &lt; 0.05 was considered statistically significant (***indicates p &lt; 0.001). The primer sequences are shown in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>The sequences of the primers used in the study.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">
<italic>TYMS</italic>
</th>
<th valign="top" align="left">Sequence (5&#x2019; &#x2192; 3&#x2032;)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">Forward Primer</td>
<td valign="top" align="left">GTGTGCCTTTCAACATCGCC</td>
</tr>
<tr>
<td valign="top" align="left">Reverse Primer</td>
<td valign="top" align="left">GGGTTCTCGCTGAAGCTGAAT</td>
</tr>
<tr>
<th valign="top" align="left">
<italic>ALU</italic>
</th>
<th valign="top" align="left">Sequence (5&#x2019; &#x2192; 3&#x2032;)</th>
</tr>
<tr>
<td valign="top" align="left">Forward Primer</td>
<td valign="top" align="left">GAGGCTGAGGCAGGAGAATCG</td>
</tr>
<tr>
<td valign="top" align="left">Reverse Primer</td>
<td valign="top" align="left">GTCGCCCAGGCTGGAGTG</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_16">
<label>2.16</label>
<title>Western blotting</title>
<p>Total protein was extracted from cultured cells using RIPA buffer. Primary polyclonal antibodies against <italic>TYMS</italic> (15047-1-AP, ProteinTech) and <italic>&#x3b2;-Actin</italic> (66009-1-Ig, ProteinTech) were used at dilutions of 1:3,000 and 1:20,000, respectively. The signals were visualized using an enhanced chemiluminescence kit (Millipore) and an Alpha Imager system.</p>
</sec>
<sec id="s2_17">
<label>2.17</label>
<title>Assessment of cell proliferation with IncuCyte</title>
<p>The long-term dynamic proliferation of the H1395 cells was observed using a long-term dynamic observation platform (IncuCyte, Essen, MI, USA). The cells were seeded into 96-well plates (3000 cells per well, six wells per group) and cultured for 120 h to generate proliferation curves. The cells were photographed every 24 h on the platform and analyzed using IncuCyte ZOOM software (Essen, Ann Arbor, MI, USA).</p>
</sec>
<sec id="s2_18">
<label>2.18</label>
<title>Statistical analysis</title>
<p>All analyses were performed using R software (version 4.4.2). For significance analysis between various values (such as expression levels, infiltration ratios, and various eigenvalues), the Wilcoxon rank-sum test was applied to compare the differences between two groups of samples, and the Kruskal-Wallis test was used to compare the differences between multiple groups of samples. For the plot presentation, ns indicates p &gt; 0.05, * indicates p &lt; 0.05, ** indicates p &lt; 0.01, *** indicates p &lt; 0.001, and **** indicates p &lt; 0.0001. Survival curves for the prognostic analysis were generated using the Kaplan-Meier method, and the significance of the differences was determined using the log-rank test.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Identification of DE lung T<sub>RM</sub> cell-specific genes</title>
<p>A flow chart of the study is shown in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>. To assess whether the expression of lung T<sub>RM</sub>-cell-specific genes affects tumorigenesis and tumor progression in LUAD, differential expression analysis was performed in LUAD and adjacent normal tissues. First, 1002 downregulated genes and 741 upregulated genes in tumor tissues were screened (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2A, B</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table&#xa0;1</bold>
</xref>), including 130 lung T<sub>RM</sub> cell-specific genes (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM2">
<bold>Supplementary Table&#xa0;2</bold>
</xref>). Protein-protein interaction network (PPI) analysis results revealed extensive interactions among the DE lung T<sub>RM</sub> cell-specific genes, and the node connectivity of the <italic>RRM2</italic>, <italic>CDK1</italic>, <italic>CCNA2</italic> and <italic>EXO1</italic> genes was relatively high, which may indicate that these genes play a dominant role in the regulatory network (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>The flow chart of this study.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1600863-g001.tif">
<alt-text content-type="machine-generated">Flowchart depicting the analysis process of lung TRM cells specific genes in LUAD. Includes differential expression, prognostic signature construction, single-cell RNA data analysis, and validation with protein data. Features various graphs and charts illustrating cell group identification, interaction analysis, prognostic efficacy, immunotherapy guidance, clinical characteristics association, and TYMS gene verification with histological images and Western blot results.</alt-text>
</graphic>
</fig>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Identification of the lung T<sub>RM</sub> cell-related genes that were differentially expressed between LUAD and adjacent normal tissues. <bold>(A)</bold> Volcano plot showing the DEGs between LUAD and adjacent normal tissues. The red dots represent the upregulated genes with log2FC&#x2009;&#x2265;&#x2009;1 and FDR &lt;&#x2009;0.05, whereas the green dots represent downregulated genes with log2FC&#x2009;&#x2264;&#x2009;-1 and FDR&#x2009;&lt;&#x2009;0.05. <bold>(B)</bold> Heatmap of the DEGs. The upper horizontal axis denotes the cluster analysis of each sample. The blue color indicates adjacent normal tissues, whereas the red color indicates tumor tissues. The left longitudinal axis indicates the cluster analysis of the DEGs. The blue and red blocks represent relatively low and high expression, respectively. <bold>(C)</bold> Venn diagram showing the intersecting genes among the DEGs and the T<sub>RM</sub> cell-related genes in the lung. <bold>(D)</bold> The PPI network of the intersecting genes among the DEGs and the lung T<sub>RM</sub> cell-related genes. <bold>(E1)</bold> KEGG pathway, <bold>(E2)</bold> GO biological process, <bold>(E3)</bold> GO molecular function and <bold>(E4)</bold> GO cellular component enrichment analyses of the intersecting genes. FC, fold change; FDR, false discovery rate; DEGs, differentially expressed genes.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1600863-g002.tif">
<alt-text content-type="machine-generated">A set of scientific charts and diagrams related to gene expression analysis. Panel A shows a volcano plot depicting upregulated and downregulated genes. Panel B features a heatmap comparing gene expression in normal versus tumor samples. Panel C presents a Venn diagram illustrating shared and unique differentially expressed genes. Panel D displays a network graph of gene interactions. Panels E1 to E4 contain dot plots representing KEGG pathways and Gene Ontology categories: Biological Process (E2), Molecular Function (E3), and Cellular Component (E4), with dot size and color indicating significance.</alt-text>
</graphic>
</fig>
<p>The results of functional enrichment analysis revealed that the DE lung T<sub>RM</sub> cell-specific genes were significantly enriched in biological processes such as cell cycle regulation and chromosome segregation and were significantly associated with functions such as MHC class II molecule receptor activity, antigen binding, and immune receptor activity (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2E1&#x2013;E4</bold>
</xref>), suggesting that these genes are related to T<sub>RM</sub> cells.</p>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Construction and validation of the lung T<sub>RM</sub>-related prognostic signature</title>
<p>To investigate the clinical value of the DE lung T<sub>RM</sub> cell-specific genes, a lung T<sub>RM</sub> cell-related prognostic signature was constructed and validated. First, a univariate Cox regression analysis was performed. There were 62 genes associated with overall patient survival, and the top 20 genes with the greatest significance are shown in <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM3">
<bold>Supplementary Table&#xa0;3</bold>
</xref>. The KM curves of the top six genes with the lowest p-values are presented in (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3B1&#x2013;B6</bold>
</xref>). Least absolute shrinkage and selection operator (LASSO) regression analysis was subsequently conducted to further investigate the clinical significance of these genes. The trajectory of each independent variable was obtained (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>), and as the lambda gradually increased, the number of independent variable coefficients gradually decreased to zero (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>). Ten-fold cross-validation was used to build the model, and the confidence intervals for each lambda value are shown in <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3D</bold>
</xref>. Fourteen genes were identified when the model was optimized. Therefore, we selected the 14 genes for the subsequent analyses and constructed a risk score model based on their coefficients and expression levels of the 14 genes (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3E</bold>
</xref>). The formula for calculating the risk-score model is as follows:</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Construction of the lung T<sub>RM</sub> cell-related prognostic model. <bold>(A)</bold> Forest plot showing the top 20 lung T<sub>RM</sub> cell-related prognostic genes identified via univariate Cox regression analysis. The left column of each panel shows the p value of each gene, and the right column shows the corresponding forest plot. <bold>(B)</bold> The KM survival curves of the top 6 prognostic genes in the univariate Cox regression analysis: <italic>CCNA2</italic> <bold>(B1)</bold>, <italic>CDK1</italic> <bold>(B2)</bold>, <italic>FAM83D</italic> <bold>(B3)</bold>, <italic>ASPM</italic> <bold>(B4)</bold>, <italic>NUSAP1</italic> <bold>(B5)</bold> and <italic>SLC16A3</italic> <bold>(B6)</bold>. The abscissa axis shows the survival time, whereas the ordinate axis shows the survival probability. The blue color represents low expression, whereas the red color represents high expression of each gene. The risk table is presented under the KM survival curves of each gene. <bold>(C)</bold> Scatter plot showing the trajectory of each independent variable. The abscissa axis represents the log value of the independent variable lambda. The vertical axis indicates the coefficient of the independent variable. <bold>(D)</bold> Dynamic process diagram of variables screened by LASSO regression analysis and selection process diagram of the cross-validation parameter lambda. <bold>(E)</bold> Coefficient of each gene included in the prognostic model.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1600863-g003.tif">
<alt-text content-type="machine-generated">Panel A displays a forest plot showing hazard ratios and p-values for various variables. Panels B1 to B6 present Kaplan-Meier survival curves comparing high and low expression groups for six genes, with hazard ratios and confidence intervals. Panel C is a line plot illustrating coefficients against log lambda values, while Panel D shows a partial likelihood deviance plot with error bars. Panel E is a bar graph of gene coefficients, with both positive and negative values represented.</alt-text>
</graphic>
</fig>
<p>Score = <italic>SLC16A3</italic> * (0.128) + <italic>ARHGAP11A</italic> * (0.031) + <italic>PTTG1</italic> * (0.020) +<italic>DTL</italic> * (0.025) + <italic>GPRIN1</italic> * (0.044) + <italic>EXO1</italic> * (0.018) + <italic>GAPDH</italic> * (0.128) + <italic>TYMS</italic> * (0.039) + <italic>DAPK2</italic> * (-0.023) + <italic>CCL20</italic> * (0.038) + <italic>HLA-DQA1</italic> * (-0.076) +<italic>ADAM12</italic> * (0.010) + <italic>ALOX5AP</italic> * (-0.040) + <italic>OASL</italic> * (0.014).</p>
<p>Using the 14-gene risk score model, the samples in the TCGA-LUAD training cohort were divided into high- and low-risk groups according to the median risk score. Overall survival analysis revealed that the OS of patients in the high-risk group was significantly lower than that of patients in the low-risk group in both the training cohort (TCGA-LUAD) (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>) and the two validation cohorts: GSE41271 (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4D</bold>
</xref>) and GSE42127 (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4G</bold>
</xref>). The ROC curve revealed that the AUCs of the patients at 1, 3, and 5 years were relatively high (0.688, 0.698, and 0.648, respectively) in the training cohort (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>). The AUCs of patients at 1, 3, and 5 years were 0.649, 0.638, and 0.646, respectively, in validation cohort GSE41271 (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4E</bold>
</xref>). The AUCs of the patients at 1, 3, and 5 years were 0.867, 0.662, and 0.672, respectively, in validation cohort GSE42127 (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4H</bold>
</xref>). To test whether the risk score model was an independent prognostic factor for LUAD patients, we performed univariate and multivariate Cox regression analyses via the &#x201c;coxph()&#x201d; function in the R package &#x201c;survival&#x201d;. In all the training and validation cohorts, the risk score was an independent prognostic factor among other clinical features, such as age, sex, and tumor stage (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4C, F, I</bold>
</xref>). These results demonstrated that the 14-gene prognostic signature based on the DE lung T<sub>RM</sub> cell-specific genes had strong prognostic efficacy with high robustness and generalizability.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Validation of the predictive efficacy of the lung T<sub>RM</sub> cell-related prognostic model in the training cohort: <bold>(A&#x2013;C)</bold> TCGA-LUAD cohort and in the validation cohorts: <bold>(D&#x2013;F)</bold> GSE41271 and <bold>(G&#x2013;I)</bold> GSE42127. <bold>(A, D, G)</bold> KM survival curves of patients in the low- and high-risk score groups in the TCGA-LUAD cohort, GSE41271 cohort and GSE42127 cohort, respectively. The blue color represents patients in the low-risk score group, whereas the red color represents patients in the high-risk score group. The risk table is presented under the KM survival curves of each gene. <bold>(B, E, H)</bold> ROC curves for predicting the 1-, 3-, and 5-year survival of patients according to the risk score in the TCGA-LUAD cohort, GSE41271 cohort and GSE42127 cohort, respectively. The abscissa axis represents specificity, and the vertical axis represents sensitivity. Different colors represent different predictive times. <bold>(C, F, I)</bold> Univariate and multivariate Cox regression analyses of the prognostic model in the TCGA-LUAD cohort, GSE41271 cohort and GSE42127 cohort, respectively. The upper forest plot in each panel is the result of univariate Cox regression analysis, whereas the lower plot is the result of multivariate Cox regression analysis. In each forest plot, the variables are listed on the left of each panel. The hazard ratio of each variable and the corresponding forest plot are in the middle of each panel. The p values of the corresponding variables are shown on the right.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1600863-g004.tif">
<alt-text content-type="machine-generated">Image containing three sets of data panels with survival analysis and ROC curves for different datasets. Panels A, D, and G show Kaplan-Meier survival curves comparing low and high score groups, with hazard ratios and p-values. Panels B, E, and H display corresponding ROC curves with AUC values at one, three, and five years. Panels C, F, and I include forest plots detailing hazard ratios across variables like score, sex, stage, and age, with p-values and confidence intervals. Each set is labeled with associated dataset names such as TCGA and GSE in the captions.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Association between the T<sub>RM</sub> cell-related prognostic signature and clinicopathologic features</title>
<p>The associations between the T<sub>RM</sub>-related prognostic signature and patients&#x2019; clinicopathological features were further analyzed. The results revealed that the proportions of patients aged &lt;60 years, with advanced-stage disease, and with a history of smoking was significantly greater in the high-risk score group than in the low-risk score group (p &lt; 0.05). The proportions of patients of different sexes, <italic>ALK</italic> rearrangements, <italic>EGFR</italic> mutations, and <italic>KRAS</italic> mutations did not significantly differ between the high- and low-risk score groups (<xref ref-type="supplementary-material" rid="SF1">
<bold>Supplementary Figure&#xa0;1</bold>
</xref>). Patients aged &lt;60 years, with advanced-stage disease, male sex, and a history of smoking had significantly higher risk scores than the other groups of patients, and there was no significant difference in the risk scores for patients with <italic>EGFR</italic> mutations or <italic>KRAS</italic> mutations (<xref ref-type="supplementary-material" rid="SF2">
<bold>Supplementary Figure&#xa0;2</bold>
</xref>).</p>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>Depiction of the TME landscape via the prognostic signature</title>
<p>To further explore the functions of lung-specific T<sub>RM</sub> cells in the TME of LUAD, gene set enrichment analysis (GSEA) and immune cell infiltration analysis were conducted in the high- and low-risk score groups of patients. The results revealed that signaling pathways, such as P53, B-cell receptor, and MAPK, were significantly activated in the low-risk score group (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM4">
<bold>Supplementary Table&#xa0;4</bold>
</xref>), and immune-related biological processes, such as T-cell activation, proliferation, and B-cell activation, were also significantly activated in the low-risk score group (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM4">
<bold>Supplementary Table&#xa0;4</bold>
</xref>). Further analysis of immune cell infiltration revealed that the infiltration of immune cells, such as activated B cells, activated CD8<sup>+</sup>T cells, central memory CD4<sup>+</sup>T cells, central memory CD8<sup>+</sup>T cells, and effector memory CD8<sup>+</sup>T cells, was significantly greater in the low-risk score group (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>). These results demonstrate that patients in the low-risk score group had stronger antitumor immunity and greater infiltration of T<sub>RM</sub> cells, which may be the reason for their longer survival time. The ESTIMATE, immunity, and stroma scores were significantly greater in the low-risk score group, whereas the tumor purity was significantly greater in the high-risk score group (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5D1&#x2013;D4</bold>
</xref>). Next, the expression levels of the immune checkpoint genes were compared between the high- and low-risk score groups. The results revealed that the expression levels of several immune checkpoint genes, including <italic>CD276</italic> and <italic>LAG3</italic>, were significantly different between the two groups (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5E</bold>
</xref>). These findings suggest the possibility of exploring novel targets for immunotherapy.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Correlation between the risk score and the immune landscape. <bold>(A)</bold> Pathways that are activated in different risk score groups according to KEGG GSEA enrichment analysis of bulk RNA-seq data. <bold>(B)</bold> Pathways that were activated in different risk score groups according to the GO-BP enrichment analysis of the bulk RNA-seq data. The abscissa axis represents the ranked gene list according to their expression levels in the two groups. The vertical axis represents the running enrichment score. Curves of different colors represent different pathways. <bold>(C)</bold> Relative abundances of the 28 types of immune cells in the low-risk score and high-risk score groups. The abscissa axis represents the names of the immune cells. The vertical axis represents the infiltration fraction. <bold>(D)</bold> Box plots showing the ESTIMATE score <bold>(D1)</bold>, immune score <bold>(D2)</bold>, stromal score <bold>(D3)</bold> and tumor purity <bold>(D4)</bold> in the low- and high-risk score groups. <bold>(E)</bold> Expression levels of immune checkpoint genes in the low-risk score and high-risk score groups. The abscissa axis shows the gene names, and the vertical axis shows the relative expression levels of these genes.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1600863-g005.tif">
<alt-text content-type="machine-generated">Graphs and charts depicting data analysis related to signaling pathways and biological processes. Graph A shows KEGG signaling pathways with various colored lines for different pathways. Graph B illustrates GO biological processes with colored lines. Graph C provides box plots comparing low and high scores for immune cell populations. Graphs D1 to D4 display box plots for ESTIMATE Score, Immune Score, Stroma Score, and Tumor Purity, respectively. Graph E shows a comprehensive set of box plots comparing low and high scores across multiple variables.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_5">
<label>3.5</label>
<title>Validation of the predictive efficacy of the prognostic model at the single-cell level</title>
<p>A total of 51935 cells, including 4827 B lymphocytes, 635 endothelial cells, 10998 epithelial cells, 1764 fibroblasts, 1735 MAST cells, 9098 myeloid cells, 22878 T/NK cells, and 27578 cells, were detected in the GSE131907 scRNA-seq cohort (<xref ref-type="supplementary-material" rid="SF3">
<bold>Supplementary Figure&#xa0;3</bold>
</xref>). The PCA results revealed that there was a significant batch effect between samples (<xref ref-type="supplementary-material" rid="SF4">
<bold>Supplementary Figures&#xa0;4A, B</bold>
</xref>), and the batch effect between samples was removed via the R package &#x201c;Harmony&#x201d; (<xref ref-type="supplementary-material" rid="SF4">
<bold>Supplementary Figures&#xa0;4C, D</bold>
</xref>). The distribution of different cell types was determined via UMAP analysis (<xref ref-type="supplementary-material" rid="SF4">
<bold>Supplementary Figure&#xa0;4E</bold>
</xref>), and heterogeneity in the distribution of cells among the samples was detected (<xref ref-type="supplementary-material" rid="SF4">
<bold>Supplementary Figure&#xa0;4F</bold>
</xref>).</p>
<p>A total of 3906 malignant tumor cells with at least two model genes detected were extracted for subsequent analyses. These malignant cells were renormalized and clustered, and three subtypes of malignant cells were identified (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6A, B1&#x2013;B3</bold>
</xref>). These cell subtypes were defined according to the genes that were highly expressed in the clusters, and these three subtypes were named <italic>IFI27</italic>
<sup>+</sup>Mal, <italic>FBXO2</italic>
<sup>+</sup>Mal and <italic>HMGB2</italic>
<sup>+</sup>Mal (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6A, B1&#x2013;B3</bold>
</xref>). With the &#x201c;FindAllMarkers&#x201d; function, we identified the marker genes of each cell subtype (<xref ref-type="supplementary-material" rid="SM5">
<bold>Supplementary Table&#xa0;5</bold>
</xref>), and the top 5 marker genes of each cell subtype are shown in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>. <italic>FBXO2</italic>
<sup>+</sup>Mal highly expressed genes such as <italic>CXCL14</italic>, <italic>TNNC2</italic> and <italic>ASS1</italic>, which were significantly enriched in biological processes such as the regulation of the apoptosis signaling pathway and peptidase activity (<xref ref-type="supplementary-material" rid="SF5">
<bold>Supplementary Figure&#xa0;5A</bold>
</xref>). <italic>HMGB2</italic>
<sup>+</sup>Mal highly expressed genes such as <italic>STMN1</italic>, <italic>TUBA1B</italic> and <italic>UBE2C</italic>, which were significantly enriched in biological processes such as the regulation of cell adhesion, leukocyte migration and leukocyte chemotaxis (<xref ref-type="supplementary-material" rid="SF5">
<bold>Supplementary Figure&#xa0;5B</bold>
</xref>). <italic>IFI27</italic>
<sup>+</sup>Mal highly expressed genes such as <italic>SFTPA2</italic>, <italic>SFTPA1</italic> and <italic>SCGB3A1</italic>, which were significantly enriched in biological processes such as the regulation of cell adhesion, leukocyte migration and leukocyte chemotaxis (<xref ref-type="supplementary-material" rid="SF5">
<bold>Supplementary Figure&#xa0;5C</bold>
</xref>).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Calculation of the risk score at the single-cell level in LUAD. <bold>(A)</bold> TSNE plot showing the three subtypes of malignant tumor cells. Different colors represent different cell subtypes. <bold>(B)</bold> TSNE plots showing the expression levels of the marker genes in the three subtypes of malignant tumor cells: <italic>IFI27</italic> <bold>(B1)</bold>, <italic>FBXO2</italic> <bold>(B2)</bold> and <italic>HMGB2</italic> <bold>(B3)</bold>. <bold>(C)</bold> Bubble diagram presenting the expression of the top 5 marker genes of the three subtypes of malignant cells. The abscissa axis shows the gene names, and the vertical axis shows the names of the cell subtypes. Yellow indicates high expression, whereas yellow indicates low expression. The bubble size represents the percentage of each gene expressed in each subtype of cell. <bold>(D)</bold> The TSNE plot showing the cell score for each malignant cell. Blue represents a low score, whereas red represents a high score. <bold>(E)</bold> Violin plot showing the cell scores of three subtypes of malignant cells. The abscissa axis shows the cell names, and the vertical axis shows the CellScore. <bold>(F)</bold> The TSNE plot shows that the single cells were divided into high- and low-CellScore groups. <bold>(G)</bold> Proportion of different subtypes of malignant cells in the high- and low-cell groups. The abscissa represents the cell name, and the vertical axis represents the proportion.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1600863-g006.tif">
<alt-text content-type="machine-generated">A series of plots analyzing cell data. Panel A: t-SNE plot differentiating subtypes FBXO2+Mal (red), HMGB2+Mal (blue), and IFI27+Mal (green). Panels B1-B3: t-SNE plots showing expression of IFI27, FBXO2, and HMGB2, colored by expression levels. Panel C: Dot plot displaying average expression and percent expression for features correlated with subtype identities. Panel D: t-SNE plot indicating cell scores, with a color gradient from red (higher) to blue (lower). Panel E: Violin plot showing distribution of cell scores among subtypes. Panel F: t-SNE plot categorizing cells into high (red) and low (blue) groups. Panel G: Bar chart comparing cell group proportions across subtypes.</alt-text>
</graphic>
</fig>
<p>The CellScore of each malignant tumor cell line was calculated via the &#x201c;AddModuleScore&#x201d; function (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6D</bold>
</xref>), and the malignant tumor cells were divided into high- and low-CellScore groups (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6F</bold>
</xref>). Among the three cell subtypes, <italic>FBXO2</italic>
<sup>+</sup>Mal and <italic>HMGB2</italic>
<sup>+</sup>Mal had higher CellScores (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6E</bold>
</xref>), and the CellGroup was high (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6G</bold>
</xref>). GSEA of the cells in high- and low-CellScore groups revealed that immune-related biological processes, such as T-cell migration and the B-cell receptor signaling pathway, were also significantly activated in the low-CellScore group (<xref ref-type="supplementary-material" rid="SF6">
<bold>Supplementary Figure&#xa0;6</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM6">
<bold>Supplementary Table&#xa0;6</bold>
</xref>).</p>
<p>Trajectory analysis of the extracted malignant epithelial cells revealed three differentiation states (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7A</bold>
</xref>). In the trajectory from State1 to State2 cells, the <italic>IFI27</italic>
<sup>+</sup>Mal subpopulation decreased significantly, whereas the <italic>HMGB2</italic>
<sup>+</sup>Mal subpopulation increased significantly (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7D</bold>
</xref>). In the State1 to State3 cell trajectories, the proportion of the <italic>FBXO2</italic>
<sup>+</sup>Mal subpopulation increased, but the <italic>HMGB2</italic>
<sup>+</sup>Mal subpopulation also increased (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7D</bold>
</xref>). In the trajectory from State1 to State2, there was no significant increase in the CellScore. However, in the trajectory from State1 to State3, there was a significant increase in the CellScore (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7B, C</bold>
</xref>) and an increase in the proportion of high-cell groups (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7E, F</bold>
</xref>). This suggests that the malignancy of the tumor cells increased from low to high in the trajectory.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Trajectory analysis of malignant tumor cells. <bold>(A)</bold> Distribution of the three differentiation states of malignant cells. Different colors represent different states. <bold>(B)</bold> Distribution of malignant cells with different cell scores according to the differentiation trajectory. Different colors represent different cell scores. <bold>(C)</bold> Violin plot showing the cell scores in different states of the cell differentiation trajectory. <bold>(D)</bold> Distribution of the three subtypes of cells according to the cell differentiation trajectory. Different colors represent different cell subtypes. <bold>(E)</bold> Distribution of different cell groups according to the cell differentiation trajectory. Red represents a high CellScore, whereas blue represents a low CellScore. <bold>(F)</bold> Distribution of low- and high-cell groups in different cell differentiation states. Red represents the high-CellScore group, whereas blue represents the low-CellScore group.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1600863-g007.tif">
<alt-text content-type="machine-generated">Panel of graphs analyzing cell states and groups:  A. Three scatter plots of components one and two, colored by cell state. B. Scatter plot showing cell score gradient. C. Violin plots of cell scores across states. D. Scatter plots colored by cell subtype. E. Scatter plot contrasting high and low cell groups. F. Bar chart depicting cell group distribution across states.</alt-text>
</graphic>
</fig>
<p>To further analyze the differences in physiological activity between high- and low-neoplastic populations, cell-to-cell communication was analyzed via the &#x201c;CellChat&#x201d; package. Extensive cellular communication was observed between the cell populations (<xref ref-type="supplementary-material" rid="SF7">
<bold>Supplementary Figure&#xa0;7A</bold>
</xref>). High neoplastic cells were more likely to be outgoing signaling-dominant senders than low neoplastic cells (<xref ref-type="supplementary-material" rid="SF7">
<bold>Supplementary Figure&#xa0;7B</bold>
</xref>), and different cell populations were found to have outgoing signaling patterns in different biological pathways (<xref ref-type="supplementary-material" rid="SF7">
<bold>Supplementary Figures&#xa0;7C, D</bold>
</xref>). Compared with low neoplastic patients, high neoplastic patients exhibited specific cellular communication in the CSF and KIT signaling pathways (<xref ref-type="supplementary-material" rid="SF7">
<bold>Supplementary Figures&#xa0;7E, F</bold>
</xref>).</p>
</sec>
<sec id="s3_6">
<label>3.6</label>
<title>Lung T<sub>RM</sub>-related prognostic model for the treatment of LUAD</title>
<p>The IC50 values of the drugs in the training cohort were predicted using the R package &#x201c;oncoPredict&#x201d; via the use of the drug information from the GDSC database combined with the expression profiles of the training set. Spearman correlation analysis was performed between the prognostic signature and the log2(IC50) value for each drug (<xref ref-type="supplementary-material" rid="SM7">
<bold>Supplementary Table&#xa0;7</bold>
</xref>). Patients in the high-risk group had a poorer prognosis; therefore, the top six drugs with the most significant negative correlations were selected according to the absolute values of the correlation coefficients. The six drugs used were AZD6738_ 1917, BI.2536_1086, docetaxel_1007, docetaxel_1819, MK.1775_179, and paclitaxel_1080 (p&lt;0.05). The log2(IC50) values of these six drugs were lower in the high-risk score group than those in the low-risk score group and had greater sensitivity (<xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8A1&#x2013;A6</bold>
</xref>). The Spearman correlation coefficients between the risk scores and drug log2 (IC50) values were also calculated, and the top 50 drugs were selected for display, which revealed that there was a correlation between gene expression levels and most of the drug log2 (IC50) values (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8B</bold>
</xref>).</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>The predictive efficacy of the prognostic model for chemotherapy and immunotherapy. <bold>(A)</bold> Box plots showing the log2(IC50) values of the six drugs that had the highest negative correlation with the risk score in the high- and low-score groups: AZD6738_1917 <bold>(A1)</bold>, BI.2536_1086 <bold>(A2)</bold>, Docetaxel_1007 <bold>(A3)</bold>, Docetaxel_1819 <bold>(A4)</bold>, MK.1775_1179 <bold>(A5)</bold> and Paclitaxel_1080 <bold>(A6)</bold>. In each box plot, the abscissa axis indicates the risk score groups, and the vertical axis indicates the log2(IC50) value of each drug. <bold>(B)</bold> The correlation coefficients between the top 50 drugs that have the highest negative correlation with the risk score and the expression levels of the genes involved in the prognostic signature. The abscissa axis indicates the gene names, and the vertical axis indicates the drug names. Red indicates a positive correlation, whereas blue represents a negative correlation. The sizes of the circles indicate significance (-log(p value)). <bold>(C, E)</bold> KM survival curves of patients in the low- and high-risk score groups in the two immunotherapeutic cohorts GSE126044 and GSE135222. The blue color represents patients in the low-risk score group, whereas the red color represents patients in the high-risk score group. The risk table is presented under the KM survival curves of each gene. <bold>(D)</bold> The proportions of patients who experienced a PR or PD/SD after receiving anti-PD1/PD-L1 immunotherapy in the low- and high-risk score groups. <bold>(F)</bold> The proportions of patients who experienced progressive and no progressive disease after receiving anti-PD1/PD-L1 immunotherapy in the low- and high-risk score groups. PR, partial response; PD, progressive disease; SD, stable disease.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1600863-g008.tif">
<alt-text content-type="machine-generated">Grouped image with several panels showing data visualizations: A1-A6 depict box plots of different treatments comparing low and high groups. Panel B presents a correlation matrix with colored circles indicating strength and direction. Panels C and E feature Kaplan-Meier survival curves for datasets GSE126044 and GSE135222, respectively, with p-values. Panels D and F are bar charts comparing response and progression percentages between low and high-risk scores.</alt-text>
</graphic>
</fig>
<p>To explore the predictive efficacy of the lung T<sub>RM</sub>-related prognostic model for patients receiving anti-PD1/PD-L1 immunotherapy, two immunotherapeutic cohorts, GSE126044 and GSE135222, were used for the prognostic analysis. The results revealed that patients in the low-risk score group had a superior overall survival status compared with patients in the high-risk score group in both cohorts (<xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8C, E</bold>
</xref>). Patients with low-risk scores had a greater response rate (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8D</bold>
</xref>) and a greater progression-free rate to anti-PD1/PD-L1 immunotherapy (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8F</bold>
</xref>).</p>
</sec>
<sec id="s3_7">
<label>3.7</label>
<title>Validation of the expression levels of genes in the protein data</title>
<p>To validate whether the protein expression levels of the genes involved in the lung T<sub>RM</sub> cell-related prognostic model were consistent with the RNA expression levels, immunohistochemical staining images were obtained from the Human Protein Atlas database (<ext-link ext-link-type="uri" xlink:href="https://www.proteinatlas.org/">https://www.proteinatlas.org/</ext-link>). The results of immunohistochemical staining for <italic>SLC16A3</italic>, <italic>ARHGAP11A</italic>, <italic>PTTG1</italic>, <italic>GPRIN1</italic> and <italic>TYMS</italic> were greater in LUAD tissues than in normal lung tissues, which was consistent with the RNA expression levels of these genes (<xref ref-type="fig" rid="f9">
<bold>Figures&#xa0;9A&#x2013;F</bold>
</xref>). Immunohistochemical staining for <italic>HLA-DQA1</italic>, <italic>ALOX5AP</italic> and <italic>OASL</italic> was lower in LUAD tissues than in normal lung tissues, which was consistent with the RNA expression levels of these genes (<xref ref-type="fig" rid="f9">
<bold>Figures&#xa0;9A, G&#x2013;J</bold>
</xref>). The LUAD proteome expression data and corresponding clinical information were obtained from the supplementary data of the study by Xu et&#xa0;al. (<xref ref-type="bibr" rid="B22">22</xref>). Survival analysis based on the proteome data revealed that <italic>SLC16A3</italic>, <italic>TYMS</italic>, <italic>ALOX5AP</italic> and <italic>OASL</italic> were risk factors for patient prognosis, whereas <italic>HLA-DQA1</italic> was a protective factor (<xref ref-type="fig" rid="f10">
<bold>Figures&#xa0;10A&#x2013;E</bold>
</xref>). These findings validated the functions of key genes in the T<sub>RM</sub> cell-related prognostic signature.</p>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>Validation of the protein expression levels of genes involved in the lung T<sub>RM</sub>-related prognostic signature. <bold>(A)</bold> RNA expression levels of the genes included in the prognostic model in LUAD and adjacent normal tissues. The abscissa axis shows the gene names, and the vertical axis shows the RNA expression levels. <bold>(B&#x2013;J)</bold> Immunohistochemical staining images obtained from the Human Protein Atlas database (<ext-link ext-link-type="uri" xlink:href="https://www.proteinatlas.org/">https://www.proteinatlas.org/</ext-link>): <bold>(B)</bold> <italic>SLC16A3</italic>, <bold>(C)</bold> <italic>ARHGAP11A</italic>, <bold>(D)</bold> <italic>PTTG1</italic>, <bold>(E)</bold> <italic>GPRIN1</italic>, <bold>(F)</bold> <italic>TYMS</italic>, <bold>(G)</bold> <italic>HLA-DQA1</italic>, <bold>(H)</bold> <italic>ALOX5AP</italic> and <bold>(J)</bold> <italic>OASL</italic>. The names of the genes and antibodies are presented at the top of each panel. The left image of each panel is the adjacent normal tissue, whereas the right image is the LUAD tissue. The staining intensity is labeled under each image.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1600863-g009.tif">
<alt-text content-type="machine-generated">Box plot illustrating RNA expression levels of genes in normal and tumor tissues, highlighting significant differences. Ten panels (B-J) show stained images of normal lung tissue and lung adenocarcinoma for various genes, including SLC16A3, ARHGAP11A, and others. Each shows staining intensity differences, marked as low, medium, or high, with a scale bar indicating 200 micrometers.</alt-text>
</graphic>
</fig>
<fig id="f10" position="float">
<label>Figure&#xa0;10</label>
<caption>
<p>Validation of the prognostic significance of the genes involved in the lung T<sub>RM</sub>-related prognostic signature via proteomic data. K&#x2013;M curves showing the survival status of LUAD patients with low and high protein expression of <bold>(A)</bold> <italic>SLC16A3</italic>, <bold>(B)</bold> <italic>TYMS</italic>, <bold>(C)</bold> <italic>HLA-DQA1</italic>, <bold>(D)</bold> <italic>ALOX5AP</italic> and <bold>(E)</bold> <italic>OASL</italic>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1600863-g010.tif">
<alt-text content-type="machine-generated">Kaplan-Meier survival curves depict survival probabilities over time for different gene expressions. Panel A shows SLC16A3 with a p-value of 0.010, Panel B shows TYMS with a p-value of 0.044, Panel C shows HLA-DQA1 with a p-value of 0.014, Panel D shows ALOX5AP with a p-value of 0.148, and Panel E shows OASL with a p-value of 0.065. Each panel compares high and low expression groups with corresponding survival probabilities and number at risk.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_8">
<label>3.8</label>
<title>Verification of the clinical and biological roles of the TYMS hub gene</title>
<p>Previous results revealed that <italic>TYMS</italic> was a hub gene in the T<sub>RM</sub> cell-related prognostic signature in the PPI analysis and the construction of the risk score model (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2D</bold>
</xref>, <xref ref-type="fig" rid="f3">
<bold>3E</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM3">
<bold>Supplementary Table&#xa0;3</bold>
</xref>). However, the function of <italic>TYMS</italic> in LUAD has rarely been investigated. To further investigate the clinical and biological roles of <italic>TYMS</italic> in LUAD, we performed immunohistochemical staining experiments using LUAD samples and assessed the proliferation of LUAD cell lines. Images of LUAD samples with negative, low, moderate, and high <italic>TYMS</italic> expression, magnified 40 &#xd7; 10 times under a light microscope, are presented in (<xref ref-type="fig" rid="f11">
<bold>Figures&#xa0;11A1&#x2013;A4</bold>
</xref>). The clinical samples included in this study were from a total of 30 patients with LUAD, 10 of whom were positive for <italic>TYMS</italic> and 20 of whom were negative. Survival analysis revealed that patients with negative <italic>TYMS</italic> staining in their tumor tissues had longer overall survival times than patients with positive <italic>TYMS</italic> staining (p=0.038, <xref ref-type="fig" rid="f11">
<bold>Figure&#xa0;11B</bold>
</xref>). Patients with M1 tumors had a higher <italic>TYMS</italic>-positive staining rate than those with M0 tumors (<xref ref-type="fig" rid="f11">
<bold>Figure&#xa0;11C</bold>
</xref>), and patients with clinical stage IV tumors had a higher <italic>TYMS</italic>-positive staining rate than those with stages II and III tumors (<xref ref-type="fig" rid="f11">
<bold>Figure&#xa0;11D</bold>
</xref>). These findings indicated that <italic>TYMS</italic> is a risk factor for LUAD patients, which is consistent with our previous findings (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3E</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM3">
<bold>Supplementary Table&#xa0;3</bold>
</xref>).</p>
<fig id="f11" position="float">
<label>Figure&#xa0;11</label>
<caption>
<p>Validation of the clinical and biological roles of <italic>TYMS</italic> through experiments on LUAD clinical samples (n=30) and cell lines. <bold>(A)</bold> Images of LUAD samples with negative <italic>TYMS</italic> expression <bold>(A1)</bold>, low <italic>TYMS</italic> expression <bold>(A2)</bold>, moderate <italic>TYMS</italic> expression <bold>(A3)</bold> and high <italic>TYMS</italic> expression <bold>(A4)</bold> in the immunohistochemical experiment. <bold>(B)</bold> Kaplan&#x2013;Meier curves showing the survival status of LUAD patients with negative and positive <italic>TYMS</italic> staining. <bold>(C)</bold> Percentage plot showing the proportion of samples with negative and positive staining among tumors at the M0 and M1 stages. <bold>(D)</bold> Percentage plot showing the proportions of samples with negative and positive staining among patients with clinical stages II+III and clinical stage IV disease. <bold>(E)</bold> Column chart showing the relative mRNA expression levels of <italic>TYMS</italic> in the si-<italic>TYMS</italic>-1#, si-<italic>TYMS</italic>-2# and control groups via qRT&#x2013;PCR. <bold>(F)</bold> Western blotting results showing the protein levels of <italic>TYMS</italic> in the si-<italic>TYMS</italic>-1#, si-<italic>TYMS</italic>-2# and control groups. <bold>(G)</bold> The corresponding grayscale of the WB results in <bold>(F)</bold>. <bold>(H)</bold> Proliferation curves of H1395 cells in the si-<italic>TYMS</italic>-1#, si-<italic>TYMS</italic>-2# and control groups. <bold>(I)</bold> Images of H1395 cells in the si-<italic>TYMS</italic>-1#, si-<italic>TYMS</italic>-2# and control groups captured by the IncuCyte platform 120 hours after seeding into 96-well plates.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1600863-g011.tif">
<alt-text content-type="machine-generated">The image consists of multiple panels demonstrating various analyses. Panels A1 to A4 show different levels of TYMS expression in tissue samples with increasing staining intensity from negative to high. Panel B is a Kaplan-Meier survival curve related to TYMS staining differences, showing statistical significance (p=0.038). Panels C and D are bar charts depicting the percentage weight of negative and positive TYMS staining across M stages and clinical stages. Panel E is a bar graph of relative TYMS mRNA levels in different treatments, with a significant decrease marked by asterisks. Panel F shows Western blot results for TYMS and &#x3b2;-Actin. Panel G is a bar graph of relative TYMS protein levels. Panel H is a line graph showing phase object confluence over time for various treatments. Panel I displays images of cell morphology under different treatments.</alt-text>
</graphic>
</fig>
<p>In the cell proliferation experiment, first, <italic>TYMS</italic> was successfully knocked down through the siRNA oligos, as evaluated by qRT-PCR (<xref ref-type="fig" rid="f11">
<bold>Figure&#xa0;11E</bold>
</xref>) and western blotting (<xref ref-type="fig" rid="f11">
<bold>Figures&#xa0;11F, G</bold>
</xref>). The results of long-term dynamic observation experiments using the IncuCyte platform revealed that the proliferative capacity of H1395 cells was significantly impaired in the <italic>TYMS</italic>-knockdown groups compared with the control groups (<xref ref-type="fig" rid="f11">
<bold>Figures&#xa0;11H, I</bold>
</xref>), suggesting that <italic>TYMS</italic> may promote LUAD cell proliferation. These findings validate the role of <italic>TYMS</italic> in enhancing the growth of H1395 cells, suggesting its potential in promoting LUAD progression.</p>
</sec>
<sec id="s3_9">
<label>3.9</label>
<title>Validating the correlation between the T<sub>RM</sub> cells infiltration density and the expression levels of the prognostic predictors in LUAD</title>
<p>To further verify the link between tissue-resident memory T cells infiltration and the expression of the T<sub>RM</sub> cell-related prognostic predictors, Spearman&#x2019;s correlation analysis was performed between the expression levels of the marker genes of T<sub>RM</sub> cells: <italic>CD8</italic>, <italic>CD69</italic>, <italic>CD103</italic>, and the 14 genes included in the T<sub>RM</sub> cell-related prognostic signature. The analytical results were consistent in the three datasets: TCGA (<xref ref-type="fig" rid="f12">
<bold>Figure&#xa0;12A</bold>
</xref>), GSE41271 (<xref ref-type="fig" rid="f12">
<bold>Figure&#xa0;12B</bold>
</xref>), and GSE42127 (<xref ref-type="fig" rid="f12">
<bold>Figure&#xa0;12C</bold>
</xref>). Interestingly, the expression levels of genes that were significant risk factors for LUAD patient prognosis, such as <italic>GAPDH</italic>, <italic>GPRIN1</italic> and <italic>EXO1</italic>, were negatively correlated with the expression levels of T<sub>RM</sub> cell marker genes (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3E</bold>
</xref>, <xref ref-type="fig" rid="f12">
<bold>12A&#x2013;C</bold>
</xref>). In contrast, the genes that are protective factors for the prognosis of LUAD, such as <italic>HLA-DQA1</italic> and <italic>ALOX5AP</italic>, were positively correlated with the three T<sub>RM</sub> cell markers (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3E</bold>
</xref>, <xref ref-type="fig" rid="f12">
<bold>12A&#x2013;C</bold>
</xref>). Moreover, the risk score of the LUAD patients was negatively correlated with the important T<sub>RM</sub> cell marker gene <italic>CD69</italic> in all three cohorts (<xref ref-type="fig" rid="f12">
<bold>Figures&#xa0;12A&#x2013;C</bold>
</xref>). These results confirmed again that the prognostic predictors involved in the T<sub>RM</sub> cell-related signature could affect patient prognosis by regulating the infiltration of T<sub>RM</sub> cells.</p>
<fig id="f12" position="float">
<label>Figure&#xa0;12</label>
<caption>
<p>Validating the correlation between the tissue-resident memory T cells infiltration density and the expression levels of the prognostic predictors in LUAD. <bold>(A&#x2013;C)</bold> Correlation analysis between T<sub>RM</sub> cell marker genes <italic>CD8</italic>, <italic>CD69</italic> and <italic>CD103</italic>, and the 14 genes involved in the T<sub>RM</sub> cell-related prognostic signature using TCGA <bold>(A)</bold>, GSE 41271 <bold>(B)</bold> and GSE42127 <bold>(C)</bold> datasets. Negative correlation: blue; positive correlation: red.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1600863-g012.tif">
<alt-text content-type="machine-generated">Heatmaps showing the correlation between immune markers (CD8, CD69, CD103) and various genes for three different datasets: TCGA, GSE41271, and GSE42127. Each rectangle represents a correlation value, with colors ranging from blue (negative correlation) to red (positive correlation), indicating the strength and type of correlation. Significance is marked with asterisks: *** for p &lt; 0.001, ** for p &lt; 0.01, and * for p &lt; 0.05.</alt-text>
</graphic>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>T<sub>RM</sub> cells can reside in specific organs or tissues without entering the blood circulation (<xref ref-type="bibr" rid="B1">1</xref>). A recent study revealed that T<sub>RM</sub> cells in different tissues or organs have distinct transcriptomic status and specific gene expression patterns, which may be closely related to their specific functions in these organs (<xref ref-type="bibr" rid="B11">11</xref>). For example, acute respiratory virus-specific T<sub>RM</sub> cells, such as influenza- and SARS-CoV-2-specific T<sub>RM</sub> cells, are more likely to be maintained in the lungs than at other sites; T<sub>RM</sub> cells that target the intestinal microbiota and pathogens are maintained in the intestinal tract, whereas in the skin, T<sub>RM</sub> cells are produced in response to skin infections and are associated with protective immune responses. The infiltration of T<sub>RM</sub> cells has been proven to be a protective factor for patient prognosis in many cancers (<xref ref-type="bibr" rid="B10">10</xref>). Recent studies have shown that even the dysfunctional CD8<sup>+</sup>T<sub>RM</sub> cells, induced by interactions with surrounding tumor cells, play important roles in anti-tumoral reactivity (<xref ref-type="bibr" rid="B23">23</xref>, <xref ref-type="bibr" rid="B24">24</xref>). The efficacy of anti-PD-1 immunotherapy is also highly dependent on the sufficiency of CD8<sup>+</sup>T<sub>RM</sub> cells infiltrating in the TME (<xref ref-type="bibr" rid="B25">25</xref>). However, it is unclear whether T<sub>RM</sub>-specific genes in one type of organ can regulate T<sub>RM</sub> cells to exert specific immune responses against tumors.</p>
<p>To explore the roles of T<sub>RM</sub>-specific genes in regulating the development of LUAD, in this study, T<sub>RM</sub> cell-specific genes that were differentially expressed (DE) between LUAD and adjacent normal tissues were identified (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2A&#x2013;D</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Tables&#xa0;1</bold>
</xref>, <xref ref-type="supplementary-material" rid="SM2">
<bold>2</bold>
</xref>). Then, 62 T<sub>RM</sub>-specific DE genes associated with OS were identified through univariate Cox regression analysis (<xref ref-type="supplementary-material" rid="SM3">
<bold>Supplementary Table&#xa0;3</bold>
</xref>), and a T<sub>RM</sub>-related prognostic model was constructed based on these genes (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3A&#x2013;E</bold>
</xref>). The prognostic model showed strong predictive efficacy in both the training and validation cohorts (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4A&#x2013;I</bold>
</xref>). Patients with low- and high-risk scores also had different clinical features according to the prognostic model (<xref ref-type="supplementary-material" rid="SF1">
<bold>Supplementary Figures&#xa0;1</bold>
</xref>, <xref ref-type="supplementary-material" rid="SF2">
<bold>2</bold>
</xref>). Fourteen lung T<sub>RM</sub> cell-specific genes were included in the prognostic model (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3E</bold>
</xref>). Among the 14 genes, <italic>GAPDH</italic>, <italic>SLC16A3</italic>, <italic>PRIN1</italic>, <italic>TYMS</italic>, <italic>CCL20</italic>, <italic>ARHGAP11A</italic>, <italic>DTL</italic>, <italic>PTTG1</italic>, <italic>EXO1</italic>, <italic>OASL</italic> and <italic>ADAM12</italic> were risk factors, whereas <italic>DAPK2</italic>, <italic>ALOX5AP</italic> and <italic>HLA-DQA1</italic> were protective factors for the prognosis of patients with LUAD (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3E</bold>
</xref>). Our results are consistent with those of previously published studies (<xref ref-type="bibr" rid="B26">26</xref>&#x2013;<xref ref-type="bibr" rid="B38">38</xref>). We noticed that <italic>TYMS</italic> and <italic>EXO1</italic> had strong connectivity with other T<sub>RM</sub> cell-specific genes in the PPI analysis; therefore, these two genes may play central roles in the regulatory network of these genes (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>). We intend to further explore the clinical and biological functions of these two genes in our future studies, and our research on the functions of <italic>EXO1</italic> in LUAD has recently been published recently (<xref ref-type="bibr" rid="B39">39</xref>).</p>
<p>The results of the GSEA of the DEGs between the low- and high-risk score groups revealed that some pathways related to the antitumoral response, such as the B-cell receptor signaling pathway (<xref ref-type="bibr" rid="B40">40</xref>), regulation of T-cell activation and T-cell-mediated immunity (<xref ref-type="bibr" rid="B41">41</xref>), were activated in the low-risk score group (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A, B</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM4">
<bold>Supplementary Table&#xa0;4</bold>
</xref>). Some immune cells that play important roles in killing tumor cells also infiltrated more in the low-risk score group, such as activated CD8<sup>+</sup>T cells and central memory CD8 T cell (<xref ref-type="bibr" rid="B22">22</xref>, <xref ref-type="bibr" rid="B23">23</xref>, <xref ref-type="bibr" rid="B41">41</xref>, <xref ref-type="bibr" rid="B42">42</xref>) (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>). This was validated by correlation analysis between CD8<sup>+</sup>T<sub>RM</sub> cell marker genes <italic>CD8</italic>, <italic>CD69</italic>, <italic>CD103</italic> (<xref ref-type="bibr" rid="B2">2</xref>), the T<sub>RM</sub> cell-related risk score, and the 14 genes involved in the T<sub>RM</sub> cell-related prognostic signature. Among the 14 genes, genes that are associated with inferior prognosis of LUAD patients, such as <italic>GAPDH</italic>, <italic>GPRIN1</italic> and <italic>EXO1</italic>, were negatively correlated with the expression levels of T<sub>RM</sub> cells markers (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3E</bold>
</xref>, <xref ref-type="fig" rid="f12">
<bold>12A&#x2013;C</bold>
</xref>). However, genes that were associated with superior prognosis of LUAD patients, such as <italic>HLA-DQA1</italic> and <italic>ALOX5AP</italic>, were positively correlated with T<sub>RM</sub> cell marker genes (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3E</bold>
</xref>, <xref ref-type="fig" rid="f12">
<bold>12A&#x2013;C</bold>
</xref>). The risk score, which was associated with poor prognosis, was significantly negatively correlated with the T<sub>RM</sub> cell marker <italic>CD69</italic> in all three cohorts (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4</bold>
</xref>, <xref ref-type="fig" rid="f12">
<bold>12</bold>
</xref>). This confirmed that the T<sub>RM</sub> cell-related risk score was negatively associated with T<sub>RM</sub> cell infiltration in LUAD, and the prognostic predictors involved in the risk score model may impact the prognosis of LUAD patients by regulating T<sub>RM</sub> cell infiltration. These findings suggest that the risk score was negatively correlated with antitumor immune activation in LUAD patients, which may be an important reason for the better prognosis in the low-risk score group. Moreover, most of the reported immune checkpoint genes were highly expressed in the low-risk score group (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5E</bold>
</xref>). This finding was consistent with the finding that patients in the low-risk score group had better clinical outcomes after treatment with immune checkpoint blockade (<xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8C&#x2013;F</bold>
</xref>).</p>
<p>Given that single-cell sequencing is an efficient method for studying the spatiotemporal heterogeneity of tumors (<xref ref-type="bibr" rid="B43">43</xref>&#x2013;<xref ref-type="bibr" rid="B45">45</xref>), we further analyzed the scRNA-seq data to validate the predictive efficacy of the T<sub>RM</sub>-related prognostic model (<xref ref-type="supplementary-material" rid="SF3">
<bold>Supplementary Figures&#xa0;3</bold>
</xref>, <xref ref-type="fig" rid="f4">
<bold>4</bold>
</xref>). Three subtypes of malignant cells were identified, namely, <italic>IFI27</italic>
<sup>+</sup>Mal, <italic>FBXO2</italic>
<sup>+</sup>Mal and <italic>HMGB2</italic>
<sup>+</sup>Mal (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6A&#x2013;C</bold>
</xref>). The results also revealed that the <italic>FBXO2</italic>
<sup>+</sup>Mal and <italic>HMGB2</italic>
<sup>+</sup>Mal cell subtypes had significantly higher scores than <italic>IFI27</italic>
<sup>+</sup>Mal cells (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6D&#x2013;G</bold>
</xref>). Functional enrichment analysis revealed that the marker genes of <italic>IFI27</italic>
<sup>+</sup>Mal cells were enriched in pathways related to immune activation, such as the positive regulation of leukocyte and MHC class II receptor activity (<xref ref-type="supplementary-material" rid="SF5">
<bold>Supplementary Figure&#xa0;5</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM5">
<bold>Supplementary Table&#xa0;5</bold>
</xref>), which was consistent with previous findings that the T<sub>RM</sub>-related risk score and cell score were negatively correlated with immune activation (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A&#x2013;D</bold>
</xref>; <xref ref-type="supplementary-material" rid="SF6">
<bold>Supplementary Figure&#xa0;6A</bold>
</xref>). <italic>FBXO2</italic>, <italic>HMGB2</italic> and <italic>IFI27</italic> are all oncogenes according to previous reports (<xref ref-type="bibr" rid="B46">46</xref>&#x2013;<xref ref-type="bibr" rid="B51">51</xref>), and their roles in regulating the development of LUAD and the possibility of becoming therapeutic targets need to be further studied.</p>
<p>The above results were mainly based on analyses of RNA expression data. In subsequent analyses, the protein expression levels of the genes included in the T<sub>RM</sub>-related signature were investigated using immunohistochemical images from the Human Protein Atlas database (<ext-link ext-link-type="uri" xlink:href="https://www.proteinatlas.org/">https://www.proteinatlas.org/</ext-link>). <italic>SLC16A3</italic>, <italic>ARHGAP11A</italic>, <italic>PTTG1</italic>, <italic>GPRIN1</italic> and <italic>TYMS</italic> were more highly expressed in LUAD tissues, whereas <italic>HLA-DQA1</italic>, <italic>ALOX5AP</italic> and <italic>OASL</italic> were expressed at lower levels in LUAD tissues than in normal lung tissues. These findings validated the differences in the RNA expression of these genes (<xref ref-type="fig" rid="f9">
<bold>Figures&#xa0;9A&#x2013;J</bold>
</xref>). Survival analysis via proteomic data verified the prognostic significance of several T<sub>RM</sub>-related signature genes, including <italic>SLC16A3</italic>, <italic>TYMS</italic>, <italic>HLA-DQA1</italic>, <italic>ALOX5AP</italic> and <italic>OASL</italic> (<xref ref-type="fig" rid="f10">
<bold>Figures&#xa0;10A&#x2013;E</bold>
</xref>). Among these genes included in the T<sub>RM</sub>-related signature, <italic>TYMS</italic> appeared to be a hub gene. <italic>TYMS</italic> has been reported to be an oncogene for colorectal cancer, pancreatic cancer and lymphoma and promotes tumor progression (<xref ref-type="bibr" rid="B52">52</xref>&#x2013;<xref ref-type="bibr" rid="B54">54</xref>), but its role in LUAD has rarely been reported. Our experiments using LUAD clinical samples and cell lines demonstrated that <italic>TYMS</italic> could also promote the progression of LUAD (<xref ref-type="fig" rid="f11">
<bold>Figures&#xa0;11A&#x2013;I</bold>
</xref>), and may be a potential therapeutic target that could regulate the functions of T<sub>RM</sub> cells in LUAD. A few reports have suggested that the expression levels of <italic>TYMS</italic> are associated with the TME landscape and responses to immune checkpoint inhibitor therapy (<xref ref-type="bibr" rid="B55">55</xref>, <xref ref-type="bibr" rid="B56">56</xref>). However, the underlying mechanisms have not been elucidated. <italic>TYMS</italic> is a key enzyme in the 5-FU catabolic pathway and is associated with the response to 5-FU-based therapy (<xref ref-type="bibr" rid="B57">57</xref>). A study has also demonstrated that 5-FU/platinum chemotherapy could facilitate tumor-reactive T cell and M1-like macrophage interactions, thus improving the efficacy of anti-PD-1 immunotherapy for advanced gastroesophageal adenocarcinomas (GEA) (<xref ref-type="bibr" rid="B58">58</xref>). Therefore, <italic>TYMS</italic> may regulate the TME and anti-PD-1 immunotherapeutic response via its roles in 5-FU metabolism. Moreover, <italic>TYMS</italic> is regulated by <italic>MYC</italic>, which affects <italic>PD-1</italic> expression in colorectal cancer (<xref ref-type="bibr" rid="B59">59</xref>). Thus, <italic>TYMS</italic> may also affect anti-PD1 immunotherapy through <italic>MYC</italic>.</p>
<p>Our study had some limitations. First, our study was based mainly on bioinformatics analyses of public datasets and was only partially verified by experiments on clinical tissues. Biological and molecular experiments <italic>in vitro</italic> and/or <italic>in vivo</italic> are needed to further investigate the functions of key genes and the activities of the corresponding signaling pathways. Second, owing to the retrospective nature of our study, bias may be inevitable, and prospective experiments are needed for further validation. Third, the differentially expressed T<sub>RM</sub> cell-related genes were identified with thresholds set at |log2FC|&#x2265;1 and FDR&lt;0.05, using bioinformatic methods. Although they are standard methods, some genes that do not meet with the threshold criteria may also play significant roles in the functions of lung T<sub>RM</sub> cells and the development of LUAD. Moreover, the experimental validation in our study focused primarily on the PPI hub gene <italic>TYMS</italic> owing to the limitation of time and experimental conditions. In the future studies, we will extend these functional studies to other key genes.</p>
</sec>
<sec id="s5" sec-type="conclusions">
<label>5</label>
<title>Conclusion</title>
<p>The prognostic signature based on lung T<sub>RM</sub> cell-related genes was efficient and robust for predicting the prognosis and therapeutic outcomes of patients with LUAD. The expression and functions of key genes in the prognostic signature were verified through experiments with LUAD samples and cell lines. Our findings increase the understanding of T<sub>RM</sub>-related clinical and biological significance in LUAD and may provide potential therapeutic targets for LUAD.</p>
</sec>
</body>
<back>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>
<p>The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.</p>
</sec>
<sec id="s7" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The studies involving humans were approved by the Ethics Committee of Shandong Provincial Hospital. The studies were conducted in accordance with the local legislation and institutional requirements. The human samples used in this study were acquired from primarily isolated as part of your previous study for which ethical approval was obtained. Written informed consent for participation was not required from the participants or the participants&#x2019; legal guardians/next of kin in accordance with the national legislation and institutional requirements.</p>
</sec>
<sec id="s8" sec-type="author-contributions">
<title>Author contributions</title>
<p>ZL: Formal analysis, Visualization, Methodology, Software, Validation, Writing &#x2013; original draft, Investigation, Data curation. MT: Validation, Methodology, Data curation, Software, Writing &#x2013; original draft, Visualization, Investigation. YY: Writing &#x2013; original draft, Investigation, Software, Data curation, Validation, Visualization. YW: Formal analysis, Methodology, Visualization, Writing &#x2013; original draft, Investigation, Data curation. LZ: Formal analysis, Writing &#x2013; review &amp; editing, Data curation, Visualization, Software. FH: Investigation, Data curation, Software, Writing &#x2013; review &amp; editing, Formal analysis. XW: Formal analysis, Writing &#x2013; review &amp; editing, Data curation, Investigation. XY: Writing &#x2013; review &amp; editing, Software, Investigation, Data curation. XL: Conceptualization, Writing &#x2013; review &amp; editing, Resources, Investigation, Methodology, Supervision. YT: Project administration, Funding acquisition, Supervision, Methodology, Investigation, Writing &#x2013; review &amp; editing, Conceptualization, Resources.</p>
</sec>
<sec id="s9" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare that financial support was received for the research and/or publication of this article. This study was funded by the Research Start-up Fund for Talent Introduction of the Affiliated Hospital of Shandong University of Traditional Chinese Medicine (yjgjzcrc-202402) and the Clinical Medical Science and Technology Innovation Program of Jinan (202430045).</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>We are very grateful to the Gene Expression Omnibus (GEO) and the Cancer Genome Atlas (TCGA) databases for providing the transcriptome and clinical information.</p>
</ack>
<sec id="s10" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that this research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.</p>
</sec>
<sec id="s11" sec-type="ai-statement">
<title>Generative AI statement</title>
<p>The author(s) declare that no Generative AI was used in the creation of this manuscript.</p>
</sec>
<sec id="s12" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s13" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fimmu.2025.1600863/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fimmu.2025.1600863/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Image1.tif" id="SF1" mimetype="image/tiff">
<label>Supplementary Figure&#xa0;1</label>
<caption>
<p>The percentages of patients with different ages <bold>(A)</bold>, tumor stages <bold>(B)</bold>, sexes <bold>(C)</bold>, <italic>EGFR</italic> alteration status <bold>(D)</bold>, <italic>ALK-EML4</italic> fusion status <bold>(E)</bold>, <italic>KRAS</italic> alteration status <bold>(F)</bold> and smoking history <bold>(G)</bold> in the low- and high-risk score groups.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Image2.tif" id="SF2" mimetype="image/tiff">
<label>Supplementary Figure&#xa0;2</label>
<caption>
<p>Box plots showing the risk scores of patients with different ages <bold>(A)</bold>, tumor stages <bold>(B)</bold>, sexes <bold>(C)</bold>, <italic>EGFR</italic> alteration status <bold>(D)</bold>, smoking history <bold>(E)</bold> and <italic>KRAS</italic> alteration status <bold>(F)</bold>.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Image3.tif" id="SF3" mimetype="image/tiff">
<label>Supplementary Figure&#xa0;3</label>
<caption>
<p>Quality control of the scRNA-seq data. <bold>(A&#x2013;F)</bold> Correlation analysis between nFeature_RNA and nCount_RNA <bold>(A)</bold>, percent.mito and nCount_RNA <bold>(B)</bold>, percent.HB and nCount_RNA <bold>(C)</bold>, percent.mito and nFeature_RNA <bold>(D)</bold>, percent.HB and nFeature_RNA <bold>(E)</bold>, percent.HB and percent.mito <bold>(F)</bold>. The correlation coefficients were marked on the top of each panal. <bold>(G&#x2013;J)</bold> The nFeature_RNA <bold>(G)</bold>, nCount_RNA <bold>(H)</bold>, percent.mito <bold>(I)</bold> and percent.HB <bold>(J)</bold> in different LUAD samples. The abscissa axes show the names of LUAD samples, whilst the ordinate axes show the numbers or percentages of each items.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Image4.tif" id="SF4" mimetype="image/tiff">
<label>Supplementary Figure&#xa0;4</label>
<caption>
<p>Annotation of the cell types in the scRNA-seq data. <bold>(A)</bold> ElbowPlot of the PCA. <bold>(B)</bold> PCA of the scRNA-seq data. <bold>(C)</bold> The distribution of cells before the removal of the batch effect. <bold>(D)</bold> The distribution of cells after the removal of the batch effect. <bold>(E)</bold> The TSNE plot showing the distribution of the cell types annotated in the harmony analysis. Different colors represent different cell types. The names of the cell types are annotated on the right of the plot. <bold>(F)</bold> The percent bar chart showing the proportions of different types of cells in the LUAD tissues. The abscissa axes show the names of LUAD samples, whilst the ordinate axes show the percentage weight of each cell. The figure note is marked on the right.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Image5.tif" id="SF5" mimetype="image/tiff">
<label>Supplementary Figure&#xa0;5</label>
<caption>
<p>Functional enrichment analysis for the marker genes of <italic>FBXO2</italic>
<sup>+</sup> <bold>(A1&#x2013;A4)</bold>, <italic>HMGB2</italic>
<sup>+</sup> <bold>(B1&#x2013;B4)</bold> and <italic>IFI27</italic>
<sup>+</sup> <bold>(C1&#x2013;C4)</bold> malignant tumor cells.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Image6.tif" id="SF6" mimetype="image/tiff">
<label>Supplementary Figure&#xa0;6</label>
<caption>
<p>GSEA of the DEGs between the low- and high-CellScore groups. <bold>(A)</bold> Pathways that are activated in different risk score groups according to KEGG enrichment analysis of the scRNA-seq data. <bold>(B)</bold> Pathways that are activated in different risk score groups according to the results of the GO-BP enrichment analysis of the scRNA-seq data. The abscissa axis represents the list of genes ranked according to their expression levels in the two groups. The vertical axis represents the running enrichment score. Curves of different colors represent different pathways.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Image7.tif" id="SF7" mimetype="image/tiff">
<label>Supplementary Figure&#xa0;7</label>
<caption>
<p>Cellular communication analysis for the high- and low-CellScore groups. <bold>(A)</bold> The number of receptor&#x2013;ligand pairs between different cell populations. The sizes of the dots represent the number of corresponding cells. The thickness of the lines indicates the number of receptors and ligands between different cell populations. The color of the connecting line was the same as the color of the signal emitter. <bold>(B)</bold> Statistical dot plot of the dominant signaling pathways. The colors of the dots indicate different cell populations. The sizes of the dots are proportional to the number of ligands and receptors inferred from each cell population, and the x- and y-axes indicate the strengths of the cell populations as signal senders and receivers, respectively. <bold>(C)</bold> Statistical heatmap of the signaling dominant of the significant pathways. The abscissa axis indicates the cell, and the vertical axis indicates the names of the signaling pathways. <bold>(D)</bold> Dot plot of the signaling dominant of the significant pathways. The abscissa axis indicates the names of the signaling pathways, and the vertical axis indicates the cell names. <bold>(E)</bold> Tumor cells in the high-CellScore group had stronger cellular communication with myeloid cells in the CSF signaling pathway network. <bold>(F)</bold> Tumor cells in the high-CellScore group had stronger cellular communication with mast cells in the KIT signaling pathway network.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Table1.xlsx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet">
<label>Supplementary Table&#xa0;1</label>
<caption>
<p>Differential expression analysis of genes between LUAD and adjacent normal tissues.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Table2.xlsx" id="SM2" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet">
<label>Supplementary Table&#xa0;2</label>
<caption>
<p>The intersecting genes of the DEGs between LUAD and adjacent normal tissues and between lung T<sub>RM</sub> cell-related genes.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Table3.xlsx" id="SM3" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet">
<label>Supplementary Table&#xa0;3</label>
<caption>
<p>The 62 prognostic genes identified in the univariate Cox regression analysis.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Table4.xlsx" id="SM4" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet">
<label>Supplementary Table&#xa0;4</label>
<caption>
<p>KEGG GSEA and GO-BP GSEA enrichment analysis of the DEGs between the low- and high-risk score groups in the bulk RNA-seq data.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Table5.xlsx" id="SM5" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet">
<label>Supplementary Table&#xa0;5</label>
<caption>
<p>The marker genes of each subtype of malignant cells.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Table6.xlsx" id="SM6" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet">
<label>Supplementary Table&#xa0;6</label>
<caption>
<p>KEGG GSEA and GO-BP GSEA enrichment analysis of the DEGs between the low- and high-risk score groups in the scRNA-seq data.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Table7.xlsx" id="SM7" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet">
<label>Supplementary Table&#xa0;7</label>
<caption>
<p>Correlation analysis between the risk score and the log2(IC50) values of the drugs.</p>
</caption>
</supplementary-material>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yuan</surname> <given-names>R</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Jiao</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>F</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>The roles of tissue-resident memory T cells in lung diseases</article-title>. <source>Front Immunol</source>. (<year>2021</year>) <volume>12</volume>:<elocation-id>710375</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2021.710375</pub-id>
</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mueller</surname> <given-names>SN</given-names>
</name>
<name>
<surname>Mackay</surname> <given-names>LK</given-names>
</name>
</person-group>. <article-title>Tissue-resident memory T cells: local specialists in immune defense</article-title>. <source>Nat Rev Immunol</source>. (<year>2016</year>) <volume>16</volume>:<fpage>79</fpage>&#x2013;<lpage>89</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nri.2015.3</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Clark</surname> <given-names>RA</given-names>
</name>
</person-group>. <article-title>Resident memory T cells in human health and disease</article-title>. <source>Sci Transl Med</source>. (<year>2015</year>) <volume>7</volume>:<fpage>269rv1</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/scitranslmed.3010641</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schenkel</surname> <given-names>JM</given-names>
</name>
<name>
<surname>Masopust</surname> <given-names>D</given-names>
</name>
</person-group>. <article-title>Tissue-resident memory T cells</article-title>. <source>Immunity</source>. (<year>2014</year>) <volume>41</volume>:<page-range>886&#x2013;97</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.immuni.2014.12.007</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Snyder</surname> <given-names>ME</given-names>
</name>
<name>
<surname>Farber</surname> <given-names>DL</given-names>
</name>
</person-group>. <article-title>Human lung tissue resident memory T cells in health and disease</article-title>. <source>Curr Opin Immunol</source>. (<year>2019</year>) <volume>59</volume>:<page-range>101&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.coi.2019.05.011</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Byrne</surname> <given-names>A</given-names>
</name>
<name>
<surname>Savas</surname> <given-names>P</given-names>
</name>
<name>
<surname>Sant</surname> <given-names>S</given-names>
</name>
<name>
<surname>Li</surname> <given-names>R</given-names>
</name>
<name>
<surname>Virassamy</surname> <given-names>B</given-names>
</name>
<name>
<surname>Luen</surname> <given-names>SJ</given-names>
</name>
<etal/>
</person-group>. <article-title>Tissue-resident memory T cells in breast cancer control and immunotherapy responses</article-title>. <source>Nat Rev Clin Oncol</source>. (<year>2020</year>) <volume>17</volume>:<page-range>341&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41571-020-0333-y</pub-id>
</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Noble</surname> <given-names>A</given-names>
</name>
<name>
<surname>Pring</surname> <given-names>ET</given-names>
</name>
<name>
<surname>Durant</surname> <given-names>L</given-names>
</name>
<name>
<surname>Man</surname> <given-names>R</given-names>
</name>
<name>
<surname>Dilke</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Hoyles</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>Altered immunity to microbiota, B-cell activation and depleted &#x3b3;&#x3b4;/resident memory T cells in colorectal cancer</article-title>. <source>Cancer Immunol Immunother</source>. (<year>2022</year>) <volume>71</volume>:<page-range>2619&#x2013;29</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00262-021-03135-8</pub-id>
</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Webb</surname> <given-names>JR</given-names>
</name>
<name>
<surname>Milne</surname> <given-names>K</given-names>
</name>
<name>
<surname>Watson</surname> <given-names>P</given-names>
</name>
<name>
<surname>Deleeuw</surname> <given-names>RJ</given-names>
</name>
<name>
<surname>Nelson</surname> <given-names>BH</given-names>
</name>
</person-group>. <article-title>Tumor-infiltrating lymphocytes expressing the tissue resident memory marker CD103 are associated with increased survival in high-grade serous ovarian cancer</article-title>. <source>Clin Cancer Res</source>. (<year>2014</year>) <volume>20</volume>:<page-range>434&#x2013;44</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/1078-0432.CCR-13-1877</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Edwards</surname> <given-names>J</given-names>
</name>
<name>
<surname>Wilmott</surname> <given-names>JS</given-names>
</name>
<name>
<surname>Madore</surname> <given-names>J</given-names>
</name>
<name>
<surname>Gide</surname> <given-names>TN</given-names>
</name>
<name>
<surname>Quek</surname> <given-names>C</given-names>
</name>
<name>
<surname>Tasker</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>CD103+ Tumor-resident CD8+ T cells are associated with improved survival in immunotherapy-na&#xef;ve melanoma patients and expand significantly during anti-PD-1 treatment</article-title>. <source>Clin Cancer Res</source>. (<year>2018</year>) <volume>24</volume>:<page-range>3036&#x2013;45</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/1078-0432.CCR-17-2257</pub-id>
</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Amsen</surname> <given-names>D</given-names>
</name>
<name>
<surname>van Gisbergen</surname> <given-names>KPJM</given-names>
</name>
<name>
<surname>Hombrink</surname> <given-names>P</given-names>
</name>
<name>
<surname>van Lier</surname> <given-names>RAW</given-names>
</name>
</person-group>. <article-title>Tissue-resident memory T cells at the center of immunity to solid tumors</article-title>. <source>Nat Immunol</source>. (<year>2018</year>) <volume>19</volume>:<page-range>538&#x2013;46</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41590-018-0114-2</pub-id>
</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Poon</surname> <given-names>MML</given-names>
</name>
<name>
<surname>Caron</surname> <given-names>DP</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Wells</surname> <given-names>SB</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>D</given-names>
</name>
<name>
<surname>Meng</surname> <given-names>W</given-names>
</name>
<etal/>
</person-group>. <article-title>Tissue adaptation and clonal segregation of human memory T cells in barrier sites</article-title>. <source>Nat Immunol</source>. (<year>2023</year>) <volume>24</volume>:<page-range>309&#x2013;19</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41590-022-01395-9</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Siegel</surname> <given-names>RL</given-names>
</name>
<name>
<surname>Miller</surname> <given-names>KD</given-names>
</name>
<name>
<surname>Wagle</surname> <given-names>NS</given-names>
</name>
<name>
<surname>Jemal</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>Cancer statistics, 2023</article-title>. <source>CA Cancer J Clin</source>. (<year>2023</year>) <volume>73</volume>:<fpage>17</fpage>&#x2013;<lpage>48</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3322/caac.21763</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Karasaki</surname> <given-names>T</given-names>
</name>
<name>
<surname>Moore</surname> <given-names>DA</given-names>
</name>
<name>
<surname>Veeriah</surname> <given-names>S</given-names>
</name>
<name>
<surname>Naceur-Lombardelli</surname> <given-names>C</given-names>
</name>
<name>
<surname>Toncheva</surname> <given-names>A</given-names>
</name>
<name>
<surname>Magno</surname> <given-names>N</given-names>
</name>
<etal/>
</person-group>. <article-title>Evolutionary characterization of lung adenocarcinoma morphology in TRACERx</article-title>. <source>Nat Med</source>. (<year>2023</year>) <volume>29</volume>:<page-range>833&#x2013;45</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41591-023-02230-w</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gillette</surname> <given-names>MA</given-names>
</name>
<name>
<surname>Satpathy</surname> <given-names>S</given-names>
</name>
<name>
<surname>Cao</surname> <given-names>S</given-names>
</name>
<name>
<surname>Dhanasekaran</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Vasaikar</surname> <given-names>SV</given-names>
</name>
<name>
<surname>Krug</surname> <given-names>K</given-names>
</name>
<etal/>
</person-group>. <article-title>Proteogenomic characterization reveals therapeutic vulnerabilities in lung adenocarcinoma</article-title>. <source>Cell</source>. (<year>2020</year>) <volume>182</volume>:<page-range>200&#x2013;25</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cell.2020.06.013</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sorin</surname> <given-names>M</given-names>
</name>
<name>
<surname>Rezanejad</surname> <given-names>M</given-names>
</name>
<name>
<surname>Karimi</surname> <given-names>E</given-names>
</name>
<name>
<surname>Fiset</surname> <given-names>B</given-names>
</name>
<name>
<surname>Desharnais</surname> <given-names>L</given-names>
</name>
<name>
<surname>Perus</surname> <given-names>LJM</given-names>
</name>
<etal/>
</person-group>. <article-title>Single-cell spatial landscapes of the lung tumor immune microenvironment</article-title>. <source>Nature</source>. (<year>2023</year>) <volume>614</volume>:<page-range>548&#x2013;54</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41586-022-05672-3</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Djenidi</surname> <given-names>F</given-names>
</name>
<name>
<surname>Adam</surname> <given-names>J</given-names>
</name>
<name>
<surname>Goubar</surname> <given-names>A</given-names>
</name>
<name>
<surname>Durgeau</surname> <given-names>A</given-names>
</name>
<name>
<surname>Meurice</surname> <given-names>G</given-names>
</name>
<name>
<surname>de Montpr&#xe9;ville</surname> <given-names>V</given-names>
</name>
<etal/>
</person-group>. <article-title>CD8+CD103+ tumor-infiltrating lymphocytes are tumor-specific tissue-resident memory T cells and a prognostic factor for survival in lung cancer patients</article-title>. <source>J Immunol</source>. (<year>2015</year>) <volume>194</volume>:<page-range>3475&#x2013;86</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.4049/jimmunol.1402711</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ganesan</surname> <given-names>AP</given-names>
</name>
<name>
<surname>Clarke</surname> <given-names>J</given-names>
</name>
<name>
<surname>Wood</surname> <given-names>O</given-names>
</name>
<name>
<surname>Garrido-Martin</surname> <given-names>EM</given-names>
</name>
<name>
<surname>Chee</surname> <given-names>SJ</given-names>
</name>
<name>
<surname>Mellows</surname> <given-names>T</given-names>
</name>
<etal/>
</person-group>. <article-title>Tissue-resident memory features are linked to the magnitude of cytotoxic T-cell responses in human lung cancer</article-title>. <source>Nat Immunol</source>. (<year>2017</year>) <volume>18</volume>:<page-range>940&#x2013;50</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/ni.3775</pub-id>
</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Oja</surname> <given-names>AE</given-names>
</name>
<name>
<surname>Piet</surname> <given-names>B</given-names>
</name>
<name>
<surname>van der Zwan</surname> <given-names>D</given-names>
</name>
<name>
<surname>Blaauwgeers</surname> <given-names>H</given-names>
</name>
<name>
<surname>Mensink</surname> <given-names>M</given-names>
</name>
<name>
<surname>de Kivit</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Functional heterogeneity of CD4+ Tumor-infiltrating lymphocytes with a resident memory phenotype in NSCLC</article-title>. <source>Front Immunol</source>. (<year>2018</year>) <volume>9</volume>:<elocation-id>2654</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2018.02654</pub-id>
</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Clarke</surname> <given-names>J</given-names>
</name>
<name>
<surname>Panwar</surname> <given-names>B</given-names>
</name>
<name>
<surname>Madrigal</surname> <given-names>A</given-names>
</name>
<name>
<surname>Singh</surname> <given-names>D</given-names>
</name>
<name>
<surname>Gujar</surname> <given-names>R</given-names>
</name>
<name>
<surname>Wood</surname> <given-names>O</given-names>
</name>
<etal/>
</person-group>. <article-title>Single-cell transcriptomic analysis of tissue-resident memory T cells in human lung cancer</article-title>. <source>J Exp Med</source>. (<year>2019</year>) <volume>216</volume>:<page-range>2128&#x2013;49</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1084/jem.20190249</pub-id>
</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Weeden</surname> <given-names>CE</given-names>
</name>
<name>
<surname>Gayevskiy</surname> <given-names>V</given-names>
</name>
<name>
<surname>Marceaux</surname> <given-names>C</given-names>
</name>
<name>
<surname>Batey</surname> <given-names>D</given-names>
</name>
<name>
<surname>Tan</surname> <given-names>T</given-names>
</name>
<name>
<surname>Yokote</surname> <given-names>K</given-names>
</name>
<etal/>
</person-group>. <article-title>Early immune pressure initiated by tissue-resident memory T cells sculpts tumor evolution in non-small cell lung cancer</article-title>. <source>Cancer Cell</source>. (<year>2023</year>) <volume>41</volume>:<page-range>837&#x2013;52</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ccell.2023.03.019</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Charoentong</surname> <given-names>P</given-names>
</name>
<name>
<surname>Finotello</surname> <given-names>F</given-names>
</name>
<name>
<surname>Angelova</surname> <given-names>M</given-names>
</name>
<name>
<surname>Mayer</surname> <given-names>C</given-names>
</name>
<name>
<surname>Efremova</surname> <given-names>M</given-names>
</name>
<name>
<surname>Rieder</surname> <given-names>D</given-names>
</name>
<etal/>
</person-group>. <article-title>Pancancer immunogenomic analyses reveal genotype-immunophenotype relationships and predictors of response to checkpoint blockade</article-title>. <source>Cell Rep</source>. (<year>2017</year>) <volume>18</volume>:<page-range>248&#x2013;62</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.celrep.2016.12.019</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname> <given-names>JY</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>C</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Zhai</surname> <given-names>L</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Mao</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>Integrative proteomic characterization of human lung adenocarcinoma</article-title>. <source>Cell</source>. (<year>2020</year>) <volume>182</volume>:<page-range>245&#x2013;61</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cell.2020.05.043</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>H</given-names>
</name>
<name>
<surname>van der Leun</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Yofe</surname> <given-names>I</given-names>
</name>
<name>
<surname>Lubling</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Gelbard-Solodkin</surname> <given-names>D</given-names>
</name>
<name>
<surname>van Akkooi</surname> <given-names>ACJ</given-names>
</name>
<etal/>
</person-group>. <article-title>Dysfunctional CD8 T cells form a proliferative, dynamically regulated compartment within human melanoma</article-title>. <source>Cell</source>. (<year>2019</year>) <volume>176</volume>:<page-range>775&#x2013;89</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cell.2018.11.043</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>W</given-names>
</name>
<name>
<surname>You</surname> <given-names>W</given-names>
</name>
<name>
<surname>Lan</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Ren</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>S</given-names>
</name>
<name>
<surname>Li</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>An immune cell map of human lung adenocarcinoma development reveals an anti-tumoral role of the Tfh-dependent tertiary lymphoid structure</article-title>. <source>Cell Rep Med</source>. (<year>2024</year>) <volume>5</volume>:<elocation-id>101448</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.xcrm.2024.101448</pub-id>
</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Barboy</surname> <given-names>O</given-names>
</name>
<name>
<surname>Bercovich</surname> <given-names>A</given-names>
</name>
<name>
<surname>Li</surname> <given-names>H</given-names>
</name>
<name>
<surname>Eyal-Lubling</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Yalin</surname> <given-names>A</given-names>
</name>
<name>
<surname>Shapir Itai</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>Modeling T cell temporal response to cancer immunotherapy rationalizes development of combinatorial treatment protocols</article-title>. <source>Nat Cancer</source>. (<year>2024</year>) <volume>5</volume>:<page-range>742&#x2013;59</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s43018-024-00734-z</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>S</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>R</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>D</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>C</given-names>
</name>
<name>
<surname>Cao</surname> <given-names>P</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Machine learning reveals diverse cell death patterns in lung adenocarcinoma prognosis and therapy</article-title>. <source>NPJ Precis Oncol</source>. (<year>2024</year>) <volume>8</volume>:<fpage>49</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41698-024-00538-5</pub-id>
</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zheng</surname> <given-names>P</given-names>
</name>
<name>
<surname>Mao</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>M</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>L</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>Comprehensive bioinformatics analysis of the solute carrier family and preliminary exploration of SLC25A29 in lung adenocarcinoma</article-title>. <source>Cancer Cell Int</source>. (<year>2023</year>) <volume>23</volume>:<fpage>222</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12935-023-03082-7</pub-id>
</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Tan</surname> <given-names>H</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>T</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>X</given-names>
</name>
<name>
<surname>Jing</surname> <given-names>F</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>H</given-names>
</name>
</person-group>. <article-title>Potential immune biomarker candidates and immune subtypes of lung adenocarcinoma for developing mRNA vaccines</article-title>. <source>Front Immunol</source>. (<year>2021</year>) <volume>12</volume>:<elocation-id>755401</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2021.755401</pub-id>
</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wan</surname> <given-names>S</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Mai</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>M</given-names>
</name>
<name>
<surname>Di</surname> <given-names>Q</given-names>
</name>
<etal/>
</person-group>. <article-title>MicroRNA-140-3p represses the proliferation, migration, invasion and angiogenesis of lung adenocarcinoma cells by targeting TYMS (thymidylate synthetase)</article-title>. <source>Bioengineered</source>. (<year>2021</year>) <volume>12</volume>:<page-range>11959&#x2013;77</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/21655979.2021.2009422</pub-id>
</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fan</surname> <given-names>T</given-names>
</name>
<name>
<surname>Li</surname> <given-names>S</given-names>
</name>
<name>
<surname>Xiao</surname> <given-names>C</given-names>
</name>
<name>
<surname>Tian</surname> <given-names>H</given-names>
</name>
<name>
<surname>Zheng</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>CCL20 promotes lung adenocarcinoma progression by driving epithelial&#x2013;mesenchymal transition</article-title>. <source>Int J Biol Sci</source>. (<year>2022</year>) <volume>18</volume>:<page-range>4275&#x2013;88</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.7150/ijbs.73275</pub-id>
</citation>
</ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>L</given-names>
</name>
<name>
<surname>Peng</surname> <given-names>M</given-names>
</name>
<name>
<surname>Xue</surname> <given-names>W</given-names>
</name>
<name>
<surname>Fan</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>T</given-names>
</name>
<name>
<surname>Lian</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Integrated analysis of dysregulated long noncoding RNAs/microRNAs/mRNAs in metastasis of lung adenocarcinoma</article-title>. <source>J Transl Med</source>. (<year>2018</year>) <volume>16</volume>:<fpage>372</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12967-018-1732-z</pub-id>
</citation>
</ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fan</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>G</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>W</given-names>
</name>
<name>
<surname>Teng</surname> <given-names>L</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>W</given-names>
</name>
<etal/>
</person-group>. <article-title>Optimizing component formula suppresses lung cancer by blocking DTL-mediated PDCD4 ubiquitination to regulate the MAPK/JNK pathway</article-title>. <source>J Ethnopharmacol</source>. (<year>2022</year>) <volume>299</volume>:<elocation-id>115546</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jep.2022.115546</pub-id>
</citation>
</ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>G</given-names>
</name>
</person-group>. <article-title>Identification of novel gene signature for lung adenocarcinoma by machine learning to predict immunotherapy and prognosis</article-title>. <source>Front Immunol</source>. (<year>2023</year>) <volume>14</volume>:<elocation-id>1177847</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2023.1177847</pub-id>
</citation>
</ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ren</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>P</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>H</given-names>
</name>
<name>
<surname>Feng</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Chi</surname> <given-names>H</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X</given-names>
</name>
<etal/>
</person-group>. <article-title>A novel signature predicts prognosis and immunotherapy in lung adenocarcinoma based on cancer-associated fibroblasts</article-title>. <source>Front Immunol</source>. (<year>2023</year>) <volume>14</volume>:<elocation-id>1201573</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2023.1201573</pub-id>
</citation>
</ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lv</surname> <given-names>J</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>H</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X</given-names>
</name>
</person-group>. <article-title>Regulatory roles of OASL in lung cancer cell sensitivity to Actinidia chinensis Planch root extract (acRoots)</article-title>. <source>Cell Biol Toxicol</source>. (<year>2018</year>) <volume>34</volume>:<page-range>207&#x2013;18</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10565-018-9422-4</pub-id>
</citation>
</ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>K</given-names>
</name>
<name>
<surname>Quan</surname> <given-names>L</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>F</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>Z</given-names>
</name>
</person-group>. <article-title>ADAM12 promotes the resistance of lung adenocarcinoma cells to EGFR-TKI and regulates the immune microenvironment by activating PI3K/Akt/mTOR and RAS signaling pathways</article-title>. <source>Int Immunopharmacol</source>. (<year>2023</year>) <volume>122</volume>:<elocation-id>110580</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.intimp.2023.110580</pub-id>
</citation>
</ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>He</surname> <given-names>W</given-names>
</name>
<name>
<surname>Ju</surname> <given-names>D</given-names>
</name>
<name>
<surname>Jie</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>A</given-names>
</name>
<name>
<surname>Xing</surname> <given-names>X</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Q</given-names>
</name>
</person-group>. <article-title>Aberrant CpG-methylation affects genes expression predicting survival in lung adenocarcinoma</article-title>. <source>Cancer Med</source>. (<year>2018</year>) <volume>7</volume>:<page-range>5716&#x2013;26</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/cam4.1834</pub-id>
</citation>
</ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>J</given-names>
</name>
<name>
<surname>Xiao</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Ming</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>J</given-names>
</name>
<name>
<surname>Dong</surname> <given-names>F</given-names>
</name>
<etal/>
</person-group>. <article-title>CD20+CD22+ADAM28+ B cells in tertiary lymphoid structures promote immunotherapy response</article-title>. <source>Front Immunol</source>. (<year>2022</year>) <volume>13</volume>:<elocation-id>865596</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2022.865596</pub-id>
</citation>
</ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>X</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Tian</surname> <given-names>M</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>F</given-names>
</name>
<etal/>
</person-group>. <article-title>EXO1 is a key gene for lung-resident memory T cells and has diagnostic and predictive values for lung adenocarcinoma</article-title>. <source>Sci Rep</source>. (<year>2025</year>) <volume>15</volume>:<fpage>4002</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41598-025-88126-w</pub-id>
</citation>
</ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Downs-Canner</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Meier</surname> <given-names>J</given-names>
</name>
<name>
<surname>Vincent</surname> <given-names>BG</given-names>
</name>
<name>
<surname>Serody</surname> <given-names>JS</given-names>
</name>
</person-group>. <article-title>B-cell function in the tumor microenvironment</article-title>. <source>Annu Rev Immunol</source>. (<year>2022</year>) <volume>40</volume>:<page-range>169&#x2013;93</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1146/annurev-immunol-101220-015603</pub-id>
</citation>
</ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>van der Leun</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Thommen</surname> <given-names>DS</given-names>
</name>
<name>
<surname>Schumacher</surname> <given-names>TN</given-names>
</name>
</person-group>. <article-title>CD8+ T-cell states in human cancer: insights from single-cell analysis</article-title>. <source>Nat Rev Cancer</source>. (<year>2020</year>) <volume>20</volume>:<page-range>218&#x2013;32</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41568-019-0235-4</pub-id>
</citation>
</ref>
<ref id="B42">
<label>42</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>T</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Luyten</surname> <given-names>S</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>X</given-names>
</name>
</person-group>. <article-title>Tissue-resident memory CD8+ T cells in cancer immunology and immunotherapy</article-title>. <source>Pharmacol Res</source>. (<year>2020</year>) <volume>159</volume>:<elocation-id>104876</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.phrs.2020.104876</pub-id>
</citation>
</ref>
<ref id="B43">
<label>43</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Maynard</surname> <given-names>A</given-names>
</name>
<name>
<surname>McCoach</surname> <given-names>CE</given-names>
</name>
<name>
<surname>Rotow</surname> <given-names>JK</given-names>
</name>
<name>
<surname>Harris</surname> <given-names>L</given-names>
</name>
<name>
<surname>Haderk</surname> <given-names>F</given-names>
</name>
<name>
<surname>Kerr</surname> <given-names>DL</given-names>
</name>
<etal/>
</person-group>. <article-title>Therapy-induced evolution of human lung cancer revealed by single-cell RNA sequencing</article-title>. <source>Cell</source>. (<year>2020</year>) <volume>182</volume>:<page-range>1232&#x2013;51</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cell.2020.07.017</pub-id>
</citation>
</ref>
<ref id="B44">
<label>44</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Leader</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Grout</surname> <given-names>JA</given-names>
</name>
<name>
<surname>Maier</surname> <given-names>BB</given-names>
</name>
<name>
<surname>Nabet</surname> <given-names>BY</given-names>
</name>
<name>
<surname>Park</surname> <given-names>MD</given-names>
</name>
<name>
<surname>Tabachnikova</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>Single-cell analysis of human non-small cell lung cancer lesions refines tumor classification and patient stratification</article-title>. <source>Cancer Cell</source>. (<year>2021</year>) <volume>39</volume>:<page-range>1594&#x2013;609</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ccell.2021.10.009</pub-id>
</citation>
</ref>
<ref id="B45">
<label>45</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Salcher</surname> <given-names>S</given-names>
</name>
<name>
<surname>Sturm</surname> <given-names>G</given-names>
</name>
<name>
<surname>Horvath</surname> <given-names>L</given-names>
</name>
<name>
<surname>Untergasser</surname> <given-names>G</given-names>
</name>
<name>
<surname>Kuempers</surname> <given-names>C</given-names>
</name>
<name>
<surname>Fotakis</surname> <given-names>G</given-names>
</name>
<etal/>
</person-group>. <article-title>High-resolution single-cell atlas reveals diversity and plasticity of tissue-resident neutrophils in non-small cell lung cancer</article-title>. <source>Cancer Cell</source>. (<year>2022</year>) <volume>40</volume>:<page-range>1503&#x2013;20</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ccell.2022.10.008</pub-id>
</citation>
</ref>
<ref id="B46">
<label>46</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Buehler</surname> <given-names>M</given-names>
</name>
<name>
<surname>Yi</surname> <given-names>X</given-names>
</name>
<name>
<surname>Ge</surname> <given-names>W</given-names>
</name>
<name>
<surname>Blattmann</surname> <given-names>P</given-names>
</name>
<name>
<surname>Rushing</surname> <given-names>E</given-names>
</name>
<name>
<surname>Reifenberger</surname> <given-names>G</given-names>
</name>
<etal/>
</person-group>. <article-title>Quantitative proteomic landscapes of primary and recurrent glioblastoma reveal a protumorigeneic role for FBXO2-dependent glioma-microenvironment interactions</article-title>. <source>Neuro Oncol</source>. (<year>2023</year>) <volume>25</volume>:<fpage>290</fpage>&#x2013;<lpage>302</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/neuonc/noac169</pub-id>
</citation>
</ref>
<ref id="B47">
<label>47</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ji</surname> <given-names>J</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>J</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>M</given-names>
</name>
<name>
<surname>Qian</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Qiu</surname> <given-names>T</given-names>
</name>
<etal/>
</person-group>. <article-title>FBXO2 targets glycosylated SUN2 for ubiquitination and degradation to promote ovarian cancer development</article-title>. <source>Cell Death Dis</source>. (<year>2022</year>) <volume>13</volume>:<fpage>442</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41419-022-04892-9</pub-id>
</citation>
</ref>
<ref id="B48">
<label>48</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Che</surname> <given-names>X</given-names>
</name>
<name>
<surname>Jian</surname> <given-names>F</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>J</given-names>
</name>
<name>
<surname>Cheng</surname> <given-names>Q</given-names>
</name>
<etal/>
</person-group>. <article-title>FBXO2 promotes proliferation of endometrial cancer by ubiquitin-mediated degradation of FBN1 in the regulation of the cell cycle and the autophagy pathway</article-title>. <source>Front Cell Dev Biol</source>. (<year>2020</year>) <volume>8</volume>:<elocation-id>843</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fcell.2020.00843</pub-id>
</citation>
</ref>
<ref id="B49">
<label>49</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cui</surname> <given-names>G</given-names>
</name>
<name>
<surname>Cai</surname> <given-names>F</given-names>
</name>
<name>
<surname>Ding</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>L</given-names>
</name>
</person-group>. <article-title>HMGB2 promotes the Malignancy of human gastric cancer and indicates poor survival outcome</article-title>. <source>Hum Pathol</source>. (<year>2019</year>) <volume>84</volume>:<page-range>133&#x2013;41</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.humpath.2018.09.017</pub-id>
</citation>
</ref>
<ref id="B50">
<label>50</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>W</given-names>
</name>
<name>
<surname>Cheng</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>LINC00974 sponges miR-33a to facilitate cell proliferation, invasion, and EMT of ovarian cancer through HMGB2 upregulation</article-title>. <source>Genet Mol Biol</source>. (<year>2022</year>) <volume>45</volume>:<elocation-id>e20210224</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1590/1678-4685-GMB-2021-0224</pub-id>
</citation>
</ref>
<ref id="B51">
<label>51</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>C</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>H</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>W</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>W</given-names>
</name>
<etal/>
</person-group>. <article-title>PABPC1-induced stabilization of IFI27 mRNA promotes angiogenesis and Malignant progression in esophageal squamous cell carcinoma through exosomal miRNA-21-5p</article-title>. <source>J Exp Clin Cancer Res</source>. (<year>2022</year>) <volume>41</volume>:<fpage>111</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s13046-022-02339-9</pub-id>
</citation>
</ref>
<ref id="B52">
<label>52</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>F</given-names>
</name>
<name>
<surname>Ye</surname> <given-names>J</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>W</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>F</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Han</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>TYMS-TM4SF4 axis promotes the progression of colorectal cancer by EMT and upregulating stem cell marker</article-title>. <source>Am J Cancer Res</source>. (<year>2022</year>) <volume>12</volume>:<page-range>1009&#x2013;26</page-range>.</citation>
</ref>
<ref id="B53">
<label>53</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fu</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Jiao</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Ji</surname> <given-names>B</given-names>
</name>
<name>
<surname>Jia</surname> <given-names>B</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>B</given-names>
</name>
</person-group>. <article-title>TYMS presents a novel biomarker for diagnosis and prognosis in patients with pancreatic cancer</article-title>. <source>Med (Baltimore)</source>. (<year>2019</year>) <volume>98</volume>:<elocation-id>e18487</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1097/MD.0000000000018487</pub-id>
</citation>
</ref>
<ref id="B54">
<label>54</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guijarro</surname> <given-names>MV</given-names>
</name>
<name>
<surname>Nawab</surname> <given-names>A</given-names>
</name>
<name>
<surname>Dib</surname> <given-names>P</given-names>
</name>
<name>
<surname>Burkett</surname> <given-names>S</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>X</given-names>
</name>
<name>
<surname>Feely</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>TYMS promotes genomic instability and tumor progression in Ink4a/Arf null background</article-title>. <source>Oncogene</source>. (<year>2023</year>) <volume>42</volume>:<page-range>1926&#x2013;39</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41388-023-02694-7</pub-id>
</citation>
</ref>
<ref id="B55">
<label>55</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xiong</surname> <given-names>K</given-names>
</name>
<name>
<surname>Pan</surname> <given-names>B</given-names>
</name>
<name>
<surname>Fang</surname> <given-names>H</given-names>
</name>
<name>
<surname>Tao</surname> <given-names>Z</given-names>
</name>
</person-group>. <article-title>Single-cell sequencing analysis reveals cancer-associated pericyte subgroup in esophageal squamous cell carcinoma to predict prognosis</article-title>. <source>Front Immunol</source>. (<year>2025</year>) <volume>15</volume>:<elocation-id>1474673</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2024.1474673</pub-id>
</citation>
</ref>
<ref id="B56">
<label>56</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ye</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Du</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>W</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>X</given-names>
</name>
</person-group>. <article-title>Construction of a circadian rhythm-relevant gene signature for hepatocellular carcinoma prognosis, immunotherapy and chemosensitivity prediction</article-title>. <source>Heliyon</source>. (<year>2024</year>) <volume>10</volume>:<elocation-id>e33682</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.heliyon.2024.e33682</pub-id>
</citation>
</ref>
<ref id="B57">
<label>57</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname> <given-names>F</given-names>
</name>
<name>
<surname>Ye</surname> <given-names>ML</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>YP</given-names>
</name>
<name>
<surname>Li</surname> <given-names>WJ</given-names>
</name>
<name>
<surname>Li</surname> <given-names>MT</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>HZ</given-names>
</name>
<etal/>
</person-group>. <article-title>MicroRNA-375-3p enhances chemosensitivity to 5-fluorouracil by targeting thymidylate synthase in colorectal cancer</article-title>. <source>Cancer Sci</source>. (<year>2020</year>) <volume>111</volume>:<page-range>1528&#x2013;41</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/cas.14356</pub-id>
</citation>
</ref>
<ref id="B58">
<label>58</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>An</surname> <given-names>M</given-names>
</name>
<name>
<surname>Mehta</surname> <given-names>A</given-names>
</name>
<name>
<surname>Min</surname> <given-names>BH</given-names>
</name>
<name>
<surname>Heo</surname> <given-names>YJ</given-names>
</name>
<name>
<surname>Wright</surname> <given-names>SJ</given-names>
</name>
<name>
<surname>Parikh</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Early immune remodeling steers clinical response to first-line chemoimmunotherapy in advanced gastric cancer</article-title>. <source>Cancer Discov</source>. (<year>2024</year>) <volume>14</volume>:<page-range>766&#x2013;85</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/2159-8290.CD-23-0857</pub-id>
</citation>
</ref>
<ref id="B59">
<label>59</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname> <given-names>H</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>H</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Li</surname> <given-names>K</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>MH</given-names>
</name>
</person-group>. <article-title>Therapeutic potential of Clostridium butyricum anticancer effects in colorectal cancer</article-title>. <source>Gut Microbes</source>. (<year>2023</year>) <volume>15</volume>:<elocation-id>2186114</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/19490976.2023.2186114</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>