<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2025.1600778</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Immunology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Low nanomolar affinity to major grass pollen allergen Phl p 5 as achieved in an unmutated human antibody-lineage ancestor</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Ess&#xe9;n</surname>
<given-names>Mattias</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Franciskovic</surname>
<given-names>Eric</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2636819/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Sele</surname>
<given-names>C&#xe9;leste</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Godzwon</surname>
<given-names>Magdalena</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Ohlin</surname>
<given-names>Mats</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/145282/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Department of Immunotechnology, Lund University</institution>, <addr-line>Lund</addr-line>,&#xa0;<country>Sweden</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Lund Protein Production Platform LP3, Department of Biology, Lund University</institution>, <addr-line>Lund</addr-line>,&#xa0;<country>Sweden</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>SciLifeLab, Lund University</institution>, <addr-line>Lund</addr-line>,&#xa0;<country>Sweden</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Harry W. Schroeder, University of Alabama at Birmingham, United States</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Annalisa Pastore, King&#x2019;s College London, United Kingdom</p>
<p>Geoffrey Mueller, National Institute of Environmental Health Sciences (NIH), United States</p>
<p>Matthew Raybould, University of Oxford, United Kingdom</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Mats Ohlin, <email xlink:href="mailto:mats.ohlin@immun.lth.se">mats.ohlin@immun.lth.se</email>
</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>01</day>
<month>07</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2025</year>
</pub-date>
<volume>16</volume>
<elocation-id>1600778</elocation-id>
<history>
<date date-type="received">
<day>26</day>
<month>03</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>02</day>
<month>06</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Ess&#xe9;n, Franciskovic, Sele, Godzwon and Ohlin</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Ess&#xe9;n, Franciskovic, Sele, Godzwon and Ohlin</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>Group 5 allergens, such as Phl p 5 of timothy grass, are major contributors to grass pollen allergy. Antibody 212597 specific for this allergen was recently isolated by single cell sequencing of bone marrow B cells of a grass pollen-allergic subject. This antibody, although subjected only to a low level of hypermutation resulting in six amino acid substitution across the heavy and light chain variable domains, has achieved sub-nM affinity for the allergen, suggesting that antibodies specific for this major group of allergens can be of high affinity even at the na&#xef;ve, unmutated stage. The present study was designed to assess affinity and biophysical characters of the antibody, its inferred unmutated ancestor, and other intermediate and allelic variants thereof.</p>
</sec>
<sec>
<title>Methods</title>
<p>Site-directed mutagenesis was used to revert substitutions of antibody 212579. Mutants, including its inferred unmutated common ancestor were characterized with respect to allergen affinity, thermostability, and hydrodynamic radius.</p>
</sec>
<sec>
<title>Results</title>
<p>We demonstrate that even the antibody&#x2019;s inferred unmutated common ancestor shows high affinity for the allergen in the low-nM range. Glutamate at heavy chain position 38, a residue unique to allele IGHV3-48*03, the germline gene origin of the heavy chain of antibody 212579, was critical for high affinity binding. Substitution to serine as found in other alleles of IGHV3&#x2013;48 reduced the affinity about 20-fold. A substitution, N40<sub>H</sub>T in the heavy/light chain variable domain interface, introduced into the antibody through somatic hypermutation, did not impact its affinity for the allergen but reduced its thermal stability and increased its hydrodynamic radius.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>Unmutated, high affinity (low-nM) antibodies specific for a major allergen (Phl p 5) can be generated directly in na&#xef;ve B cells and are, given an appropriate rearrangement, imprinted into the repertoire through rearrangements involving immunoglobulin germline gene alleles IGHV3-48*03 and IGKV3-20*01. This specificity depends on an allele-unique residue encoded by the immunoglobulin germline repertoire. Substitutions in the heavy/light chain variable domain interface, such as N40<sub>H</sub>T in a heavy chain variable domain, might negatively impact biophysical properties of the antibody and should be considered as targets for further evolution or reversion if they negatively impact an antibody&#x2019;s developability properties.</p>
</sec>
</abstract>
<kwd-group>
<kwd>affinity</kwd>
<kwd>antibody</kwd>
<kwd>antibody repertoire</kwd>
<kwd>IgE</kwd>
<kwd>immunoglobulin germline gene allele</kwd>
<kwd>molecular evolution</kwd>
<kwd>somatic hypermutation</kwd>
<kwd>unmutated common ancestor (UCA)</kwd>
</kwd-group>    <contract-num rid="cn001">2019-01042</contract-num>    <contract-sponsor id="cn001">Vetenskapsr&#xe5;det<named-content content-type="fundref-id">10.13039/501100004359</named-content>
</contract-sponsor>    <contract-sponsor id="cn002">Alfred &#xd6;sterlunds Stiftelse<named-content content-type="fundref-id">10.13039/501100005390</named-content>
</contract-sponsor>
<counts>
<fig-count count="8"/>
<table-count count="3"/>
<equation-count count="0"/>
<ref-count count="41"/>
<page-count count="12"/>
<word-count count="6136"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>B Cell Biology</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Allergen-specific antibodies are key to the induction, but also the resolution, of allergic disease (<xref ref-type="bibr" rid="B1">1</xref>). Studies of such antibodies and their development have been hampered by the rarity of allergen-specific B cells, in particular those producing IgE, the hallmark antibody isotype that cause the allergic condition. The origins of IgE-producing cells and the memory compartment from which IgE-producing cells are derived have also been matters of controversy (<xref ref-type="bibr" rid="B2">2</xref>). Looney et&#xa0;al. (<xref ref-type="bibr" rid="B3">3</xref>) demonstrated through use of large-scale next generation sequencing that IgG1-producing cells were the most likely origins of IgE-producing cells. Lately, the IgG-producing compartment was confirmed to contribute substantially to IgE memory (<xref ref-type="bibr" rid="B4">4</xref>&#x2013;<xref ref-type="bibr" rid="B6">6</xref>). There is thus a strong link between the population of antibodies of the IgG and IgE isotype and the latter may develop from memory residing in a subpopulation of the memory cells that encode the allergen-specific IgG1 compartment.</p>
<p>High affinity antigen recognition, a feature commonly important for the potency of antibodies including those specific for allergens (<xref ref-type="bibr" rid="B7">7</xref>, <xref ref-type="bibr" rid="B8">8</xref>), is typically achieved through processes of somatic hypermutation and selection in secondary lymphoid structures. However, it is conceivable that high affinity can be imprinted into an antibody already at the unmutated, na&#xef;ve stage, suggesting that highly functional antibodies can be developed early during a humoral immune response. Our limited knowledge of allergen-specific antibody repertoires similarly limit our understanding of such processes.</p>
<p>Single cell sequencing technology, offers opportunities for in-depth studies of immunity and has been used to define native human allergen-specific antibodies (<xref ref-type="bibr" rid="B9">9</xref>&#x2013;<xref ref-type="bibr" rid="B11">11</xref>). Such an approach was recently used to identify grass pollen-specific antibodies. One such high affinity (sub-nM) antibody, clone 212579, specific for grass pollen group 5 allergens, like the major timothy allergen Phl p 5 (<xref ref-type="bibr" rid="B12">12</xref>), was encoded by a bone marrow (BM)-derived cell (<xref ref-type="bibr" rid="B9">9</xref>). This B cell lineage produced antibodies of both the IgE isotype and IgG1 subclass. The fully sequenced IgG1 antibody was minimally mutated (<xref ref-type="bibr" rid="B9">9</xref>). In contrast, the partially sequenced set of IgE antibodies, also encoded by cells of BM, was substantially more mutated (<xref ref-type="bibr" rid="B9">9</xref>). The antibody clonotype was derived from the commonly utilized light chain allele IGKV3-20*01 and the heavy chain germline allele IGHV3-48*03, the products of which differ from other more commonly used alleles of the IGHV3&#x2013;48 gene in two residues of the heavy chain complementary determining regions (CDR) (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>). Altogether this clonotype offers an opportunity for detailed assessment of (<xref ref-type="bibr" rid="B1">1</xref>) the potential to generate high affinity group 5 pollen allergen-specific antibodies already at the unmutated, na&#xef;ve stage (<xref ref-type="bibr" rid="B2">2</xref>), the path for development of a high affinity allergen-specific clonotype, and (<xref ref-type="bibr" rid="B3">3</xref>) the role of allele-differentiating diversity for the generation of an allergen-specific antibody. We demonstrate that the inferred unmutated common ancestor (UCA) of antibody 212579 maintained a high (low-nM) affinity for the allergen illustrating the ability of the na&#xef;ve repertoire to generate high affinity antibody towards the major allergen Phl p 5. We also demonstrate that an immunoglobulin heavy chain variable allele-specific residue is important for establishing the sub-nM affinity of antibody 212579.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>    <p>Protein sequences encoded by the four alleles of IGHV3-48. The number of subjects among 99 individuals in a Norwegian cohort (<xref ref-type="bibr" rid="B17">17</xref>) that encode antibodies from these alleles (<ext-link ext-link-type="uri" xlink:href="https://vdjbase.org">https://vdjbase.org</ext-link>) are shown in parenthesis after each allele name. Residues are numbered according to the IMGT numbering system (<xref ref-type="bibr" rid="B13">13</xref>). Gaps (represented by dashes) are introduced into the sequences to account for residues that are present in some products of immunoglobulin and T cell receptor genes but absent in products derived from IGHV3&#x2013;48 according to this numbering system. Residues belonging to CDRs are underlined. Residues 38<sub>H</sub> and 62<sub>H</sub>, which both vary among products encoded by the alleles of IGHV3-48, locate to CDR1 and CDR2, respectively. The D96<sub>H</sub> variant of IGHV3-48*02 is in the loop connecting the E and F &#x3b2;-strands, on the back side of the variable domain far from the antibody paratope.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1600778-g001.tif">
<alt-text content-type="machine-generated">A sequence alignment table shows variants of the IGHV3-48 gene segment. Two notable variants in complementarity determining regions are marked at positions 38 and 62 in one sequences. Each sequence is labeled with its identifier and frequency.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s2">
<label>2</label>
<title>Methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>The 212579 Phl p 5-specific human monoclonal antibody</title>
<p>The high (sub-nM) affinity human monoclonal IgG1 antibody 212579 was previously identified by single cell sequencing of antibody encoding genes of bone marrow cells of a grass-pollen allergic subject (<xref ref-type="bibr" rid="B9">9</xref>). Clonally related IgE heavy chain-encoding transcripts were identified in the same subject (<xref ref-type="bibr" rid="B9">9</xref>). Genes encoding the heavy and light chain of antibody 212579 (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>) are available using GenBank accession numbers PQ539330 and PQ539331. Residues are numbered according to the IMGT numbering system (<xref ref-type="bibr" rid="B13">13</xref>). For instance, E38<sub>H</sub> refers to a glutamate residue at position 38 of the heavy (<sub>H</sub>) chain, and V29<sub>L</sub>I refers to a substitution of residue 29 of the light (<sub>L</sub>) chain from valine to isoleucine.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Nucleotide and protein sequences of the heavy <bold>(A, B)</bold> and light <bold>(C, D)</bold> chain variable domains of the human Phl p 5-specific antibody 212579 and its most likely inferred UCA. The sequence and residue numbers of CDR3 of the heavy chain of the inferred UCA is spelled out above the nucleotide sequence <bold>(A)</bold>. The parts of the variable, diversity, and joining germline genes that contributed to the rearrangements in the heavy and kappa light chain loci are shown <bold>(A, C)</bold>. Only amino acids that were fully encoded by the incorporated genes are spelled out in panels <bold>(B, D)</bold> In addition, two bases of germline genes were incorporated into codons encoding D107<sub>H</sub>, W110<sub>H</sub>, M111.2<sub>H</sub>, and N112.3<sub>H</sub> and one base of germline IGKV3-20*1 were incorporated into the codon encoding L115<sub>L</sub>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1600778-g002.tif">
<alt-text content-type="machine-generated">Sequences of heavy and light chains are displayed in sections labeled A, B, C, and D. Each section compares sequences labeled &#x201c;UCA&#x201d; and &#x201c;212579&#x201d; with reference sequences. Differences between sequences are highlighted, showing nucleotide variations in sequence alignment for analysis.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Mutagenesis</title>
<p>Codon optimized genes (GenBank accession numbers PQ539345 and PQ539358) encoding the heavy and light chain variable domains of antibody 212579 were previously cloned into a eukaryotic expression vector and expressed as IgG1 (<xref ref-type="bibr" rid="B9">9</xref>). Site-directed mutagenesis was performed using the GeneArt<sup>&#xae;</sup> Site-Directed Mutagenesis System (Thermo Fisher Scientific, Waltham, MA, USA) for single mutations and the GeneArt<sup>&#xae;</sup> Site-Directed Mutagenesis PLUS Kit for multi-site mutagenesis using primers listed in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>. PCR conditions included an initial denaturation at 94&#xb0;C for 2 minutes, followed by 18 cycles at 94&#xb0;C for 20 seconds, 57&#xb0;C for 30 seconds, and 68&#xb0;C for 3 minutes, with a final extension at 68&#xb0;C for 5 minutes. Mutant constructs were verified via Sanger sequencing (Eurofins Genomics, Ebersberg, Germany). Clones were experimentally derived by a single mutagenesis process or in a sequential manner, as outlined in <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Primers used to generate variants of antibody 212579.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">Substitution</th>
<th valign="middle" align="left">Primers</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">T40<sub>H</sub>N</td>
<td valign="middle" align="left">GCTCCTACGAGATGAACTGGGTTAGACAGGC<break/>GCCTGTCTAACCCAGTTCATCTCGTAGGAGC</td>
</tr>
<tr>
<td valign="middle" align="left">I53<sub>H</sub>V</td>
<td valign="middle" align="left">AAAGGCCTGGAATGGGTCAGCTACATCAGCA<break/>TGCTGATGTAGCTGACCCATTCCAGGCCTTT</td>
</tr>
<tr>
<td valign="middle" align="left">H113<sub>H</sub>Y</td>
<td valign="middle" align="left">GATAACTACTATTACTACGGCATGGATGTGT<break/>ACACATCCATGCCGTAGTAATAGTAGTTATC</td>
</tr>
<tr>
<td valign="middle" align="left">I29<sub>L</sub>V, T40<sub>L</sub>A</td>
<td valign="middle" align="left">AGAGCTTCTCAGAGCGTCAGCAGCAGCTACCTGGCATGGTATCAGCAAA<break/>TTTGCTGATACCATGCCAGGTAGCTGCTGCTGACGCTCTGAGAAGCTCT</td>
</tr>
<tr>
<td valign="middle" align="left">V108<sub>L</sub>G</td>
<td valign="middle" align="left">ACTGCCAGCAGTACGGGTCCTCCCTGATCAC<break/>GTGATCAGGGAGGACCCGTACTGCTGGCAGT</td>
</tr>
<tr>
<td valign="middle" align="left">E38<sub>H</sub>S</td>
<td valign="middle" align="left">ACCTTCAGCTCCTACTCGATGACCTGGGTTAG<break/>CTAACCCAGGTCATCGAGTAGGAGCTGAAGGT</td>
</tr>
<tr>
<td valign="middle" align="left">G62<sub>H</sub>S</td>
<td valign="middle" align="left">TACATCAGCAGCTCTAGCAGCACAATCTACT<break/>AGTAGATTGTGCTGCTAGAGCTGCTGATGTA</td>
</tr>
</tbody>
</table>
</table-wrap>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Experimental paths through which the different variants of 212579 were generated by the site-directed mutagenesis process. Heavy chain domain variants are highlighted in blue (those related to reversion of substitutions that had been introduced by mutation of the inferred UCA) and orange (those related to sequence differences between alleles of IGHV3-48). Domains carrying reversion of substitutions of the light chain are highlighted in green.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1600778-g003.tif">
<alt-text content-type="machine-generated">Diagram of experimental development of variants of clone 212579. Antibodies are depicted with variations in residues: E38S, G62S, I53V, T40N, H113Y, I29V, T40A, V108G with subsequent combinations resulting in multiple variants and an ultimate form labeled UCA.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Protein production and purification</title>
<p>Plasmids encoding antibody variants were amplified in DH5&#x3b1; <italic>Escherichia coli</italic> (Thermo Fisher Scientific) and purified using the EndoFree Plasmid Maxi Kit (Qiagen, Hilden, Germany) following the manufacturer&#x2019;s protocol. Expi293F&#x2122; suspension cells (Thermo Fisher Scientific) were cultured in Expi293&#x2122; Expression Medium (Gibco&#x2122;, Carlsbad, CA, USA) under conditions optimized for exponential growth (37&#xb0;C, 8% CO<sub>2</sub>, 225 rpm). Cells were maintained in 125 mL shake flasks at a volume of 30 mL and passaged every 3&#x2013;4 days when reaching a density of 3&#x2013;5 &#xd7; 10<sup>6</sup> cells/mL by diluting cultures to 0.3&#x2013;0.5 &#xd7; 10<sup>6</sup> cells/mL. For transfection, cells were seeded at 2.5 &#xd7; 10<sup>6</sup> cells/mL in fresh Expi293&#x2122; Expression Medium one day prior. On the day of transfection, cells were adjusted to a final concentration of 3 &#xd7; 10<sup>6</sup> cells/mL and seeded at 2.5 mL per well in a 24-well plate, allowing cells to settle for 4 hours before transfection. Plasmid DNA (2.5 &#xb5;g per well) and PEI MAX Reagent (1 mg/mL) (PEI MAX<sup>&#xae;</sup> - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000), Polysciences, Inc., Warrington, PA, USA) were diluted in sterile-filtered (0.22 &#xb5;m) 0.15 M NaCl. DNA and PEI were mixed at DNA: PEI ratios of 1:6 and 1:9 (w/w), gently swirled, and incubated at room temperature for 10&#x2013;20 minutes to ensure complex formation. The DNA: PEI complexes were added dropwise to the wells containing cells while swirling to promote even distribution. Cells were incubated at 37&#xb0;C, 8% CO<sub>2</sub>, and 225 rpm for six days before harvest of culture supernatant.</p>
<p>Antibodies were purified using Pierce&#x2122; Protein A Magnetic Beads (Thermo Fisher Scientific, Product No. 88845) according to the manufacturer&#x2019;s protocol. Briefly, a 900 &#xb5;L aliquot of clarified supernatant was combined with 100 &#xb5;L of 10X binding/wash buffer (200 mM Tris, 1.5 M NaCl, 0.5% Tween-20, pH 7.4) in a 24-well deep-well plate with pointy-tip wells. Beads (50 &#xb5;L per sample) were pre-washed with 150 &#xb5;L of 1X binding/wash buffer and magnetically separated before incubation with the diluted supernatant at room temperature for 1 hour with gentle mixing. Following incubation, beads were washed twice with 500 &#xb5;L of 1X binding/wash buffer to remove unbound proteins. Bound antibodies were eluted by adding 100 &#xb5;L of 0.1 M glycine (pH 2.0) and incubating for 10 minutes with occasional mixing. The eluate was immediately neutralized with 15 &#xb5;L of 1 M Tris (pH 8.5) and stored at 4&#xb0;C. Antibody concentration was determined at 280 nm using a NanoDrop ND-1000 UV-Vis Spectrophotometer using an extinction coefficient (&#x3f5;) of 1.4 (mg/mL)&#x2212;&#xb9; cm&#x2212;&#xb9;.</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Immunochemical analysis</title>
<p>Indirect chemiluminescent ELISA assessed antibody binding to antigen Phl p 5. A 96 well plate (Corning, Corning, NY, USA) was coated overnight at 4&#xb0;C with Phl p 5.0101 (Biomay, Vienna, Austria) diluted to 0.5 &#x3bc;g/mL with cold PBS (Dulbecco&#x2019;s Phosphate Buffered Saline without Ca<sup>2+</sup> and Mg<sup>2+</sup> (Cytiva, Marlborough, MA, USA)). Washing steps were performed with a solution of 150 mM NaCl with 0.05% Tween 20, and a blocking step (after coating) was done with 0.5% BSA in PBS with 0.05% Tween 20. Incubation for each step except the coating was done at room temperature for 1 hour on the shaking table. Investigated antibodies were incubated with the immobilized antigen and detected with horse radish peroxidase (HRP)-conjugated goat anti-human IgG (Invitrogen, Carlsbad, CA, USA) and SuperSignal ELISA Pico Chemiluminescent Substrate (Thermo Scientific). Luminescence was measured using a FLUOstar Omega plate reader (BMG Labtech, Ortenberg, Germany).</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>SDS-PAGE</title>
<p>SDS-PAGE was performed to evaluate the purity and integrity of produced IgG. Proteins were mixed with 4&#xd7; LDS Sample Buffer (Clear Page, C.B.S. Scientific) and 10&#xd7; Sample Reducing Agent (Novex, Life Technologies), heated at 70&#xb0;C for 10 minutes, and separated on a 10% Bis-Tris gel (NuPAGE&#x2122;, Life Technologies). A pre-stained protein ladder (PageRuler, Thermo Scientific) was included for molecular weight estimation. Electrophoresis was carried out in MES SDS Running Buffer (Invitrogen) at 200 V for 35 minutes. Gels were stained with SimplyBlue&#x2122; SafeStain (Invitrogen) for 1 hour and destained in deionized water overnight. Band patterns were visualized using a Gel Doc EZ Imager (BioRad, Hercules, CA, USA).</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Determination of antigen binding affinity and reaction rate constants</title>
<p>Surface plasmon resonance (SPR) was used to assess the binding kinetics and affinity of antibodies for Phl p 5, using a Biacore 1K+ instrument (Cytiva, Uppsala, Sweden). Anti-human IgG (Fc) (the Human Antibody Capture Kit (Cytiva, Product No. BR100839)) were immobilized on a CM5 sensor chip (Cytiva) anti human IgG was captured on this surface. The capture level was optimized to reach approximately 100 response units (RU). Binding experiments were conducted in PBS-based running buffer containing 0.02% Tween 20. Serial dilutions of Phl p 5 antigen (0 nM, and 1.875&#x2013;60 nM) in a twofold dilution series were used. Each antigen concentration was injected at 25 &#xb5;L/min for 120 seconds, followed by a 1360-second dissociation phase. The sensor surface was regenerated using 3 M MgCl<sub>2</sub> (Cytiva). Binding kinetics were determined using Biacore Insight software (Cytiva) and data were fitted to a 1:1 Langmuir binding model.</p>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Determination of antibody thermostability</title>
<p>Antibody thermal stability was assessed using Nano Differential Scanning Fluorimetry (NanoDSF, Prometheus (Nanotemper, Munich, Germany)). Antibody samples were loaded into NanoDSF standard capillaries and subjected to a temperature gradient (rate: 1&#xb0;/min) from 25&#xb0;C to 95&#xb0;C. Intrinsic tryptophan fluorescence at 330 nm and 350 nm was recorded and melting temperature (Tm) values were determined from the first derivative of the unfolding curve. Measurements were performed in triplicates.</p>
</sec>
<sec id="s2_8">
<label>2.8</label>
<title>Determination of antibody hydrodynamic radius</title>
<p>The hydrodynamic radius (R_h) and sample monodispersity were assessed using the Fida Neo system (FidaBio, Copenhagen, Denmark). Antibody samples, stored at 4&#xb0;C prior to analysis, were analyzed in triplicate using a reversibly coated hydrophilic capillary. Measurements were conducted at 25&#xb0;C and 37&#xb0;C, with the original antibody buffer serving as both the running and wash buffer. Data analysis employed single- or dual-species fitting models to assess sample homogeneity and detect potential aggregation or structural changes at different temperatures.</p>
</sec>
<sec id="s2_9">
<label>2.9</label>
<title>Structure models and structures</title>
<p>Five structure models of antibody 212579 and its inferred UCA as single chain fragment variable (scFv), with a ((G<sub>4</sub>S)<sub>3</sub> linker) were generated using AlphaFold3 (<ext-link ext-link-type="uri" xlink:href="https://alphafoldserver.com/">https://alphafoldserver.com/</ext-link>) (<xref ref-type="bibr" rid="B14">14</xref>). A single structure model of 212579 and its inferred UCA as Fv were generated using ABodyBuilder2 (<xref ref-type="bibr" rid="B15">15</xref>) featured on the Bionamic software platform for antibody discovery and development (<ext-link ext-link-type="uri" xlink:href="https://bionamic.io/">https://bionamic.io/</ext-link>). Model structures were visualized using the PyMOL Molecular Graphics System, Version 3.0.3 (Schr&#xf6;dinger, LLC, Mannheim, Germany). Structure models generated by AlphaFold3 were aligned to models generated by ABodyBuilder2 taking C&#x3b1; of residues not being part of heavy chain CDR3 into account.</p>
<p>Five crystal structures (PDB: 2UZI, 5D70, 5TY6, 6PE7, and 6PHG) of human antibodies with an origin in IGHV3&#x2013;48 or related germline genes with N40<sub>H</sub> and with a resolution of &#x2264;2.5 &#xc5; were identified from the IMGT 3D-structure database (<xref ref-type="bibr" rid="B16">16</xref>). Structures were visualized using the PyMOL Molecular Graphics System, Version 3.0.3.</p>
</sec>
<sec id="s2_10">
<label>2.10</label>
<title>Immunoglobulin heavy chain variable alleles in the human population</title>
<p>The occurrences of alleles of IGHV3&#x2013;48 were assessed in a Norwegian cohort defined by immunoglobulin transcriptome sequencing extensively investigated in the past (<xref ref-type="bibr" rid="B17">17</xref>&#x2013;<xref ref-type="bibr" rid="B19">19</xref>). Data describing this cohort is available in the VDJbase online database (<xref ref-type="bibr" rid="B20">20</xref>).</p>
</sec>
<sec id="s2_11">
<label>2.11</label>
<title>General mutation patterns of antibodies derived from IGHV3-48*03</title>
<p>Theoretical mutation patterns of sequences derived from alleles of IGHV3&#x2013;48 at the 10% mutational frequency level had been computed using the ARMADiLLO online tool (<ext-link ext-link-type="uri" xlink:href="https://armadillo.dhvi.duke.edu">https://armadillo.dhvi.duke.edu</ext-link>) (<xref ref-type="bibr" rid="B21">21</xref>, <xref ref-type="bibr" rid="B22">22</xref>). Mutational patterns of residues 40 and 53 of human IgG derived from IGHV3&#x2013;48 found in bone marrow were computed using data generated by next generation sequencing of immunoglobulin-encoding transcriptomes, as described (<xref ref-type="bibr" rid="B23">23</xref>, <xref ref-type="bibr" rid="B24">24</xref>).</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>The mutational status of Phl p 5-specific human antibody 212579 and definition of the lineage&#x2019;s unmutated common ancestor</title>
<p>The heavy chain variable domains of antibody 212579 has an origin in germline genes IGHV3-48*03, IGHD3-10*01 or IGHD3-16*02, IGHJ6*02, IGKV3-20*01, and IGKJ5*01 (<xref ref-type="bibr" rid="B9">9</xref>). Analysis of the sequence defined, assuming the absence of mutations among the non-templated nucleotides of the rearrangement, a most likely UCA (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>) (GenBank accession numbers PV255645, and PV255646). Only two bases of the IGKV-IGKJ rearrangement are not covered by the germline genes. The CDR3 of the heavy chain is 19 residues long. Only three of its residues (L108<sub>H</sub>, R109<sub>H</sub>, and D111.3<sub>H</sub>) are not encoded by any base of the IGHV, IGHD, or IGHJ genes. Altogether, the 212579 IgG1 sequence carry only three substitutions (N40<sub>H</sub>T, V53<sub>H</sub>I, and Y113<sub>H</sub>H) of the heavy chain and three of the light chain (V29<sub>L</sub>I, A40<sub>L</sub>T, and G108<sub>L</sub>V) relative the inferred UCA demonstrating the limited extent of mutation that the genes had undergone. These findings together suggested a high confidence in the definition of the inferred UCA sequence. Sequences of transcripts encoding the region from residue 24 to the end of the heavy chain variable domain of the related IgE identified the presence of multiple additional substitutions, including A24<sub>H</sub>V, S35<sub>H</sub>N, S59<sub>H</sub>G, I65<sub>H</sub>L, K84<sub>H</sub>N, Y88<sub>H</sub>S, N92<sub>H</sub>K, D111.3<sub>H</sub>E, N112.3<sub>H</sub>H, and H113<sub>H</sub>N, demonstrating the further extensive evolution of this clonotype into the form represented by an IgE clone that co-existed with the IgG1 clone at the time of sample collection. Both the minimally mutated antibody 212579 and the IgE-variant thereof carrying additional mutations in the heavy chain corresponding to those identified in IgE-encoding transcripts showed sub-nM affinity for Phl p 5 (<xref ref-type="bibr" rid="B9">9</xref>).</p>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>The 212579 antibody, its unmutated common ancestor, and potential intermediate sequence variants and their allergen-binding characteristics</title>
<p>To assess the potential of an inferred UCA of antibody 212579 and various mutated intermediates to bind Phl p 5, we generated a set of reversion mutants of antibody 212579 in IgG1 format. All but one (212579 H113<sub>H</sub>Y) of the constructs produced well in Expi293F suspension cell culture in amounts sufficient for intact antibodies to be purified. Such antibodies were pure as determined by SDS-PAGE (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>). All antibody variants bound Phl p 5 immobilized onto microtiter plates (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref>). Measurements of the affinity of the antibodies demonstrated that the antibody had affinity-matured about 27-fold from the inferred UCA to the 212579 antibody, but even the inferred UCA showed an affinity for the allergen in the low-nM range (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>). Germline gene allele IGHV3-48*03 and IGKV3-20*01 in combination are thus, given appropriate rearrangements, able to form high affinity binders that may populate the na&#xef;ve antibody repertoire.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Reduced SDS-PAGE analysis of 212579, its inferred UCA and other variants of the clonotype after purification. Antibody 212579 H113<sub>H</sub>Y was also produced but achieved only low concentrations in culture supernatants. It was used for ELISA and affinity constant determination without prior purification.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1600778-g004.tif">
<alt-text content-type="machine-generated">Gel electrophoresis image showing protein bands for different variants labeled above each lane. Molecular weight marker is on the left, with markers at 140, 115, 80, 70, 50, 40, 30, 25, 15, and 10 kDa. Variants labeled include different amino acid substitutions. Each lane displays distinct protein band patterns.</alt-text>
</graphic>
</fig>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Antibody 212579 and recombinant variants thereof bind similarly to Phl p 5 immobilized onto a microtiter-plate surface in an assay format that allows for binding enhanced by avidity effects.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1600778-g005.tif">
<alt-text content-type="machine-generated">Two line graphs show the correlation between IgG concentration and chemiluminescence signal, with various mutations indicated by different colored lines and markers. The left graph includes mutations like T40N and H113Y, while the right graph features substitutions E38S and G62 that relate to variation in complementarity determining regions present in alleles of IGHV3-48. Both graphs depict increasing chemiluminescence signals with higher IgG concentrations, illustrating that all variants recognise the allergen in a solid phase assay format.</alt-text>
</graphic>
</fig>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Reaction rate constants and dissociate constants of 212579, its inferred UCA, and other sequence variants of the clonotype.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="bottom" align="left">Mutant</th>
<th valign="bottom" align="center">k<sub>a</sub> (1/Ms) &#xd7;10<sup>5</sup>
</th>
<th valign="bottom" align="center">k<sub>d</sub> (1/s) &#xd7;10<sup>-4</sup>
</th>
<th valign="bottom" align="center">K<sub>D</sub> (M) &#xd7;10<sup>-9</sup>
</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="bottom" align="left">212579</td>
<td valign="bottom" align="center">4.4</td>
<td valign="bottom" align="center">1.4</td>
<td valign="bottom" align="center">0.32</td>
</tr>
<tr>
<td valign="bottom" align="left">UCA (212579 T40<sub>H</sub>N, I53<sub>H</sub>V, H113<sub>H</sub>Y, I29<sub>L</sub>V, T40<sub>L</sub>A, V108<sub>L</sub>G)</td>
<td valign="bottom" align="center">0.6</td>
<td valign="bottom" align="center">5.1</td>
<td valign="bottom" align="center">8.5</td>
</tr>
<tr>
<td valign="bottom" align="left">212579 T40<sub>H</sub>N</td>
<td valign="bottom" align="center">3.2</td>
<td valign="bottom" align="center">1.6</td>
<td valign="bottom" align="center">0.49</td>
</tr>
<tr>
<td valign="bottom" align="left">212579 I53<sub>H</sub>V</td>
<td valign="bottom" align="center">4.2</td>
<td valign="bottom" align="center">1.3</td>
<td valign="bottom" align="center">0.31</td>
</tr>
<tr>
<td valign="bottom" align="left">212579 H113<sub>H</sub>Y</td>
<td valign="bottom" align="center">2.6</td>
<td valign="bottom" align="center">3.6</td>
<td valign="bottom" align="center">1.4</td>
</tr>
<tr>
<td valign="bottom" align="left">212579 T40<sub>H</sub>N, I53<sub>H</sub>V</td>
<td valign="bottom" align="center">26</td>
<td valign="bottom" align="center">1.4</td>
<td valign="bottom" align="center">0.56</td>
</tr>
<tr>
<td valign="bottom" align="left">212579 T40<sub>H</sub>N, I53<sub>H</sub>V, H113<sub>H</sub>Y</td>
<td valign="bottom" align="center">1.6</td>
<td valign="bottom" align="center">1.4</td>
<td valign="bottom" align="center">0.92</td>
</tr>
<tr>
<td valign="bottom" align="left">212579 I29<sub>L</sub>V, T40<sub>L</sub>A, V108<sub>L</sub>G</td>
<td valign="bottom" align="center">2.3</td>
<td valign="bottom" align="center">3.5</td>
<td valign="bottom" align="center">1.5</td>
</tr>
<tr>
<td valign="bottom" align="left">212579 I53<sub>H</sub>V, I29<sub>L</sub>V, T40<sub>L</sub>A, V108<sub>L</sub>G</td>
<td valign="bottom" align="center">2.2</td>
<td valign="bottom" align="center">3.3</td>
<td valign="bottom" align="center">1.5</td>
</tr>
<tr>
<td valign="bottom" align="left">212579 T40<sub>H</sub>N, I29<sub>L</sub>V, T40<sub>L</sub>A, V108<sub>L</sub>G</td>
<td valign="bottom" align="center">1.2</td>
<td valign="bottom" align="center">5.0</td>
<td valign="bottom" align="center">4.3</td>
</tr>
<tr>
<td valign="bottom" align="left">212579 E38<sub>H</sub>S</td>
<td valign="bottom" align="center">2.8</td>
<td valign="bottom" align="center">27.3</td>
<td valign="bottom" align="center">9.9</td>
</tr>
<tr>
<td valign="bottom" align="left">212579 G62<sub>H</sub>S</td>
<td valign="bottom" align="center">4.2</td>
<td valign="bottom" align="center">1.1</td>
<td valign="bottom" align="center">0.27</td>
</tr>
<tr>
<td valign="bottom" align="left">212579 E38<sub>H</sub>S, G62<sub>H</sub>S</td>
<td valign="bottom" align="center">1.3</td>
<td valign="bottom" align="center">26.2</td>
<td valign="bottom" align="center">19.6</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>The N40<sub>H</sub>T substitution seen in antibody 212579 negatively impacts the antibody&#x2019;s thermal stability</title>
<p>Antibody 212579 had a melting temperature Tm=67.8&#xb0;C (<xref ref-type="table" rid="T3">
<bold>Table&#xa0;3</bold>
</xref>, <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>). As outlined above it carries an N40<sub>H</sub>T substitution relative the inferred UCA. Residue 40 typically resides in the heavy/light chain domain interface. Computational assessment demonstrate the codon&#x2019;s tendency to mutate so as to encode other amino acid residues (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7A</bold>
</xref>). Assessment of transcripts encoding IgG with an origin in IGHV3&#x2013;48 suggests that substitutions of residue 40, including to T40<sub>H</sub>, are occasional occurrences in somatically hypermutated antibodies <italic>in vivo</italic> (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7A</bold>
</xref>). However, we demonstrate that this substitution negatively impacts thermal stability of the IgG as reversion of this mutation, alone or in combination with other reversions, increases the melting temperature of the antibody by 2.4-4.1&#xb0;C (<xref ref-type="table" rid="T3">
<bold>Table&#xa0;3</bold>
</xref>, <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>). In contrast, reversion of the other substitutions that occurred during the evolution of antibody 212579, including the commonly observed V53<sub>H</sub>I substitution (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7B</bold>
</xref>), has limited or no positive effect on the antibodies&#x2019; thermal stability.</p>
<table-wrap id="T3" position="float">
<label>Table&#xa0;3</label>
<caption>
<p>Melting temperature (Tm) and the hydrodynamic radius of 212579, its inferred UCA, and other sequence variants of the clonotype.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="bottom" rowspan="2" align="left">Mutant</th>
<th valign="top" rowspan="2" align="center">Mean Tm &#xb1; SD (&#xb0;C)</th>
<th valign="top" colspan="2" align="center">Hydrodynamic radius &#xb1; SD (nm)</th>
</tr>
<tr>
<th valign="top" align="center">25&#xb0;C</th>
<th valign="top" align="center">37&#xb0;C</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">212579</td>
<td valign="middle" align="center">67.8 &#xb1; 0.0</td>
<td valign="middle" align="center">6.52 &#xb1; 0.02</td>
<td valign="middle" align="center">5.54 &#xb1; 0.15</td>
</tr>
<tr>
<td valign="middle" align="left">UCA (212579 T40<sub>H</sub>N, I53<sub>H</sub>V, H113<sub>H</sub>Y, I29<sub>L</sub>V, T40<sub>L</sub>A, V108<sub>L</sub>G)</td>
<td valign="middle" align="center">71.4 &#xb1; 0.0</td>
<td valign="middle" align="center">6.28 &#xb1; 0.05</td>
<td valign="middle" align="center">n.d.</td>
</tr>
<tr>
<td valign="middle" align="left">212579 T40<sub>H</sub>N, I29<sub>L</sub>V, T40<sub>L</sub>A, V108<sub>L</sub>G</td>
<td valign="middle" align="center">71.9 &#xb1; 0.2</td>
<td valign="middle" align="center">6.11 &#xb1; 0.02</td>
<td valign="middle" align="center">4.79 &#xb1; 0.03</td>
</tr>
<tr>
<td valign="middle" align="left">212579 T40<sub>H</sub>N, I53<sub>H</sub>V, H113<sub>H</sub>Y</td>
<td valign="middle" align="center">71.2 &#xb1; 0.2</td>
<td valign="middle" align="center">6.32 &#xb1; 0.04</td>
<td valign="middle" align="center">5.05 &#xb1; 0.04</td>
</tr>
<tr>
<td valign="middle" align="left">212579 T40<sub>H</sub>N, I53<sub>H</sub>V</td>
<td valign="middle" align="center">70.5 &#xb1; 0.1</td>
<td valign="middle" align="center">6.03 &#xb1; 0.12</td>
<td valign="middle" align="center">4.86 &#xb1; 0.13</td>
</tr>
<tr>
<td valign="middle" align="left">212579 T40<sub>H</sub>N</td>
<td valign="middle" align="center">70.2 &#xb1; 0.2</td>
<td valign="middle" align="center">6.07 &#xb1; 0.02</td>
<td valign="middle" align="center">4.89 &#xb1; 0.02</td>
</tr>
<tr>
<td valign="middle" align="left">212579 I53<sub>H</sub>V, I29<sub>L</sub>V, T40<sub>L</sub>A, V108<sub>L</sub>G</td>
<td valign="middle" align="center">68.3 &#xb1; 0.2</td>
<td valign="middle" align="center">6.67 &#xb1; 0.02</td>
<td valign="middle" align="center">5.24 &#xb1; 0.02</td>
</tr>
<tr>
<td valign="middle" align="left">212579 I53<sub>H</sub>V</td>
<td valign="middle" align="center">67.2 &#xb1; 0.1</td>
<td valign="middle" align="center">6.20 &#xb1; 0.04</td>
<td valign="middle" align="center">5.05 &#xb1; 0.08</td>
</tr>
<tr>
<td valign="middle" align="left">212579 I29<sub>L</sub>V, T40<sub>L</sub>A, V108<sub>L</sub>G</td>
<td valign="middle" align="center">66.2 &#xb1; 0.0</td>
<td valign="middle" align="center">6.53 &#xb1; 0.02</td>
<td valign="middle" align="center">5.05 &#xb1; 0.01</td>
</tr>
<tr>
<td valign="middle" align="left">212579 E38<sub>H</sub>S</td>
<td valign="middle" align="center">66.2 &#xb1; 0.0</td>
<td valign="middle" align="center">6.49 &#xb1; 0.02</td>
<td valign="middle" align="center">5.05 &#xb1; 0.02</td>
</tr>
<tr>
<td valign="middle" align="left">212579 G62<sub>H</sub>S</td>
<td valign="middle" align="center">65.7 &#xb1; 0.1</td>
<td valign="middle" align="center">6.46 &#xb1; 0.06</td>
<td valign="middle" align="center">5.20 &#xb1; 0.03</td>
</tr>
<tr>
<td valign="middle" align="left">212579 E38<sub>H</sub>S, G62<sub>H</sub>S</td>
<td valign="middle" align="center">68.3 &#xb1; 0.2</td>
<td valign="middle" align="center">6.37 &#xb1; 0.02</td>
<td valign="middle" align="center">4.92 &#xb1; 0.01</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>n.d., not determined</p>
</fn>
</table-wrap-foot>
</table-wrap>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Differential scanning calorimetry illustrates differences in melting behavior between variants of antibody 212579 carrying T<sub>H</sub>40 (for instance as in antibody 212579; solid lines) or N<sub>H</sub>40 (for instance as in the inferred UCA of 212579; dashed lines). The curves represent the average of three independent runs.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1600778-g006.tif">
<alt-text content-type="machine-generated">Line graph showing the first derivative relative of the signal of a differential calorimetric experiment on the y-axis and temperature in degrees Celsius on the x-axis, ranging from 20 to 100 degrees. Multiple colored lines represent different variants of the antibody 212579 with respective mutations, showing peaks around 70 degrees.</alt-text>
</graphic>
</fig>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Substitution frequencies of residues 40<sub>H</sub> <bold>(A)</bold> and 53<sub>H</sub> <bold>(B)</bold>, as predicted by computational analysis (using the ARMADiLLO software tool (<xref ref-type="bibr" rid="B21">21</xref>, <xref ref-type="bibr" rid="B22">22</xref>); 10% mutation level), and as observed in bone marrow (BM)-derived transcripts. Gene sequence diversity does not affect the computationally predicted substitution frequencies between alleles of IGHV3-48. <italic>In vivo</italic> data identifies the subset of the plausible substitutions that can be incorporated into positions 40<sub>H</sub> and 53<sub>H</sub> of antibodies derived from IGHV3-48, including substitutions N40<sub>H</sub>T and V53<sub>H</sub>I observed in 212579. Some substitutions are computationally predicted, based on the mutational patterns of the gene sequence (e.g. N40<sub>H</sub>K and multiple substitutions of residue V53<sub>H</sub>), but are not observed <italic>in vivo</italic>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1600778-g007.tif">
<alt-text content-type="machine-generated">Stacked bar charts labeled A and B show cumulative frequencies of amino acid substitutions of heavy chain residue 40. Chart A indicates high frequencies of certain substitutions across four IGHV3-48 variants as prediced using ARMADiLLO. Chart B shows the same information for heavy chain residue 53. Color-coded legend on the right lists substitutions by letters.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>Residue 40<sub>H</sub> impacts the hydrodynamic radius of the antibody</title>
<p>Antibody 212579, its inferred UCA, and their potential intermediates showed monodispercity with a hydrodynamic radius expected of IgG. Thus, none of them showed any tendency for aggregation. However, differences in their hydrodynamic radius were observed (<xref ref-type="table" rid="T3">
<bold>Table&#xa0;3</bold>
</xref>). In particular, variants carrying residue N40<sub>H</sub> had a hydrodynamic radius (6.16 &#xb1; 0.13 nm) at 25&#xb0;C, lower than those of variants carrying T40<sub>H</sub> (6.46 &#xb1; 0.15 nm) (p=0.015; Mann-Whitney test). Residue 40 in the heavy light chain interface thus impacts not only the thermal stability but also the overall structure of the antibody.</p>
</sec>
<sec id="s3_5">
<label>3.5</label>
<title>Structure model of antibody 212579 and its inferred UCA</title>
<p>Structure models of antibody 212579 were generated using AlphaFold3 (<xref ref-type="bibr" rid="B14">14</xref>) and ABodyBuilder2 (<xref ref-type="bibr" rid="B15">15</xref>). While the overall backbone structure of the variable domains beyond heavy chain CDR3 agreed well between ABodyBuilder2 and AlphaFold3 (RMSDs of C&#x3b1;: 0.28-0.35 &#xc5;), the proposed structure of the long CDR3 differed substantially between models proposed by the tools, in agreement with the challenges associated to computational prediction of the structure of antibody binding sites (<xref ref-type="bibr" rid="B25">25</xref>). For instance, the position of C&#x3b1; of heavy chain CDR3 residue D111.3 of the consensus model proposed by ABodyBuilder2 is 14.9-21.1 &#xc5; away from its location in five models proposed by AlphaFold3. Substantial uncertainty of this hypervariable loop was also evident in the model generated by ABodyBuilder2 (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8B</bold>
</xref>) illustrating the challenge in defining the tip of this long loop by <italic>in silico</italic> modelling. The modelling tools were used to predict the effect of N40<sub>H</sub>T substitutions within the heavy-light chain interface of the heavy chain variable domain (<xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8A, C</bold>
</xref>). In line with the agreement of the backbone structure of much of the variable domains, both tools proposed the presence in the inferred UCA of a long-range network of polar interactions involving the side chains of N40<sub>H</sub>, W52<sub>H</sub>, and D107<sub>H</sub>, while the side chain of T40<sub>H</sub> in antibody 212579 was proposed not to make polar interactions with D107<sub>H</sub> (Alphafold3), or to engage in polar interactions at all (ABodyBuilder2) (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8A</bold>
</xref>). Importantly, studies of other human antibodies that carry N40<sub>H</sub> also showed evidence of similar polar interaction networks in experimentally determined antibody structures engaging N40<sub>H</sub>, W52<sub>H</sub>, and residues 105<sub>H</sub>/107<sub>H</sub> of the ascending strand of CDR3 (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8D</bold>
</xref>).</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Model and crystal structures of antibodies derived from IGHV3-48. Antibody 212579 and its inferred UCA were modelled using ABodyBuilder2 <bold>(A)</bold> and AlphaFold3 <bold>(C)</bold>. The predicted error of each residue of the heavy and light chain variable domains (residues of CDRs are underlined) of the model of antibody 212579 as generated by ABodyBuilder2 is illustrated <bold>(B)</bold>. The backbone of CDR3 is highlighted in brown color. The modelled structures illustrate the position of residues W52<sub>H</sub>, D107<sub>H</sub> (carbon: cyan) and residue 40<sub>H</sub> (carbon: green) and proposed polar interaction made by the side chain of residue 40<sub>H</sub>. Other proposed polar interactions engaging the side chain of 40<sub>H</sub> to the backbone oxygen of residue S54<sub>H</sub> (carbon: cyan) are shown if implicated in the structures made by AlphaFold3. N40<sub>H</sub> of the inferred UCA was in all cases proposed to make polar interactions with W52<sub>H</sub> and D107<sub>H</sub>, while T40<sub>H</sub> made no interaction with D107<sub>H</sub> in any model proposed for 212579 by AlphaFold3 and no polar interactions with either W52<sub>H</sub> or D107<sub>H</sub> as proposed by ABodyBuilder2. <bold>(D)</bold> Crystal structures of antibodies (PDB: 2UZI, 5D70, 5TY6, 6PE7, and 6PHG) with a possible origin in IGHV3&#x2013;48 and with residue N40<sub>H</sub>. The side chain of this residue makes polar interactions with W52<sub>H</sub>, and in 4/5 cases also with residues of the ascending strand of CDR3. Additional polar interactions of residue N40<sub>H</sub> are also seen.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1600778-g008.tif">
<alt-text content-type="machine-generated">Section A shows protein structures modeled by ABodyBuilder2, with color-coded sections for 212579 UCA and 212579. Section B presents a line graph of root mean square deviation against residue number, with two lines for VH and VL. Section C illustrates structures predicted by AlphaFold3, similarly labeled with 212579 UCA and 212579. Section D displays multiple protein structures like 2UZI and 5D70 obtained from the Protein Data Bank, showing specific amino acid variations.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_6">
<label>3.6</label>
<title>An allele-differentiating sequence variant at residue 38 is important for binding to the allergen</title>
<p>Immunoglobulin heavy chain variable germline gene IGHV3&#x2013;48 is represented by four major alleles (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>). These alleles are differentially represented in the population. For instance, in a Norwegian cohort (<xref ref-type="bibr" rid="B17">17</xref>), the IGHV3-48*03 allele is expressed in only 34/99 genotypes while alleles IGHV3-48*01 and IGHV3-48*02 dominate in the population. Unmutated antibodies encoded by IGHV3-48*03 differ from all other alleles of this gene by the presence of E38<sub>H</sub> and G62<sub>H</sub> instead of S38<sub>H</sub> and S62<sub>H</sub> (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>). Introduction of both E38<sub>H</sub>S and G62<sub>H</sub>S substitutions, or one of these substitutions into antibody 212579 did not substantially affect protein production, product monodispersity, or the ability of the product to bind Phl p 5 in an immunoassay format that allows for bivalent binding to the immobilized antigen. Some reduction in melting temperature was seen, in particular for the G62<sub>H</sub>S variant but not for the E38<sub>H</sub>S G62<sub>H</sub>S substituted antibody. However, the E38<sub>H</sub>S (but not the G38<sub>H</sub>S) substitution substantially affected the monovalent affinity for the antigen (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>) primarily by increasing the dissociation rate of the complex approximately 20-fold. The presence of E38<sub>H</sub> unique to allele IGHV3-48*03 is thus critical for the high-affinity antigen-binding property of the clonotype.</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>Affinity is an important aspect of bioactivity of allergen-specific antibodies (<xref ref-type="bibr" rid="B7">7</xref>, <xref ref-type="bibr" rid="B8">8</xref>). Antibody 212579, a Phl p 5 allergen-specific monoclonal antibody, has evolved <italic>in vivo</italic> through a minimal set of mutations into a high affinity, allergen-specific antibody. However, also its inferred UCA was shown to display a high affinity for the antigen in the low-nM range. The present study thus illustrates how a high affinity binder to a major allergen is readily achieved even without mutation in some clonal lineages and further evolved into sub-nM affinity through a minimal number of substitutions. As only a fraction of IgE antibodies needs to be of high affinity to induce efficient basophil degranulation (<xref ref-type="bibr" rid="B2">2</xref>, <xref ref-type="bibr" rid="B7">7</xref>), these findings illustrate how such a population of specific binders can be readily achieved without the need for extensive affinity maturation. Interestingly, as antibody 212579, an antibody of the IgG1 subclass, is a member of a clonal lineage that also harbors more mutated IgE antibodies of similar affinity (<xref ref-type="bibr" rid="B9">9</xref>), it also illustrates the potential of clonal development of high affinity antibodies with potential to block basophil activation (<xref ref-type="bibr" rid="B7">7</xref>, <xref ref-type="bibr" rid="B8">8</xref>).</p>
<p>All investigated variants of 212579 bound the allergen well in an assay format that allows for avidity effects based on binding of a divalent antibody to antigen immobilized onto a surface. Assessment of monovalent binding interaction, while demonstrating the low-nM affinity even of the inferred UCA of antibody 212579, illustrated that antibody 212579 had enhanced its affinity toward the allergen, by improvement of both the association and dissociation rate constants. None of the substitutions of antibody 212579 were on their own responsible for the affinity enhancement. Reversion of the three substitutions of the light chain variable domain, that only target one residue commonly being a contact residue (<xref ref-type="bibr" rid="B26">26</xref>), reduced the affinity 4.7-fold. While reversion of the substitution of heavy chain variable domain residues 40 and 53 did not substantially affect binding affinity, reversion of the substitution of residue 113 reduced affinity 4.3-fold. Among the residues of the heavy chain that were affected by substitutions, only residue 113 is a common antigen contact residue (<xref ref-type="bibr" rid="B26">26</xref>), while residues 40<sub>H</sub> and 53<sub>H</sub> reside in the heavy/light chain variable domain interface and the lower domain core, respectively. These substitutions, N40<sub>H</sub>T and V53<sub>H</sub>I, are computationally predicted to occur during somatic hypermutation and are occasionally and commonly, respectively, seen in IgG repertoires (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>). Past studies proposed that substitution of residue N40<sub>H</sub> might, through its ability to make polar interaction with D107H, have impact on the paratope (<xref ref-type="bibr" rid="B24">24</xref>). Here we provide experimental evidence that, although no effect on the affinity to the antigen was observed upon mutation of residue 40, such substitutions influenced the thermal stability of the protein and its hydrodynamic radius. Residue 40, residing in the heavy-light chain interface, thus represents a viable candidate for optimization of antibodies, including those developed for use in allergy immunotherapy, for instance in cases where developability issues are associated to the protein product.</p>
<p>The present study illustrates that alleles IGHV3-48*03 and IGKV3-20*01 are capable of generating a high affinity (low-nM) binder also in the na&#xef;ve, unmutated stage. IGKV3-20*01 is highly expressed and present at high frequency in the human population while IGHV3-48*03 is present only in about 1/3 of subjects in this Scandinavian population. Residue E38<sub>H</sub>, a residue that commonly is engaged in antibody-protein antigen interactions (<xref ref-type="bibr" rid="B26">26</xref>), unique to this allele of IGHV3-48, is highly critical for the high affinity nature of antibody 212579 as substitution of this residue alone to serine, as found in other alleles of IGHV3-48, reduced the affinity for the allergen approximately 20-fold. We hypothesize that subjects carrying the IGHV3-48*03 allele in their genotype, might be poised to develop antibodies to the epitope of Phl p 5 recognized by antibody 212579, in particular as alleles of IGHD, IGHJ, IGKV, and IGKJ engaged in creation of the inferred 212579 UCA (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>) are frequently present in human genotypes.</p>
<p>Interestingly, antibody responses, if deconvoluted to epitope specificity, are commonly generated by a limited set of immunoglobulin rearrangements. The responses to the CD4-binding site of human immunodeficiency virus-1, the stem of influenzae virus hemagglutinin, and the AD-2 epitope of cytomegalovirus glycoprotein B, responses that are enriched in sequences derived from germline genes IGHV1-2 (<xref ref-type="bibr" rid="B27">27</xref>&#x2013;<xref ref-type="bibr" rid="B29">29</xref>), IGHV1-69 (<xref ref-type="bibr" rid="B30">30</xref>), and IGHV3&#x2013;30 and closely related genes thereof (<xref ref-type="bibr" rid="B31">31</xref>, <xref ref-type="bibr" rid="B32">32</xref>), respectively, and in some cases even particular alleles thereof, are other prime examples of such stereotyped responses. Also antibody responses to certain allergens have been shown to be germline gene-restricted including responses to peanut allergen Ara h 2 (<xref ref-type="bibr" rid="B10">10</xref>, <xref ref-type="bibr" rid="B11">11</xref>), and grass pollen allergen Phl p 2 (<xref ref-type="bibr" rid="B33">33</xref>&#x2013;<xref ref-type="bibr" rid="B35">35</xref>). The immune response to Phl p 5 is, however, known to target multiple epitopes (<xref ref-type="bibr" rid="B36">36</xref>) and to be highly diverse in genetic origin (<xref ref-type="bibr" rid="B37">37</xref>&#x2013;<xref ref-type="bibr" rid="B39">39</xref>). Given the limited information on gene usage of antibodies targeting individual epitopes it is still unknown if particular epitopes of Phl p 5 are primarily recognized by antibodies of a limited set of germline gene or allele origins. Grass pollen allergen epitope recognition profiles are, however, highly individualized (<xref ref-type="bibr" rid="B40">40</xref>, <xref ref-type="bibr" rid="B41">41</xref>). It thus remains to be investigated if such personal epitope recognition patterns are associated to each subjects&#x2019; immunoglobulin germline gene/allele repertoire, for instance as exemplified by allelic differences of IGHV3-48.</p>
<p>In summary, we have identified an inferred UCA of the allergen-specific antibody 212579 that displays high affinity for its target allergen. It illustrates the potential of unmutated na&#xef;ve antibodies of the immune repertoire to recognize the major allergen Phl p 5, a route that offers a shortcut to the development of antibodies with potential to induce an allergic condition or (as IgG) to block basophil activation. Residue N40<sub>H</sub> of the germline gene was identified as a residue that, potentially through a hydrogen-bonded network, stabilize the antibody structure. As this residue is occasionally mutated in human antibodies, we postulate that reversion of such substitutions may be a viable approach to enhance for instance the developability character of antibodies. Finally, we demonstrate that residue E38<sub>H</sub>, a unique residue of allele IGHV3-48*03, substantially contributed to the high affinity of the clonotype, suggesting an allele-differentiating effect in targeting the epitope of this major allergen.</p>
</sec>
</body>
<back>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The sequences of the 212579 antibody and its inferred UCA presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The studies involving humans were approved by Ethical Board at Lund University. The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>ME: Data curation, Formal analysis, Methodology, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing, Investigation. EF: Formal analysis, Investigation, Methodology, Supervision, Writing &#x2013; review &amp; editing. CS: Formal analysis, Supervision, Writing &#x2013; review &amp; editing, Data curation. MG: Formal analysis, Methodology, Supervision, Writing &#x2013; review &amp; editing, Investigation. MO: Conceptualization, Formal analysis, Funding acquisition, Resources, Supervision, Visualization, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare that financial support was received for the research and/or publication of this article. The study was supported by grants from The Swedish Research Council (grant number 2019-01042) and Alfred &#xd6;sterlund&#x2019;s Foundation. The funders had no role in design of the study, the execution of the study, the drafting of the manuscript, or the decision to publish the study.</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>We thank Lund University and its faculties in their support of the Lund Protein Production Platform (LP3).</p>
</ack>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="ai-statement">
<title>Generative AI statement</title>
<p>The author(s) declare that no Generative AI was used in the creation of this manuscript.</p>
</sec>
<sec id="s11" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<fn-group>
<title>Abbreviations</title>
<fn fn-type="abbr" id="abbrev1">
<p>BM, bone marrow; CDR, complementarity determining region; Tm, melting temperature; UCA, unmutated common ancestor.</p>
</fn>
</fn-group>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shamji</surname> <given-names>MH</given-names>
</name>
<name>
<surname>Valenta</surname> <given-names>R</given-names>
</name>
<name>
<surname>Jardetzky</surname> <given-names>T</given-names>
</name>
<name>
<surname>Verhasselt</surname> <given-names>V</given-names>
</name>
<name>
<surname>Durham</surname> <given-names>SR</given-names>
</name>
<name>
<surname>Wurtzen</surname> <given-names>PA</given-names>
</name>
<etal/>
</person-group>. <article-title>The role of allergen-specific IgE, IgG and IgA in allergic disease</article-title>. <source>Allergy</source>. (<year>2021</year>) <volume>76</volume>:<page-range>3627&#x2013;41</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/all.14908</pub-id>
</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Davies</surname> <given-names>JM</given-names>
</name>
<name>
<surname>Platts-Mills</surname> <given-names>TA</given-names>
</name>
<name>
<surname>Aalberse</surname> <given-names>RC</given-names>
</name>
</person-group>. <article-title>The enigma of IgE+ B-cell memory in human subjects</article-title>. <source>J Allergy Clin Immunol</source>. (<year>2013</year>) <volume>131</volume>:<page-range>972&#x2013;6</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jaci.2012.12.1569</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Looney</surname> <given-names>TJ</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>JY</given-names>
</name>
<name>
<surname>Roskin</surname> <given-names>KM</given-names>
</name>
<name>
<surname>Hoh</surname> <given-names>RA</given-names>
</name>
<name>
<surname>King</surname> <given-names>J</given-names>
</name>
<name>
<surname>Glanville</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Human B-cell isotype switching origins of IgE</article-title>. <source>J Allergy Clin Immunol</source>. (<year>2016</year>) <volume>137</volume>:<fpage>579</fpage>&#x2013;<lpage>86 e7</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jaci.2015.07.014</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Koenig</surname> <given-names>JFE</given-names>
</name>
<name>
<surname>Knudsen</surname> <given-names>NPH</given-names>
</name>
<name>
<surname>Phelps</surname> <given-names>A</given-names>
</name>
<name>
<surname>Bruton</surname> <given-names>K</given-names>
</name>
<name>
<surname>Hoof</surname> <given-names>I</given-names>
</name>
<name>
<surname>Lund</surname> <given-names>G</given-names>
</name>
<etal/>
</person-group>. <article-title>Type 2-polarized memory B cells hold allergen-specific IgE memory</article-title>. <source>Sci Transl Med</source>. (<year>2024</year>) <volume>16</volume>:<elocation-id>eadi0944</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/scitranslmed.adi0944</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ota</surname> <given-names>M</given-names>
</name>
<name>
<surname>Hoehn</surname> <given-names>KB</given-names>
</name>
<name>
<surname>Fernandes-Braga</surname> <given-names>W</given-names>
</name>
<name>
<surname>Ota</surname> <given-names>T</given-names>
</name>
<name>
<surname>Aranda</surname> <given-names>CJ</given-names>
</name>
<name>
<surname>Friedman</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>CD23(+)IgG1(+) memory B cells are poised to switch to pathogenic IgE production in food allergy</article-title>. <source>Sci Transl Med</source>. (<year>2024</year>) <volume>16</volume>:<elocation-id>eadi0673</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/scitranslmed.adi0673</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hoof</surname> <given-names>I</given-names>
</name>
<name>
<surname>Schulten</surname> <given-names>V</given-names>
</name>
<name>
<surname>Layhadi</surname> <given-names>JA</given-names>
</name>
<name>
<surname>Stranzl</surname> <given-names>T</given-names>
</name>
<name>
<surname>Christensen</surname> <given-names>LH</given-names>
</name>
<name>
<surname>Herrera de la</surname> <given-names>MS</given-names>
</name>
<etal/>
</person-group>. <article-title>Allergen-specific IgG(+) memory B cells are temporally linked to IgE memory responses</article-title>. <source>J Allergy Clin Immunol</source>. (<year>2020</year>) <volume>146</volume>:<page-range>180&#x2013;91</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jaci.2019.11.046</pub-id>
</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Christensen</surname> <given-names>LH</given-names>
</name>
<name>
<surname>Holm</surname> <given-names>J</given-names>
</name>
<name>
<surname>Lund</surname> <given-names>G</given-names>
</name>
<name>
<surname>Riise</surname> <given-names>E</given-names>
</name>
<name>
<surname>Lund</surname> <given-names>K</given-names>
</name>
</person-group>. <article-title>Several distinct properties of the IgE repertoire determine effector cell degranulation in response to allergen challenge</article-title>. <source>J Allergy Clin Immunol</source>. (<year>2008</year>) <volume>122</volume>:<fpage>298</fpage>&#x2013;<lpage>304</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jaci.2008.05.026</pub-id>
</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Strobl</surname> <given-names>MR</given-names>
</name>
<name>
<surname>Demir</surname> <given-names>H</given-names>
</name>
<name>
<surname>Stadlmayr</surname> <given-names>G</given-names>
</name>
<name>
<surname>Stracke</surname> <given-names>F</given-names>
</name>
<name>
<surname>Hoelzl</surname> <given-names>R</given-names>
</name>
<name>
<surname>Bohle</surname> <given-names>B</given-names>
</name>
<etal/>
</person-group>. <article-title>Affinity matters for IgE-blocking activity of allergen-specific antibodies</article-title>. <source>Allergy</source>. (<year>2023</year>) <volume>78</volume>:<page-range>2543&#x2013;6</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/all.15746</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Th&#xf6;rnqvist</surname> <given-names>L</given-names>
</name>
<name>
<surname>Franciskovic</surname> <given-names>E</given-names>
</name>
<name>
<surname>Godzwon</surname> <given-names>M</given-names>
</name>
<name>
<surname>Kristensen</surname> <given-names>B</given-names>
</name>
<name>
<surname>Sultan</surname> <given-names>K</given-names>
</name>
<name>
<surname>Nordstr&#xf6;m</surname> <given-names>F</given-names>
</name>
<etal/>
</person-group>. <article-title>Allergen-specific human IgE isolated and characterised through an allergen-agnostic pipeline</article-title>. (<year>2025</year>). <italic>submitted for publication</italic>.</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hoh</surname> <given-names>RA</given-names>
</name>
<name>
<surname>Joshi</surname> <given-names>SA</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>JY</given-names>
</name>
<name>
<surname>Martin</surname> <given-names>BA</given-names>
</name>
<name>
<surname>Varma</surname> <given-names>S</given-names>
</name>
<name>
<surname>Kwok</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Origins and clonal convergence of gastrointestinal IgE(+) B cells in human peanut allergy</article-title>. <source>Sci Immunol</source>. (<year>2020</year>) <volume>5</volume>:<elocation-id>eaay4209</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/sciimmunol.aay4209</pub-id>
</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Patil</surname> <given-names>SU</given-names>
</name>
<name>
<surname>Ogunniyi</surname> <given-names>AO</given-names>
</name>
<name>
<surname>Calatroni</surname> <given-names>A</given-names>
</name>
<name>
<surname>Tadigotla</surname> <given-names>VR</given-names>
</name>
<name>
<surname>Ruiter</surname> <given-names>B</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>Peanut oral immunotherapy transiently expands circulating Ara h 2-specific B cells with a homologous repertoire in unrelated subjects</article-title>. <source>J Allergy Clin Immunol</source>. (<year>2015</year>) <volume>136</volume>:<fpage>125</fpage>&#x2013;<lpage>34.e12</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jaci.2015.03.026</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Niederberger</surname> <given-names>V</given-names>
</name>
<name>
<surname>Laffer</surname> <given-names>S</given-names>
</name>
<name>
<surname>Froschl</surname> <given-names>R</given-names>
</name>
<name>
<surname>Kraft</surname> <given-names>D</given-names>
</name>
<name>
<surname>Rumpold</surname> <given-names>H</given-names>
</name>
<name>
<surname>Kapiotis</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>IgE antibodies to recombinant pollen allergens (Phl p 1, Phl p 2, Phl p 5, and Bet v 2) account for a high percentage of grass pollen-specific IgE</article-title>. <source>J Allergy Clin Immunol</source>. (<year>1998</year>) <volume>101</volume>:<page-range>258&#x2013;64</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/s0091-6749(98)70391-4</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lefranc</surname> <given-names>MP</given-names>
</name>
</person-group>. <article-title>IMGT unique numbering for the variable (V), constant (C), and groove (G) domains of IG, TR, MH, IgSF, and mhSF</article-title>. <source>Cold Spring Harb Protoc</source>. (<year>2011</year>) <volume>2011</volume>:<page-range>633&#x2013;42</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1101/pdb.ip85</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Abramson</surname> <given-names>J</given-names>
</name>
<name>
<surname>Adler</surname> <given-names>J</given-names>
</name>
<name>
<surname>Dunger</surname> <given-names>J</given-names>
</name>
<name>
<surname>Evans</surname> <given-names>R</given-names>
</name>
<name>
<surname>Green</surname> <given-names>T</given-names>
</name>
<name>
<surname>Pritzel</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>Accurate structure prediction of biomolecular interactions with AlphaFold 3</article-title>. <source>Nature</source>. (<year>2024</year>) <volume>630</volume>:<fpage>493</fpage>&#x2013;<lpage>500</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41586-024-07487-w</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Abanades</surname> <given-names>B</given-names>
</name>
<name>
<surname>Wong</surname> <given-names>WK</given-names>
</name>
<name>
<surname>Boyles</surname> <given-names>F</given-names>
</name>
<name>
<surname>Georges</surname> <given-names>G</given-names>
</name>
<name>
<surname>Bujotzek</surname> <given-names>A</given-names>
</name>
<name>
<surname>Deane</surname> <given-names>CM</given-names>
</name>
</person-group>. <article-title>ImmuneBuilder: Deep-learning models for predicting the structures of immune proteins</article-title>. <source>Commun Biol</source>. (<year>2023</year>) <volume>6</volume>:<fpage>575</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s42003-023-04927-7</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ehrenmann</surname> <given-names>F</given-names>
</name>
<name>
<surname>Lefranc</surname> <given-names>MP</given-names>
</name>
</person-group>. <article-title>IMGT/3Dstructure-DB: querying the IMGT database for 3D structures in immunology and immunoinformatics (IG or antibodies, TR, MH, RPI, and FPIA)</article-title>. <source>Cold Spring Harb Protoc</source>. (<year>2011</year>) <volume>2011</volume>:<page-range>750&#x2013;61</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1101/pdb.prot5637</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gidoni</surname> <given-names>M</given-names>
</name>
<name>
<surname>Snir</surname> <given-names>O</given-names>
</name>
<name>
<surname>Peres</surname> <given-names>A</given-names>
</name>
<name>
<surname>Polak</surname> <given-names>P</given-names>
</name>
<name>
<surname>Lindeman</surname> <given-names>I</given-names>
</name>
<name>
<surname>Mikocziova</surname> <given-names>I</given-names>
</name>
<etal/>
</person-group>. <article-title>Mosaic deletion patterns of the human antibody heavy chain gene locus shown by Bayesian haplotyping</article-title>. <source>Nat Commun</source>. (<year>2019</year>) <volume>10</volume>:<fpage>628</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-019-08489-3</pub-id>
</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Th&#xf6;rnqvist</surname> <given-names>L</given-names>
</name>
<name>
<surname>Ohlin</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Computational inference, validation, and analysis of 5&#x2019;UTR-leader sequences of alleles of immunoglobulin heavy chain variable genes</article-title>. <source>Front Immunol</source>. (<year>2021</year>) <volume>12</volume>:<elocation-id>730105</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2021.730105</pub-id>
</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ohlin</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Poorly expressed alleles of several human immunoglobulin heavy chain variable genes are common in the human population</article-title>. <source>Front Immunol</source>. (<year>2020</year>) <volume>11</volume>:<elocation-id>603980</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2020.603980</pub-id>
</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Omer</surname> <given-names>A</given-names>
</name>
<name>
<surname>Shemesh</surname> <given-names>O</given-names>
</name>
<name>
<surname>Peres</surname> <given-names>A</given-names>
</name>
<name>
<surname>Polak</surname> <given-names>P</given-names>
</name>
<name>
<surname>Shepherd</surname> <given-names>AJ</given-names>
</name>
<name>
<surname>Watson</surname> <given-names>CT</given-names>
</name>
<etal/>
</person-group>. <article-title>VDJbase: an adaptive immune receptor genotype and haplotype database</article-title>. <source>Nucleic Acids Res</source>. (<year>2020</year>) <volume>48</volume>:<page-range>D1051&#x2013;D6</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkz872</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Martin Beem</surname> <given-names>JS</given-names>
</name>
<name>
<surname>Venkatayogi</surname> <given-names>S</given-names>
</name>
<name>
<surname>Haynes</surname> <given-names>BF</given-names>
</name>
<name>
<surname>Wiehe</surname> <given-names>K</given-names>
</name>
</person-group>. <article-title>ARMADiLLO: a web server for analyzing antibody mutation probabilities</article-title>. <source>Nucleic Acids Res</source>. (<year>2023</year>) <volume>51</volume>:<page-range>W51&#x2013;W6</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkad398</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wiehe</surname> <given-names>K</given-names>
</name>
<name>
<surname>Bradley</surname> <given-names>T</given-names>
</name>
<name>
<surname>Meyerhoff</surname> <given-names>RR</given-names>
</name>
<name>
<surname>Hart</surname> <given-names>C</given-names>
</name>
<name>
<surname>Williams</surname> <given-names>WB</given-names>
</name>
<name>
<surname>Easterhoff</surname> <given-names>D</given-names>
</name>
<etal/>
</person-group>. <article-title>Functional relevance of improbable antibody mutations for HIV broadly neutralizing antibody development</article-title>. <source>Cell Host Microbe</source>. (<year>2018</year>) <volume>23</volume>:<fpage>759</fpage>&#x2013;<lpage>65 e6</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.chom.2018.04.018</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kirik</surname> <given-names>U</given-names>
</name>
<name>
<surname>Persson</surname> <given-names>H</given-names>
</name>
<name>
<surname>Levander</surname> <given-names>F</given-names>
</name>
<name>
<surname>Greiff</surname> <given-names>L</given-names>
</name>
<name>
<surname>Ohlin</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Antibody heavy chain variable domains of different germline gene origins diversify through different paths</article-title>. <source>Front Immunol</source>. (<year>2017</year>) <volume>8</volume>:<elocation-id>1433</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2017.01433</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Persson</surname> <given-names>H</given-names>
</name>
<name>
<surname>Kirik</surname> <given-names>U</given-names>
</name>
<name>
<surname>Th&#xf6;rnqvist</surname> <given-names>L</given-names>
</name>
<name>
<surname>Greiff</surname> <given-names>L</given-names>
</name>
<name>
<surname>Levander</surname> <given-names>F</given-names>
</name>
<name>
<surname>Ohlin</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>
<italic>In vitro</italic> evolution of antibodies inspired by <italic>in vivo</italic> evolution</article-title>. <source>Front Immunol</source>. (<year>2018</year>) <volume>9</volume>:<elocation-id>1391</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2018.01391</pub-id>
</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Polonsky</surname> <given-names>K</given-names>
</name>
<name>
<surname>Pupko</surname> <given-names>T</given-names>
</name>
<name>
<surname>Freund</surname> <given-names>NT</given-names>
</name>
</person-group>. <article-title>Evaluation of the ability of alphaFold to predict the three-dimensional structures of antibodies and epitopes</article-title>. <source>J Immunol</source>. (<year>2023</year>) <volume>211</volume>:<page-range>1578&#x2013;88</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.4049/jimmunol.2300150</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Madsen</surname> <given-names>AV</given-names>
</name>
<name>
<surname>Mejias-Gomez</surname> <given-names>O</given-names>
</name>
<name>
<surname>Pedersen</surname> <given-names>LE</given-names>
</name>
<name>
<surname>Preben Morth</surname> <given-names>J</given-names>
</name>
<name>
<surname>Kristensen</surname> <given-names>P</given-names>
</name>
<name>
<surname>Jenkins</surname> <given-names>TP</given-names>
</name>
<etal/>
</person-group>. <article-title>Structural trends in antibody-antigen binding interfaces: a computational analysis of 1833 experimentally determined 3D structures</article-title>. <source>Comput Struct Biotechnol J</source>. (<year>2024</year>) <volume>23</volume>:<fpage>199</fpage>&#x2013;<lpage>211</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.csbj.2023.11.056</pub-id>
</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>deCamp</surname> <given-names>AC</given-names>
</name>
<name>
<surname>Corcoran</surname> <given-names>MM</given-names>
</name>
<name>
<surname>Fulp</surname> <given-names>WJ</given-names>
</name>
<name>
<surname>Willis</surname> <given-names>JR</given-names>
</name>
<name>
<surname>Cottrell</surname> <given-names>CA</given-names>
</name>
<name>
<surname>Bader</surname> <given-names>DLV</given-names>
</name>
<etal/>
</person-group>. <article-title>Human immunoglobulin gene allelic variation impacts germline-targeting vaccine priming</article-title>. <source>NPJ Vaccines</source>. (<year>2024</year>) <volume>9</volume>:<fpage>58</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41541-024-00811-5</pub-id>
</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>West</surname> <given-names>AP</given-names>
<suffix>Jr.</suffix>
</name>
<name>
<surname>Diskin</surname> <given-names>R</given-names>
</name>
<name>
<surname>Nussenzweig</surname> <given-names>MC</given-names>
</name>
<name>
<surname>Bjorkman</surname> <given-names>PJ</given-names>
</name>
</person-group>. <article-title>Structural basis for germ-line gene usage of a potent class of antibodies targeting the CD4-binding site of HIV-1 gp120</article-title>. <source>Proc Natl Acad Sci U S A</source>. (<year>2012</year>) <volume>109</volume>:<page-range>E2083&#x2013;90</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.1208984109</pub-id>
</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname> <given-names>T</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Moquin</surname> <given-names>S</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>B</given-names>
</name>
<name>
<surname>Acharya</surname> <given-names>P</given-names>
</name>
<etal/>
</person-group>. <article-title>Multidonor analysis reveals structural elements, genetic determinants, and maturation pathway for HIV-1 neutralization by VRC01-class antibodies</article-title>. <source>Immunity</source>. (<year>2013</year>) <volume>39</volume>:<page-range>245&#x2013;58</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.immuni.2013.04.012</pub-id>
</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Avnir</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Watson</surname> <given-names>CT</given-names>
</name>
<name>
<surname>Glanville</surname> <given-names>J</given-names>
</name>
<name>
<surname>Peterson</surname> <given-names>EC</given-names>
</name>
<name>
<surname>Tallarico</surname> <given-names>AS</given-names>
</name>
<name>
<surname>Bennett</surname> <given-names>AS</given-names>
</name>
<etal/>
</person-group>. <article-title>IGHV1&#x2013;69 polymorphism modulates anti-influenza antibody repertoires, correlates with IGHV utilization shifts and varies by ethnicity</article-title>. <source>Sci Rep</source>. (<year>2016</year>) <volume>6</volume>:<elocation-id>20842</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/srep20842</pub-id>
</citation>
</ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>McLean</surname> <given-names>GR</given-names>
</name>
<name>
<surname>Olsen</surname> <given-names>OA</given-names>
</name>
<name>
<surname>Watt</surname> <given-names>IN</given-names>
</name>
<name>
<surname>Rathanaswami</surname> <given-names>P</given-names>
</name>
<name>
<surname>Leslie</surname> <given-names>KB</given-names>
</name>
<name>
<surname>Babcook</surname> <given-names>JS</given-names>
</name>
<etal/>
</person-group>. <article-title>Recognition of human cytomegalovirus by human primary immunoglobulins identifies an innate foundation to an adaptive immune response</article-title>. <source>J Immunol</source>. (<year>2005</year>) <volume>174</volume>:<page-range>4768&#x2013;78</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.4049/jimmunol.174.8.4768</pub-id>
</citation>
</ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ohlin</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>A new look at a poorly immunogenic neutralization epitope on cytomegalovirus glycoprotein B. Is there cause for antigen redesign</article-title>? <source>Mol Immunol</source>. (<year>2014</year>) <volume>60</volume>:<fpage>95</fpage>&#x2013;<lpage>102</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.molimm.2014.03.015</pub-id>
</citation>
</ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hoh</surname> <given-names>RA</given-names>
</name>
<name>
<surname>Th&#xf6;rnqvist</surname> <given-names>L</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>F</given-names>
</name>
<name>
<surname>Godzwon</surname> <given-names>M</given-names>
</name>
<name>
<surname>King</surname> <given-names>JJ</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>JY</given-names>
</name>
<etal/>
</person-group>. <article-title>Clonal evolution and stereotyped sequences of human IgE lineages in aeroallergen-specific immunotherapy</article-title>. <source>J Allergy Clin Immunol</source>. (<year>2023</year>) <volume>152</volume>:<page-range>214&#x2013;29</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jaci.2023.02.009</pub-id>
</citation>
</ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Levin</surname> <given-names>M</given-names>
</name>
<name>
<surname>Levander</surname> <given-names>F</given-names>
</name>
<name>
<surname>Palmason</surname> <given-names>R</given-names>
</name>
<name>
<surname>Greiff</surname> <given-names>L</given-names>
</name>
<name>
<surname>Ohlin</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Antibody-encoding repertoires of bone marrow and peripheral blood-a focus on IgE</article-title>. <source>J Allergy Clin Immunol</source>. (<year>2017</year>) <volume>139</volume>:<page-range>1026&#x2013;30</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jaci.2016.06.040</pub-id>
</citation>
</ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Persson</surname> <given-names>H</given-names>
</name>
<name>
<surname>Flicker</surname> <given-names>S</given-names>
</name>
<name>
<surname>Sadegh</surname> <given-names>MK</given-names>
</name>
<name>
<surname>Greiff</surname> <given-names>L</given-names>
</name>
<name>
<surname>Valenta</surname> <given-names>R</given-names>
</name>
<name>
<surname>Ohlin</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>A common idiotype in IgE and its relation to recognition of the grass pollen allergen Phl p 2</article-title>. <source>Mol Immunol</source>. (<year>2008</year>) <volume>45</volume>:<page-range>2715&#x2013;20</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.molimm.2008.01.004</pub-id>
</citation>
</ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Levin</surname> <given-names>M</given-names>
</name>
<name>
<surname>Rotthus</surname> <given-names>S</given-names>
</name>
<name>
<surname>Wendel</surname> <given-names>S</given-names>
</name>
<name>
<surname>Najafi</surname> <given-names>N</given-names>
</name>
<name>
<surname>K&#xe4;llstr&#xf6;m</surname> <given-names>E</given-names>
</name>
<name>
<surname>Focke-Tejkl</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Multiple independent IgE epitopes on the highly allergenic grass pollen allergen Phl p 5</article-title>. <source>Clin Exp Allergy</source>. (<year>2014</year>) <volume>44</volume>:<page-range>1409&#x2013;19</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/cea.12423</pub-id>
</citation>
</ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Andr&#xe9;asson</surname> <given-names>U</given-names>
</name>
<name>
<surname>Flicker</surname> <given-names>S</given-names>
</name>
<name>
<surname>Lindstedt</surname> <given-names>M</given-names>
</name>
<name>
<surname>Valenta</surname> <given-names>R</given-names>
</name>
<name>
<surname>Greiff</surname> <given-names>L</given-names>
</name>
<name>
<surname>Korsgren</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>The human IgE-encoding transcriptome to assess antibody repertoires and repertoire evolution</article-title>. <source>J Mol Biol</source>. (<year>2006</year>) <volume>362</volume>:<page-range>212&#x2013;27</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jmb.2006.06.062</pub-id>
</citation>
</ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Persson</surname> <given-names>H</given-names>
</name>
<name>
<surname>Sadegh</surname> <given-names>MK</given-names>
</name>
<name>
<surname>Greiff</surname> <given-names>L</given-names>
</name>
<name>
<surname>Ohlin</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Delineating the specificity of an IgE-encoding transcriptome</article-title>. <source>J Allergy Clin Immunol</source>. (<year>2007</year>) <volume>120</volume>:<page-range>1186&#x2013;92</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jaci.2007.06.041</pub-id>
</citation>
</ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Persson</surname> <given-names>J</given-names>
</name>
<name>
<surname>Augustsson</surname> <given-names>P</given-names>
</name>
<name>
<surname>Laurell</surname> <given-names>T</given-names>
</name>
<name>
<surname>Ohlin</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Acoustic microfluidic chip technology to facilitate automation of phage display selection</article-title>. <source>FEBS J</source>. (<year>2008</year>) <volume>275</volume>:<page-range>5657&#x2013;66</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1742-4658.2008.06691.x</pub-id>
</citation>
</ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mikus</surname> <given-names>M</given-names>
</name>
<name>
<surname>Zandian</surname> <given-names>A</given-names>
</name>
<name>
<surname>Sj&#xf6;berg</surname> <given-names>R</given-names>
</name>
<name>
<surname>Hamsten</surname> <given-names>C</given-names>
</name>
<name>
<surname>Forsstr&#xf6;m</surname> <given-names>B</given-names>
</name>
<name>
<surname>Andersson</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Allergome-wide peptide microarrays enable epitope deconvolution in allergen-specific immunotherapy</article-title>. <source>J Allergy Clin Immunol</source>. (<year>2021</year>) <volume>147</volume>:<page-range>1077&#x2013;86</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jaci.2020.08.002</pub-id>
</citation>
</ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Th&#xf6;rnqvist</surname> <given-names>L</given-names>
</name>
<name>
<surname>Sj&#xf6;berg</surname> <given-names>R</given-names>
</name>
<name>
<surname>Greiff</surname> <given-names>L</given-names>
</name>
<name>
<surname>van Hage</surname> <given-names>M</given-names>
</name>
<name>
<surname>Ohlin</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Linear epitope binding patterns of grass pollen-specific antibodies in allergy and in response to allergen-specific immunotherapy</article-title>. <source>Front Allergy</source>. (<year>2022</year>) <volume>3</volume>:<elocation-id>859126</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/falgy.2022.859126</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>