<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2025.1597776</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Immunology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Zika virus induces monocyte recruitment in the immunocompetent adult brain driving chronic inflammation</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Garcia Diaz</surname>
<given-names>Josefina</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2182768/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Park</surname>
<given-names>Soo-Jeung</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1513484/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Legouez</surname>
<given-names>Lou</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Comlekoglu</surname>
<given-names>Tina</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3007298/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Beck</surname>
<given-names>Ashley</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Kuan</surname>
<given-names>Chia-Yi</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/371224/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Hahn</surname>
<given-names>Young S.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/355536/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Beirne B. Carter Center for Immunology Research, University of Virginia</institution>, <addr-line>Charlottesville, VA</addr-line>,&#xa0;<country>United States</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Department of Microbiology, Immunology and Cancer Biology, University of Virginia</institution>, <addr-line>Charlottesville, VA</addr-line>,&#xa0;<country>United States</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Department of Neuroscience, Center for Brain Immunology and Glia (BIG), University of Virginia School of Medicine</institution>, <addr-line>Charlottesville, VA</addr-line>,&#xa0;<country>United States</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Luisa F. Duarte, Universidad del Desarrollo, Chile</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Chengjin Ye, Texas Biomedical Research Institute, United States</p>
<p>Karen Bohmwald, Autonomous University of Chile, Chile</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Young S. Hahn, <email xlink:href="mailto:ysh5e@virginia.edu">ysh5e@virginia.edu</email>
</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>04</day>
<month>07</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2025</year>
</pub-date>
<volume>16</volume>
<elocation-id>1597776</elocation-id>
<history>
<date date-type="received">
<day>21</day>
<month>03</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>18</day>
<month>06</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Garcia Diaz, Park, Legouez, Comlekoglu, Beck, Kuan and Hahn</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Garcia Diaz, Park, Legouez, Comlekoglu, Beck, Kuan and Hahn</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>Zika virus (ZIKV) is a neurotropic pathogen linked to neuropathogenesis in adults, causing conditions such as Guillain-Barr&#xe9; syndrome (GBS) and fatal encephalitis. Intracranial injection of virus in immunocompromised mice have shown neuroinflammation and subsequent brain damage. However, the mechanisms underlying ZIKV-induced neuroinflammation in immunocompetent adult mice via peripheral infection remain unclear. To investigate this, we utilized a murine model of ZIKV infection via footpad injection. Our findings reveal that acute ZIKV infection at 4 days post-infection (4 dpi) induces significant apoptosis and neuroinflammation in the adult brain, persisting up to 28 dpi. Notably, ZIKV infection triggers apoptosis in the hippocampus and cortex&#x2014;key regions involved in memory&#x2014;and induces early immune cell infiltration. Additionally, microglial activation occurs following infection at 7 dpi, with viral RNA detected in the brain. Bulk RNA sequencing of the hippocampus at 28 dpi further reveals the activation of inflammatory pathways, underscoring the prolonged neuroinflammatory response in the infected brain. Microglial activation is likely driven by infiltrating monocytes, as inhibiting monocyte recruitment reduced the expression of microglial activation genes. These results suggest that targeting monocyte-induced inflammatory mediators could be potential therapeutic interventions for ZIKV.</p>
</abstract>
<kwd-group>
<kwd>zika (ZIKV)</kwd>
<kwd>monocytes</kwd>
<kwd>microglia</kwd>
<kwd>neuroinflammation</kwd>
<kwd>immunocompetent adult brain</kwd>
</kwd-group>
<counts>
<fig-count count="9"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="51"/>
<page-count count="17"/>
<word-count count="6736"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Viral Immunology</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Zika virus (ZIKV) is a single-stranded positive RNA virus belonging to the Flaviviridae family. ZIKV is primarily transmitted through the bite of a mosquito, though sexual and vertical transmission can also occur (<xref ref-type="bibr" rid="B1">1</xref>, <xref ref-type="bibr" rid="B2">2</xref>). Global travel and climate change have expanded the populations of human carriers and the geographical range of mosquito vectors to transmit the virus (<xref ref-type="bibr" rid="B3">3</xref>). Of particular concern is ZIKV, which has shown an increased infection rate from 1998-2018, with Brazil having reported 440,000-1,300,000 suspected cases in 2015. While ZIKV infection in pregnancy is well-known for causing microcephaly in the fetal brain, adults infected with ZIKV had detectable viral RNA in the brains and impaired cognitive function (<xref ref-type="bibr" rid="B4">4</xref>, <xref ref-type="bibr" rid="B5">5</xref>). ZIKV infection in adults has been associated with severe neurological outcomes, including acute encephalitis, Guillain-Barr&#xe9; syndrome (an autoimmune neuropathy causing weakness, paralysis, or even death), and long-term cognitive impairments (<xref ref-type="bibr" rid="B6">6</xref>, <xref ref-type="bibr" rid="B7">7</xref>). Around 20% of symptomatic adults report rash, fever, conjunctivitis, and headache (<xref ref-type="bibr" rid="B8">8</xref>). Approximately 0.3% of ZIKV-infected individuals develop neurological sequelae, with 75% of these cases resulting in GBS (<xref ref-type="bibr" rid="B9">9</xref>, <xref ref-type="bibr" rid="B10">10</xref>). In rare but concerning cases, ZIKV has been linked to acute encephalitis and long-term cognitive decline (<xref ref-type="bibr" rid="B4">4</xref>, <xref ref-type="bibr" rid="B5">5</xref>, <xref ref-type="bibr" rid="B11">11</xref>&#x2013;<xref ref-type="bibr" rid="B13">13</xref>). Some studies have further explored connections between viral infections and neurodegeneration; for example, ZIKV exposure <italic>in vitro</italic> has been shown to increase amyloid-&#x3b2; production, and ZIKV-infected brain organoids exhibit Alzheimer&#x2019;s-like pathology, including elevated A&#x3b2; and phosphorylated tau (<xref ref-type="bibr" rid="B14">14</xref>&#x2013;<xref ref-type="bibr" rid="B18">18</xref>).</p>
<p>Microglia, the brain&#x2019;s resident macrophages, are central to clearing extracellular debris and releasing pro-inflammatory cytokines and neurotoxins (<xref ref-type="bibr" rid="B19">19</xref>, <xref ref-type="bibr" rid="B20">20</xref>). Pathogenic microglia can exacerbate brain injury by inducing pro-inflammatory A1-astrocytes (<xref ref-type="bibr" rid="B21">21</xref>). Microglial-derived neurotoxins can be packaged into exosomes and released into the CNS, amplifying neuroinflammation (<xref ref-type="bibr" rid="B22">22</xref>), and tau-laden exosomes from microglia contribute to Alzheimer&#x2019;s disease pathogenesis (<xref ref-type="bibr" rid="B23">23</xref>). ZIKV infection has been shown to activate microglia in both immunocompromised mouse models and intracerebroventricular (ICV) injection studies (<xref ref-type="bibr" rid="B24">24</xref>). Furthermore, microglia can communicate with astrocytes and prolong immune activation, disrupting the BBB (<xref ref-type="bibr" rid="B51">51</xref>). However, the role of microglia in immunocompetent models via peripheral infection remains understudied. Monocytes, derived from bone marrow, infiltrate the brain following infection and may exacerbate neurological damage. ZIKV-infected monocytes exhibit enhanced transmigration across the blood-brain barrier (BBB), upregulate adhesion genes, and release exosomes containing infectious viral particles (<xref ref-type="bibr" rid="B24">24</xref>&#x2013;<xref ref-type="bibr" rid="B28">28</xref>). These findings underscore the importance of investigating ZIKV&#x2019;s effects on monocyte-microglia interactions to better understand and mitigate virus-induced neuroinflammation and cognitive dysfunction.</p>
<p>To better understand ZIKV neuropathogenesis and assess potential therapies, it is crucial to establish an animal model that mirrors human disease. Intracerebral ZIKV inoculation in immunocompetent adult mice demonstrates CNS infection and damage (<xref ref-type="bibr" rid="B29">29</xref>). In this model, antiviral responses are driven by microglia, infiltrating monocytes, and macrophages, suggesting that innate and adaptive immunities play a key role in ZIKV-associated encephalitis. Another widely used model, Ifnar1 knockout mice in a C57BL/6 genetic background, lacks type-I IFN&#x3b1;/IFN&#x3b2; responses and shows heightened susceptibility to viral replication and neurological damage (<xref ref-type="bibr" rid="B30">30</xref>). However, due to their compromised immune systems, these mice are not ideal for testing antiviral agents targeting innate immunity. To address this, a murine model was developed using wild-type C57BL/6 mice, with transient inhibition of type I IFN signaling through anti-IFNR antibody injection one day before ZIKV infection. This model is susceptible to infection and develops severe neuropathological changes, making it valuable for studying ZIKV neuropathogenesis (<xref ref-type="bibr" rid="B31">31</xref>, <xref ref-type="bibr" rid="B32">32</xref>).</p>
<p>In this report, we investigated how ZIKV affects the immunocompetent adult brain by using a transiently inhibited IFNAR mouse model. We found that during acute infection, ZIKV infection induces robust expression of inflammatory genes, such as <italic>IL-6</italic>, <italic>TNF&#x3b1;</italic>, and IL-1&#x3b2; in the brain. Notably, infected mice exhibited prolonged neuroinflammation and sustained microglial activation. Inhibition of monocyte recruitment attenuated microglial activation markers, implicating infiltrating monocytes as key drivers of neuroinflammatory microglial responses. These findings suggest that ZIKV-infected monocytes contribute to CNS injury through microglial activation. The understanding of ZIKV-associated CNS damage will help for the development of targeted therapies to prevent long-term neurological damage in adults.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Virus</title>
<p>The Uganda isolate (strain MR766) of zika virus was obtained from Dr. Michael Gale. For making new viral stocks, Vero cells were cultured and infected with an MOI of 0.05 of ZIKV. 10 mL of serum free media (DMEM) was added for 4 hours while shaking, followed by adding 20mL of 10% FBS-containing media. Cells were then harvested and stored in -80C after successful viral replication at 3&#x2013;5 days post infection. Plaque assays were performed to quantify infectious virus titers. Serial 10-fold dilutions of thawed viral stocks were prepared in serum-free DMEM, beginning with a 1:10 dilution (50 &#x3bc;L virus into 450 &#x3bc;L medium) and proceeding to 10<sup>-8</sup>. Vero cell monolayers were washed with serum-free media and infected with 200 &#x3bc;L of each dilution in duplicates. Plates were incubated at 37&#xb0;C for 2 hours, with gentle swirling every 15 minutes to promote viral infection. Following incubation, cells were washed three times with serum-free media to remove unbound virus. An overlay medium containing either 1% agarose or 0.3&#x2013;0.6% Avicel in DMEM (supplemented with 10% FBS and NaHCO<sub>3</sub>) was applied gently (4 mL/well). Plates were incubated for 5 days. After incubation, cells were fixed in 10% formaldehyde in PBS and stained with 0.1% crystal violet. Plaques were counted in wells containing 5&#x2013;100 plaques, and titers were calculated as PFU/mL using the formula: Plaques/(dilution factor * volume added)= pfu/mL. Multiple dilutions were used to determine titer accuracy, and the assay was repeated for reproducibility.</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Real-time quantitative PCR</title>
<p>For RNA isolation, Trizol was used following the Trizol induced RNA isolation protocol (Invitrogen). Following RNA isolation, the RNA was resuspended in nuclease free water and the quality/concentration of the RNA was assessed by nano-drop 2000 spectrophotometer (Thermo Scientific). For brain tissue, 1500ng of RNA was used for cDNA. cDNA synthesis was done using High-capacity RNA-tocDNA kit (Applied Biosystems). Real-time PCR was performed on a StepOnePlus system (Applied Biosystems). Primers were used for target gene quantification using SYBR green master mix (Applied Biosystems). Target gene expressions were determined using comparative cycle threshold (&#x394;&#x394;CT) technique and results normalized to HPRT. Please see <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref> for primer sequences.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Primer sequences: List of primers used for RT-qPCR with the corresponding forward and reverse sequences.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Gene</th>
<th valign="top" align="left">Forward sequence</th>
<th valign="top" align="left">Reverse sequence</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">
<italic>HPRT</italic>
</td>
<td valign="top" align="left">GTGTTCTAGTCCTGTGGCCA</td>
<td valign="top" align="left">TCAAAAGTCTGGGGACGCAG</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>NS5</italic>
</td>
<td valign="top" align="left">AARTACACATACCARAACAAAGTGGT</td>
<td valign="top" align="left">TCCRCTCCCYCTYTGGTCTTG</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>PRM</italic>
</td>
<td valign="top" align="left">TTGGTCATGATACTGCTGATTGC</td>
<td valign="top" align="left">CCCTCCACGAAGTCTCTATTGC</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>IL6</italic>
</td>
<td valign="top" align="left">GAGGATACCACTCCCAACAGACC</td>
<td valign="top" align="left">AAGTGCATCATCGTTGTTCATACA</td>
</tr>
<tr>
<td valign="top" align="left">TNF&#x3b1;</td>
<td valign="top" align="left">GGTGCCTATGTCTCAGCCTCTT</td>
<td valign="top" align="left">GCCATAGAACTGATGAGAGGGAG</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>IL1&#x3b2;</italic>
</td>
<td valign="top" align="left">CTTTCGACAGTGAGGAGAATGAC</td>
<td valign="top" align="left">CAAGACATAGGTAGCTGCCACAG</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>APOE</italic>
</td>
<td valign="top" align="left">CTGACAGGATGCCTAGCCG</td>
<td valign="top" align="left">CGCAGGTAATCCCAGAAGC</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>CD86</italic>
</td>
<td valign="top" align="left">TGTTTCCGTGGAGACGCAAG</td>
<td valign="top" align="left">TTGAGCCTTTGTAAATGGGCA</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>CH25H</italic>
</td>
<td valign="top" align="left">CTGCCTGCTGCTCTTCGACA</td>
<td valign="top" align="left">CCGACAGCCAGATGTTAATCA</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>CX3CR1</italic>
</td>
<td valign="top" align="left">ACCGGTACCTTGCCATCGT</td>
<td valign="top" align="left">ACACCGTGCTGCACTGTCC</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>P2RY12</italic>
</td>
<td valign="top" align="left">TTTCAGATCCGCAGTAAATCCAA</td>
<td valign="top" align="left">GGCTCCCAGTTTAGCATCACTA</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>RIG-I</italic>
</td>
<td valign="top" align="left">GAGAGTCACGGGACCCACT</td>
<td valign="top" align="left">CGGTCTTAGCATCTCCAACG</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>ISG15</italic>
</td>
<td valign="top" align="left">CTGAAGAAGCAGATTGCCCAGAAG</td>
<td valign="top" align="left">CGCTGCAGTTCTGTACCACTAGC</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Mice, microscopy</title>
<p>The mouse experiments were approved by the University of Virginia Animal Care and Use Committee (ACUC). This study was conducted under approved bioethics protocols, including IBC protocol #077&#x2013;99 for biological agents. Further all animal procedures were approved by the Institutional Animal Care and Use Committee (IACUC) under protocol number 2720-10-22. CX3CR1-GFP and CCR2-CreER;R26R-EGFP (Ai6) mice were kindly provided by Dr. Chia-Yi Kuan&#x2019;s lab, UVA professor. Mice were injected with IFNAR via IP injection (2mg/mL, 200uL injected) one day prior to footpad injection of ZIKV (10^4/10^5/10^6, 50uL). RS-102895 from SIGMA, a CCR2 inhibitor, was administered via IP injection at 1 hpi and at 24 hpi. Mice were euthanized using 60uL of Avertin (10 g of 2,2,2-tribromoethyl alcohol with 10 ml of tert-amyl alcohol to make 100% Avertin, freshly diluted to 2.5% in saline before each use) via IP injection to avoid brain injury that other methods may impose. Decapitation was performed to ensure death as a secondary confirmation method, along with the removal of the brain tissue for studies. Following euthanizing, mouse blood was collected, and perfusion was performed using 1XPBS. Tissue was then harvested and stored in appropriate medium for downstream applications.</p>
<p>For microscopy, harvested brains were kept in 4% PFA overnight and then placed in 30% Sucrose, before being frozen in OCT. Brain was sliced, and slices were placed on a histological slide and stored until staining. Tissue staining was performed following a modified STAR protocols 100499, Sep 17, 2021. Primary antibodies used were SALL1 (eBioscience), and GFAP (sc33673), and secondary antibodies used were AF647 (Invitrogen). UVA microscopy core Leica Thunder widefield microscope was utilized for data acquisition. Exposure, gain and intensity were kept the same for all samples to ensure rigor. Additionally, images were captured on the same day for fair comparisons. Images were captured at various resolutions 40x and 100x. Analysis of images was performed using IMARIS 10.2.0 software version. Using IMARIS software identical region areas and analysis parameters were applied across all images to ensure consistency. Cells were counted in IMARIS using the spots feature with their representative intensities being measured through spots. This work used the Leica thunder TIRF widefield imaging microscope in the Molecular Imaging Core Facility which is supported by the University of Virginia School of Medicine, Research Resource Identifiers (RRID): SCR_025472.</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>IHC</title>
<p>Mouse brains were harvested and stored in 10% Formalin for 48 hours before being transferred to cassettes in 70% ETOH. Brains were submitted to UVA Research Histology Core for paraffin embedding and H&amp;E/Oil red staining. For tissues used in H&amp;E analysis H&amp;E staining and paraffin slides, work was done in the Research Histology Core Facility which is supported by the University of Virginia School of Medicine, Research Resource Identifiers (RRID): SCR_025470. TUNEL assay was performed using the ab206386 TUNEL Assay kit HRP-DAB following manufactures instructions. TUNEL-positive cells were manually counted in a defined region of interest (ROI) in the hippocampus/cortex.</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Flow cytometry</title>
<p>Bone marrow immune cells were isolated from mouse femurs and 1mL of RBC buffer was added to cell pellet to remove red blood cells. After centrifugation, cells were washed with 1X PBS and then resuspended in FC buffer. Brain immune cells were isolated using a digestion buffer consisting of: Papain at 0.1 mg/mL, DNase I 1ug/mL, and 1X HBSS without Ca++ and Mg++. Briefly, after brain tissue was isolated from mice, they were placed in 1X PBS to wash as the next tissues were isolated. Following the end of the harvest, brains were transferred to a small cell culture dish where they were cut in half, and one section was used for PCR/IHC, and the other to continue flow analysis. The one hemisphere for flow was minced to around small &lt;1mm pieces and 1mL of the digestion buffer was added. The minced brains were then transferred to a 15mL tube where 6mL of digestion buffer was added. Brains were then placed in 37&#xb0;C for 30 minutes with gentle agitation throughout. Following incubation, brains were filtered through a 100um filter and rinsed with sample preparation medium consisting of 1X HBSS without Ca++ and Mg++ and 10% FBS. Brains were centrifuged at 1350rpm for 10 minutes and 30% Percoll was added to the cell pellet. Centrifugation again at 700g for 10 minutes with the brake off resulted in a cell pellet. The isolated immune cells were washed with 1X PBS and then resuspended in FC buffer for flow analysis. Antibodies used for staining were eBioscience F4/80-FITC, BD pharmigen CD11B-perCP-Cy5.5, Invitrogen CD45-APC, Invitrogen LY6G-PE, eBiosceince, and Invitrogen live/dead fixable violet dead cell stain. Results from experiment were analyzed using FlowJo.</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Bulk sequencing</title>
<p>Mice were harvested and the hippocampus was quickly isolated and stored in RNAlater before processing. RNA was isolated from the tissue as mentioned previously and library preparation was conducted by the UVA genome analysis and technology core. Data analysis was conducted in Rstudio using Deseq2 and GO enrichment analysis to search for gene pathways. Library preparation and sequencing was done by the University of Virginia School of Medicine Genome Analysis and Technology Core, RRID: SCR_018883.</p>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Luminex analysis</title>
<p>Mouse BMDMs were cultured and infected with MR766 for 24hr. Supernatant was obtained and stored at -80&#xb0;C until used for assay. Protein from cells were isolated using Cell Lysis Buffer II (Invitrogen) supplemented with 1mM PMSF and Protease Inhibitor Cocktail (Thermofisher), according to the manual instructions. Protein concentrations were determined through use of Pierce BCA kit (Thermofisher) and concentrations were diluted to 0.5 &#x3bc;g/&#x3bc;L using 1X PBS. Mouse 32 Plex Luminex assay was run by UVA&#x2019;s Flow Cytometry Core Facility.</p>
</sec>
<sec id="s2_8">
<label>2.8</label>
<title>ELISA</title>
<p>ELISAs were performed according to Biolegends ELISA protocol for mouse IL1<italic>&#x3b2;</italic>. BMDM supernatants were used in assessing protein amounts. Briefly, ELISA plates were coated with 100uL of IL1<italic>&#x3b2;</italic> capture antibody overnight at 4C and after washing the plates assay diluent provided was used for the blocking step. Next after washing, the samples and standards were added for 2 hours at RT. Detection antibody was then added for an hour followed by Avidin-HRP for 30 minutes at RT. Lastly, TMB substrate solution incubation in the dark for 15 minutes was performed before adding the stop solution and reading the wells. Protein amounts were assessed using an absorbance reader at 450nm within 15minutes.</p>
</sec>
<sec id="s2_9">
<label>2.9</label>
<title>Statistics</title>
<p>GraphPad Prism version 9 was used for conducting statistical analysis of data obtained throughout the experiments. Unpaired t-tests were conducted and values of p &lt; 0.05 were regarded as statistically significant. Statistical tests were performed for controls vs treated groups. Data represents the mean &#xb1; SD with <sup>&#x2217;</sup>p &lt; 0.0332, <sup>&#x2217;&#x2217;</sup>p &lt; 0.0021, and <sup>&#x2217;&#x2217;&#x2217;</sup>p &lt; 0.0002, <sup>&#x2217;&#x2217;&#x2217;&#x2217;</sup>p &lt; 0.0001.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Acute ZIKV infection induces cell apoptosis in the hippocampus and cortex of the adult brain leading to chronic neurological deficits</title>
<p>C57BL/6 adult mice were infected with ZIKV (MR766 strain; 10^6 PFU) via footpad injection to assess the impact of ZIKV on neuropathogenesis in the adult brain. One day before infection, IFNAR antibody, an IFN-A receptor antagonist, was administered to enable efficient viral infection, as ZIKV NS5 protein cannot effectively inhibit STAT2 in mice (<xref ref-type="bibr" rid="B33">33</xref>). Brain tissues were collected from uninfected (UI) and infected mice at 4-, 7-, and 28-days post-infection (dpi) (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). As ZIKV targets memory-related regions, particularly the hippocampus and cortex, histological analysis focused on these areas. H&amp;E staining revealed a reduction in the length of the dentate gyrus blade in the hippocampus at 4 dpi, returning to near baseline by 7 and 28 dpi (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1B, C</bold>
</xref>). Additionally, the hippocampal area expanded at 28 dpi, and notable immune cell infiltration was observed in the cortex (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1B, C</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Hippocampal area altered by ZIKV followed by cell death in the adult hippocampus and cortex. <bold>(A)</bold> C57BL/6 mice were injected with 10^6 PFU of ZIKV via footpad and brains were harvested at 0, 4, 7 and 28 dpi. <bold>(B)</bold> C57BL/6 mice H&amp;E data images in hippocampus (5x) and cortex (10x). <bold>(C)</bold> C57BL/6 mice H&amp;E data dentate gyrus (DG) blade length quantification, H&amp;E hippocampus area measurement and H&amp;E cortex positive cell count detection, n=3-4. <bold>(D)</bold> Corpus callosum H&amp;E with quantification (10x, 20x). <bold>(E)</bold> TUNEL images of mouse hippocampus and cortex 15x. Followed by quantification. TUNEL-positive cells were manually counted in a defined region of interest (ROI) in the hippocampus/cortex. <bold>(F)</bold> 40X immunofluorescence of GFAP in corpus callosum for UI and D28. N=3-4. Data represents the mean &#xb1; SD <sup>&#x2217;</sup>p &lt; 0.0332. The experiment was independently repeated twice with similar results; representative data are shown.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1597776-g001.tif">
<alt-text content-type="machine-generated">Diagram detailing the effects of ZIKV infection in C57BL/6 mice over a 28-day period. Panels include a timeline of infection and tissue harvest, histological images of hippocampus and cortex, graphs showing various measurements like DG blade length, hippocampus area, and cortex cell counts, and immunohistochemical analysis indicating changes in cell structures. Comparisons are drawn between uninfected controls and different days post-infection, highlighting cell alterations. Additional graphs, images, and fluorescence microscopy with DAPI and GFAP staining illustrate cellular differences at the final time points.</alt-text>
</graphic>
</fig>
<p>Furthermore, immune cell infiltration was observed in the corpus callosum at 4 dpi (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1D</bold>
</xref>). To determine if this immune response was linked to neuronal cell death, we performed a TUNEL assay at multiple time points. At 4 dpi, TUNEL-positive cells were detected in both the hippocampus and cortex (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1E</bold>
</xref>), indicating apoptosis in these memory-related regions. No TUNEL-positive cells were observed at later time points (<xref ref-type="supplementary-material" rid="SF1">
<bold>Supplementary Figure&#xa0;1C</bold>
</xref>), suggesting a subsidence of apoptosis over time. However, other forms of cell death may contribute to chronic brain damage. Additionally, because astrocytes are key modulators for the BBB, we wanted to briefly identify any changes in these cell types for our mice (<xref ref-type="bibr" rid="B21">21</xref>). Astrocyte marker GFAP was reduced in the corpus callosum of the ZIKV-infected mice (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1F</bold>
</xref>). These findings demonstrate acute and chronic brain pathology in adult immunocompetent mouse models following ZIKV infection.</p>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>ZIKV RNA and inflammatory genes are detectable in the brain during acute infection</title>
<p>To assess ZIKV presence and the inflammatory response, we performed RT-qPCR for ZIKV RNA and inflammatory gene markers. High levels of ZIKV RNA (<italic>NS5</italic>, <italic>PRM</italic>) were detected in the spleen at 4 dpi, with a decline over time (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2A, B</bold>
</xref>), confirming viral infection in adult mice. In contrast, ZIKV RNA was only detectable in the brain at 7 dpi (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2C, D</bold>
</xref>), despite the observed pathology at 4 dpi (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>). We then analyzed the expression of <italic>RIG-I</italic> and <italic>ISG15</italic>, genes induced by viral RNA as pathogen-associated molecular patterns (PAMPs). Notably, <italic>RIG-I</italic> and <italic>ISG15</italic> expression were elevated at 4 dpi and 7 dpi, suggesting viral RNA presence on day 4, despite being below the RT-qPCR detection threshold (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2E, F</bold>
</xref>).</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Inflammation observed in ZIKV infected adult brain. <bold>(A, B)</bold> RT-qPCR of ZIKV NS5, PrM in C57BL/6 mice spleens. <bold>(C&#x2013;I)</bold> RT-qPCR of ZIKV NS5, PrM, RIG-I, ISG15, TNFa, IL1B and IL6 and in mouse brain for UI, D4, D7 and D28. N=3-8. Data represents the mean &#xb1; SD <sup>&#x2217;</sup>p &lt; 0.0332, <sup>&#x2217;&#x2217;</sup>p &lt; 0.0021, and <sup>&#x2217;&#x2217;&#x2217;&#x2217;</sup>p &lt; 0.0001. The experiment was independently repeated twice with similar results; representative data are shown.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1597776-g002.tif">
<alt-text content-type="machine-generated">Bar graphs illustrate the fold change of specific markers in the spleen and brain over different days (UI, D4, D7, D28). Spleen markers depicted are ZIKV NS5 and ZIKV PRM, with significant changes indicated. Brain markers include ZIKV NS5, ZIKV PRM, RIG-I, ISG15, TNFa, IL1B, and IL6, each showing varying degrees of change and statistical significance over time. Error bars indicate variability, and asterisks denote levels of statistical significance.</alt-text>
</graphic>
</fig>
<p>Additionally, proinflammatory cytokine genes, IL1&#x3b2; and TNF&#x3b1;, were elevated at 7 dpi, and IL6 was upregulated on 4 dpi, in brain tissue (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2G&#x2013;I</bold>
</xref>). IL6 and TNF&#x3b1; gene levels remained elevated in the hippocampus at 4, 7, and 28 dpi (<xref ref-type="supplementary-material" rid="SF1">
<bold>Supplementary Figures&#xa0;1A, B</bold>
</xref>). These results indicate that viral RNA, rather than viral replication alone, triggers PAMP signaling and the innate immune response, contributing to neuroinflammation and potential CNS damage.</p>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Increased expression of microglial inflammatory genes and microglial activation following ZIKV infection</title>
<p>Disease-associated microglia (DAMs) are prominent in Alzheimer&#x2019;s disease (AD) and play a role in exacerbating brain pathology (<xref ref-type="bibr" rid="B23">23</xref>, <xref ref-type="bibr" rid="B30">30</xref>). To determine if DAMs are involved in ZIKV-related brain damage, mice were infected with varying doses of ZIKV (uninfected, 10^4, 10^5, and 10^6 PFU). Brain tissues were then harvested at 4 dpi for DAMs gene analysis. Notably, microglial activation markers such as APOE and TREM2, associated with DAMs, increased with higher viral doses (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3A, B</bold>
</xref>). Inflammatory markers CH25H and CD86 also peaked at 10^6 PFU, indicating a dose-dependent inflammatory response (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3C, D</bold>
</xref>). CH25H, an enzyme that converts cholesterol to 25-HC, is known to trigger proinflammatory cytokine production (<xref ref-type="bibr" rid="B20">20</xref>). Our prior studies showed CH25H upregulation in microglia following ZIKV infection (<xref ref-type="bibr" rid="B34">34</xref>). Of note, lower viral doses showed similar trends without statistical significance.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>10^6 PFU viral dose results in pronounced microglial activation. <bold>(A&#x2013;D)</bold> RT-qPCR of APOE, TREM2, CH25H and CD86 expression with varying doses of ZIKV (UI, 10^4,10^5,10^6) for 4dpi. N=3-5. Data represents the mean &#xb1; SD <sup>&#x2217;</sup>p &lt; 0.0332. The experiment was independently repeated twice with similar results; representative data are shown.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1597776-g003.tif">
<alt-text content-type="machine-generated">Bar graphs labeled A to D showing fold change for genes APOE, TREM2, CH25H, and CD86 across different conditions: UI, 10^4, 10^5, 10^6. Asterisks indicate significant differences, showing trends of increased expression with higher values. Error bars suggest variability in data.</alt-text>
</graphic>
</fig>
<p>We next assessed microglial morphology in CX3CR1-GFP reporter mice (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>). Widefield fluorescence microscopy was utilized to localize specific brain regions before examining areas of interest. At 7 dpi, ZIKV-infected mice exhibited altered microglial morphology, indicative of an activated, stressed state (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>) (<xref ref-type="bibr" rid="B19">19</xref>). The extended microglia morphology suggests activation, likely in response to viral PAMPs or signals from infiltrating cells (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>). The expression of sall1 confirms that CX3CR1-GFP mice are labeling microglia, as sall1 is a common microglial marker (<xref ref-type="bibr" rid="B35">35</xref>). Additionally the lack of sall1 on some CX3CR1-GFP cells suggests a downregulation of the homeostatic marker for microglia, further indicating microglial activation (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4C</bold>
</xref>) (<xref ref-type="bibr" rid="B35">35</xref>).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>ZIKV results in activated microglia with a change in morphology. <bold>(A)</bold> CX3CR1-GFP mice were injected with ZIKV at 10^6 PFU via footpad, brains were harvested at 0 and 7dpi. <bold>(B)</bold> 100X immunofluorescence imaging of mouse cortex staining for DAPI and CX3CR1. <bold>(C)</bold> 100X immunofluorescence of mouse cortex to assess microglial morphology using sall1 and CX3CR1-GFP. <bold>(D)</bold> PCR data for CD86, CX3CR1 and CH25H genes, N=3. Data represents the mean &#xb1; SD <sup>&#x2217;</sup>p &lt; 0.0332, <sup>&#x2217;&#x2217;</sup>p &lt; 0.0021. The experiment was independently repeated twice with similar results; representative data are shown.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1597776-g004.tif">
<alt-text content-type="machine-generated">Diagram showing an experiment with mice injected with ZIKV. Panel A illustrates the injection procedure. Panel B shows DAPI and CX3CR1-GFP staining in UI and D7 samples, highlighting green fluorescence. Panel C displays SALL1 staining alongside CX3CR1-GFP, with merged images showing colocalization in green and red. Panel D presents bar graphs depicting fold changes in CD86, CX3CR1, and CH25H expression between UI and D7, indicating statistical significance with asterisks.</alt-text>
</graphic>
</fig>
<p>Moreover, RT-qPCR of brain tissue showed elevated <italic>CD86, CX3CR1</italic>, and <italic>CH25H</italic> expression in infected mice at 7 dpi compared to controls, consistent with microglial activation (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4D</bold>
</xref>). Notably, in Alzheimer&#x2019;s, CH25H inhibition reduces neurodegeneration and neuroinflammation, particularly in the hippocampus (PS19 mice) (<xref ref-type="bibr" rid="B36">36</xref>). Given CH25H&#x2019;s role in lipid metabolism, we examined lipid deposits in ZIKV-infected brains. Oil-Red staining revealed lipid accumulation in the hippocampus of infected mice at 7 dpi (<xref ref-type="supplementary-material" rid="SF2">
<bold>Supplementary Figure&#xa0;2</bold>
</xref>), indicating dysregulated lipid metabolism. These findings suggest that activated microglia may contribute to neuroinflammation through the production of neurotoxins, and targeting this inflammation could present therapeutic opportunities.</p>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>Transcriptomic analysis reveals distinct gene expression patterns in acute versus chronic ZIKV infection, with chronic inflammation persisting in the hippocampus</title>
<p>To investigate ZIKV-induced chronic pathology, we conducted bulk RNA sequencing on mouse hippocampus samples, comparing infected mice at 4 and 28 dpi to uninfected controls (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>). We&#xa0;identified genes upregulated and downregulated at both time points relative to uninfected controls (<xref ref-type="supplementary-material" rid="SF3">
<bold>Supplementary Figure&#xa0;3A</bold>
</xref>). While the profiles at 4 and 28 dpi differed, 151 genes were upregulated, and 138 were downregulated in acute and chronic stages of infection. At 4 dpi, genes such as <italic>Stat1, Ifitm3</italic>, and <italic>Isg1</italic>, primarily involved in IFN signaling, were upregulated, whereas at 28 dpi, genes like <italic>Cd8a, Ms4a4b, H2-Q6</italic>, which are associated with T cell responses were notably elevated (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5B, C</bold>
</xref>). Among the top 10 genes shared between both time points, upregulated pathways included IFN signaling and pathogen recognition with higher fold observed at 4 dpi compared to 28 dpi, while downregulated genes were predominantly related to cellular stress responses, showing a similar level of reduction at both time points (<xref ref-type="supplementary-material" rid="SF3">
<bold>Supplementary Figures&#xa0;3B, C</bold>
</xref>). This downregulation may reflect the immune system&#x2019;s attempt to control inflammation, which could otherwise exacerbate pathology.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Bulk sequencing of mouse hippocampus shows chronic pathology. <bold>(A)</bold> Mice hippocampal sections were harvested and sequenced. <bold>(B, C)</bold> Volcano plot showing the top three upregulated and downregulated genes for D4 vs. UI. <bold>(C)</bold> shows D28 vs UI volcano plot for the top three upregulated and downregulated genes. Red indicates upregulated with a positive log2fold change value (&gt;1) and blue indicates downregulated with a negative log2fold change value (&lt;1). Grey is non-significant genes. <bold>(D)</bold> Gene expression differences comparing D4 to UI visualizing the top most upregulated genes in the D4 group. <bold>(E)</bold> Gene expression differences comparing D28 to UI visualizing the top most upregulated genes in the D28 group. <bold>(F)</bold> Heatmap representing fold changes of GO pathways of D4 vs UI and D28 vs UI mouse hippocampi. Blue=downregulated and Red=upregulated. N=3 per condition <bold>(G)</bold> Specific genes in microglial activation involved in immune response pathway that are altered.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1597776-g005.tif">
<alt-text content-type="machine-generated">Schematic diagram and multiple plots detailing a study on mouse brain analysis post-Zika virus (ZIKV) infection. (A) Diagram shows the experimental process involving mice injected with ZIKV, hippocampus harvesting, and bulk sequencing. (B-C) Volcano plots depict gene expression changes at days 4 and 28 post-infection, highlighting upregulated and downregulated genes. (D-E) Dot plots show top 20 gene ontology enrichment pathways with upregulated genes on days 4 and 28. (F) Heatmap illustrates pathway fold changes, comparing different biological processes. (G) Heatmap displays microglial activation in immune response at days 4 and 28.</alt-text>
</graphic>
</fig>
<p>Gene ontology (GO) enrichment analysis confirmed these findings, revealing upregulation of viral response genes and continued activation of IFN signaling at 4 and 28 dpi (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5D, E</bold>
</xref>). IFN signaling is critical for viral clearance, and prior studies have highlighted its importance in ZIKV infection in adult brains (<xref ref-type="bibr" rid="B6">6</xref>). At 4 dpi, the immune system was actively engaged in the hippocampus, with heightened viral response genes (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5D</bold>
</xref>). By D28, the viral response persisted, with increased expression of genes involved in cytotoxicity, indicating sustained immune activation (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5E</bold>
</xref>). Chronic inflammation was evident, with inflammatory pathways still upregulated 4 weeks post-infection. Notably, the &#x201c;regulation of mononuclear cell proliferation&#x201d; pathway was upregulated, suggesting infiltrating immune cells, such as monocytes, may contribute to observed pathology. In contrast, apoptotic cell clearance pathways were downregulated at 4 dpi, potentially exacerbating inflammation in the upregulated gene sets (<xref ref-type="supplementary-material" rid="SF3">
<bold>Supplementary Figure&#xa0;3D</bold>
</xref>). At 28 dpi, extracellular matrix (ECM)-related genes were similarly downregulated, a change that may hinder cell repair and proliferation (<xref ref-type="supplementary-material" rid="SF3">
<bold>Supplementary Figure&#xa0;3E</bold>
</xref>), consistent with previous studies linking ECM alterations to impaired neuronal regeneration after viral infections (<xref ref-type="bibr" rid="B37">37</xref>).</p>
<p>We then extracted genes from GO categories and compared these results with RT-qPCR and histology data with fold-change values between infected and uninfected groups visualized in a heatmap (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5F</bold>
</xref>). Notably, apoptotic processes were upregulated in both acute (4 dpi) and chronic (28 dpi) infection-though more pronounced at 4 dpi. In contrast, lipid catabolism was downregulated in both phases, which is significant as brain lipid alterations are implicated in neurodegenerative diseases like Alzheimer&#x2019;s. Moreover, <italic>Tau</italic> and <italic>amyloid-beta</italic> (A&#x3b2;) genes were downregulated at both time points, suggesting potential memory-related deficits in the mice, as these proteins are critical in Alzheimer&#x2019;s pathology.</p>
<p>Interestingly, neurotransmission genes were upregulated at 28 dpi, indicating that neurons may initially attempt to recover from infection but ultimately succumb to chronic inflammation, possibly contributing to neurocognitive dysfunction. Additionally, microglial cell proliferation was upregulated at 4 dpi, while their activation was more pronounced at 28 dpi, suggesting that microglia play a central role in driving chronic inflammation in the hippocampus (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5F, G</bold>
</xref>). This comprehensive analysis underscores the long-lasting effects of ZIKV infection in the hippocampus, revealing both acute and chronic immune responses that likely contribute to persistent neuroinflammation and potential cognitive deficits.</p>
</sec>
<sec id="s3_5">
<label>3.5</label>
<title>Monocyte infiltration into brain tissue was detectable at 7 days after ZIKV infection</title>
<p>Although high amounts of pathogens like ZIKV are not present in the adult brain, they can still trigger inflammation potentially through peripheral effects or blood-brain barrier (BBB) disruption, enabling immune cells to enter the CNS (<xref ref-type="bibr" rid="B32">32</xref>). Monocytes have been shown to infiltrate the brain in immunocompromised mouse models, and clinical studies have reported similar infiltration of mononuclear cells in adults (<xref ref-type="bibr" rid="B12">12</xref>, <xref ref-type="bibr" rid="B38">38</xref>). To investigate the role of monocyte infiltration in ZIKV-induced neuroinflammation and CNS damage, we examined monocyte migration into the brain following infection.</p>
<p>To track monocyte-derived cells, we used CCR2-creER-R26R-EGFP (Ai6) mice, which express EGFP in monocytes and their progeny, even after CCR2 is downregulated in the brain (<xref ref-type="bibr" rid="B39">39</xref>). This allows us to trace the migration of these cells despite changes in their surface markers. Mice were treated with tamoxifen (5 mg/40 g body weight) for 3 days, followed by IFNAR antibody administration one day before ZIKV footpad infection. At 7 dpi, mice were sacrificed, and cells isolated from brain tissue were analyzed by flow cytometry to track monocyte-derived cells (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>). In parallel we harvested bone marrow to assess potential monocyte migration to the brain by quantifying changes in monocyte-derived cell populations. Flow cytometry of bone marrow revealed a significant reduction in CCR2-EGFP+ monocyte-derived cells (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>), suggesting migration of these cells to the brain or cell death due to viral infection. A concurrent decrease in CD68+ monocytes supported the idea of monocyte migration or cell loss (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Infiltrating monocytes seen in ZIKV mice brains at 7dpi. <bold>(A)</bold> CCR2-CreER;R26R-EGFP (Ai6) mice were given tamoxifen for 3 days before infected with ZIKV and harvested. <bold>(B)</bold> Quantification of flow data for Bone marrow cells (CCR2-EGFP+, CCR2-EGFP+ CD68+) <bold>(C)</bold> Quantification of flow data for Brain cells (CD11B+CD45+, CD45int CD11B+ (Microglia), CCR2-EGFP+, CCR2-EGFP-). <bold>(D, E)</bold> Immunofluorescence of CCR2-CreER-R26R-EGFP mice for EGFP and sall1 expression in choroid plexus region with quantification. N=3-4. Data represents the mean &#xb1; SD <sup>&#x2217;</sup>p &lt; 0.0332, <sup>&#x2217;&#x2217;</sup>p &lt; 0.0021, and <sup>&#x2217;&#x2217;&#x2217;</sup>p &lt; 0.0002.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1597776-g006.tif">
<alt-text content-type="machine-generated">Experimental timeline and results from a study on ZIKV infection. Panel A shows a timeline of treatments and events from day -4 to 7, using a mouse model. Panels B and C present bar graphs of cell counts from bone marrow and brain, respectively, comparing various cell markers between uninfected (UI) and day 7 (D7) post-infection. Both show significant differences. Panel D displays immunofluorescence images showing cell markers DAPI, CCR2-EGFP, and SALL1 at different stages. Panel E has a bar graph comparing CCR2-EGFP+ cell counts, showing significant increase at D7.</alt-text>
</graphic>
</fig>
<p>In the brain, flow cytometry revealed an increased myeloid cell population (CD45+ CD11B+) at 7 dpi, indicating immune cell infiltration (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>). Further gating analysis showed an increase in microglia, suggesting microglial activation (<xref ref-type="bibr" rid="B34">34</xref>). Importantly, we detected an increase in CCR2-EGFP+ monocyte-derived cells and CCR2-EGFP- macrophages. (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>). Immunofluorescence of these same mice confirmed monocyte-derived cells near the choroid plexus at 7 dpi (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6D, E</bold>
</xref>). Overall, these findings demonstrate significant monocyte infiltration and microglial activation in the brain by 7 dpi, suggesting a role for infiltrating monocytes in driving neuroinflammation.</p>
</sec>
<sec id="s3_6">
<label>3.6</label>
<title>ZIKV infection drives proinflammatory monocytes and CCR2 inhibition mitigates neuroinflammation</title>
<p>To assess ZIKV&#x2019;s ability to drive monocyte inflammatory responses, we measured IL1&#x3b2; production in bone marrow-derived macrophages (BMDMs) following infection. BMDMs support ZIKV replication (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7A</bold>
</xref>), and exhibit increased <italic>IL1&#x3b2;</italic> RNA and protein levels post-infection (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7B, C</bold>
</xref>). IL1&#x3b2; production, induced by ZIKV, is linked to neuronal cell death (<xref ref-type="bibr" rid="B40">40</xref>). Cytokine/chemokine array analysis revealed that BMDMs secrete various cytokines and chemokines, including MCP-1, which are involved in monocyte recruitment (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7D</bold>
</xref>). These findings suggest that ZIKV infection promotes inflammatory factor release, triggering monocyte infiltration which may contribute to <italic>in vivo</italic> neuroinflammation.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>BMDMs infected by ZIKV and lead to the release of inflammatory cytokines <bold>(A, B)</bold> RT-qPCR for ZIKV RNA, and <italic>IL-1&#x3b2;</italic> mRNA. <bold>(C)</bold> ELISA for IL1B secretion. <bold>(D)</bold> Mouse 32 Plex Luminex assay was run by the UVA Flow Cytometry Core Facility. Data represents the mean &#xb1; SD <sup>&#x2217;</sup>p &lt; 0.0332, <sup>&#x2217;&#x2217;</sup>p &lt; 0.0021, and <sup>&#x2217;&#x2217;&#x2217;</sup>p &lt; 0.0002, <sup>&#x2217;&#x2217;&#x2217;&#x2217;</sup>p &lt; 0.0001. The experiment was independently repeated twice with similar results; representative data are shown.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1597776-g007.tif">
<alt-text content-type="machine-generated">Bar graphs showing the effects of ZIKV on BMDMs. Panel A shows increased ZIKV RNA in infected BMDMs over time. Panel B displays IL-1&#x3b2; RNA fold change with significant increases at 2 and 8 hours post-infection. Panel C depicts IL-1&#x3b2; secretion, also significantly elevated at all time points in infected cells. Panel D illustrates relative protein expression in the supernatant for multiple cytokines, with ZIKV-infected samples significantly higher than uninfected controls for most proteins. Statistical significance is marked with asterisks.</alt-text>
</graphic>
</fig>
<p>To explore the role of monocytes in neuroinflammation and CNS damage, we administered the CCR2 inhibitor RS-102895. CCR2 mediates monocyte chemotaxis toward inflammation sites and acts as a receptor for MCP-1 (CCL2) (<xref ref-type="bibr" rid="B41">41</xref>). Mice were treated with 10 mg/kg of CCR2 inhibitor one hour and 24 hours after ZIKV infection, followed by brain harvesting 48 hours post-infection (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8A</bold>
</xref>). Flow cytometry analysis showed a significant reduction in overall immune cell counts in ZIKV-infected mice treated with the CCR2 inhibitor, confirming the effective inhibition of monocyte recruitment (<xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8B, C</bold>
</xref>). Notably, microglial cell counts remained unchanged, indicating that the inhibitor did not affect microglia (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8D</bold>
</xref>).</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Monocyte inhibition ameliorates ZIKV neuroinflammation. <bold>(A)</bold> C57BL/6 mice were injected with ZIKV then CCR2 inhibitor at 1 hpi and 24hpi before harvesting at 2 dpi. <bold>(B)</bold> FACs of total immune cell and microglia. <bold>(C)</bold> FACs quantification of cell counts and microglia <bold>(D)</bold>. <bold>(E&#x2013;L)</bold> RT-qPCR of half brain regions for IL1B, IL6, CH25H, CD86, CX3CR1, P2RY12, TREM2 and APOE. N=3-5. Data represents the mean &#xb1; SD <sup>&#x2217;</sup>p &lt; 0.0332, <sup>&#x2217;&#x2217;</sup>p &lt; 0.0021, and <sup>&#x2217;&#x2217;&#x2217;</sup>p &lt; 0.0002.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1597776-g008.tif">
<alt-text content-type="machine-generated">Diagram of a study on C57BL/6 mice. Panel A shows the experimental timeline, with steps including injections of ZIKV, IFNAR, and CCR2 antagonist. Panels B-L depict flow cytometry plots and bar graphs analyzing immune and microglial cell counts, and gene expression changes in IL1B, IL6, CH25H, CD86, CX3CR1, P2RY12, TREM2, and APOE, under different conditions: untreated, ZIKV, and ZIKV with CCR2 inhibitor. Statistical significance is indicated by asterisks, and &#x201c;ns&#x201d; denotes non-significance.</alt-text>
</graphic>
</fig>
<p>We observed a reduction in neuroinflammation in the CCR2 inhibitor-treated mice by decreased expression of <italic>IL1&#x3b2;, CH25H</italic>, and <italic>CD86</italic> in the brain. Additionally, <italic>CX3CR1</italic> expression, a microglial activation marker, was decreased, suggesting reduced microglial activation (<xref ref-type="bibr" rid="B42">42</xref>, <xref ref-type="bibr" rid="B43">43</xref>). The upregulation of <italic>P2RY12</italic>, associated with anti-inflammatory microglia, further supports this finding (<xref ref-type="bibr" rid="B44">44</xref>). Lastly, <italic>TREM2</italic>, a known DAM marker, was reduced, indicating a decrease in disease-associated microglia. The increase in <italic>IL6</italic> observed in the CCR2 inhibitor-treated group could indicate&#xa0;a compensatory mechanism to ameliorate virus induced pathology (<xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8E&#x2013;L</bold>
</xref>). The combined decrease in <italic>CX3CR1</italic>, increase in <italic>P2RY12</italic>, and reduction in <italic>TREM2</italic> suggests that CCR2 inhibition attenuates neuroinflammation by modulating microglial gene expression.</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>In this report, we demonstrate that ZIKV infection induces neuroinflammation in the adult brain, characterized by microglial activation and monocyte cell infiltration. A recent study found that immunocompromised mice with intracerebral ZIKV infection show activated microglia and altered transcriptomic profiles in the cerebral cortex (<xref ref-type="bibr" rid="B30">30</xref>). However, this study is limited due to the unnatural mode of infection as well as the deficiency of host immunity. Using a model combining transient IFNAR blockade with footpad ZIKV infection, our study better mimics natural infection and pathogenesis in adults. Unlike intracerebral injection or immunodeficient models, this approach did not result in mouse mortality, suggesting less aggressive neuroinvasion. Despite low viral burden in the brain parenchyma, we observed infiltrating monocytes and activated microglia, as seen through altered microglial morphology, increased microglial cell counts, and elevated expression of microglial inflammatory genes in ZIKV-infected brains one-week post-infection. Additionally, some microglia in CX3CR1-GFP mice did not express sall1, suggesting microglial activation as sall1 downregulation is associated with this process (<xref ref-type="bibr" rid="B35">35</xref>). Understanding these key factors driving brain pathology is crucial for developing therapeutic strategies for ZIKV-associated neurological deficits.</p>
<p>Our studies show elevated <italic>IL1&#x3b2;</italic> and <italic>TNF&#x3b1;</italic> gene expression up to day 7, likely driven by ZIKV infection and apoptosis in brain tissue. <italic>In vitro</italic> studies on ZIKV-infected mouse BMDMs revealed increased <italic>IL1&#x3b2;</italic>, linked to inflammatory cell death (<xref ref-type="bibr" rid="B6">6</xref>). Notably, neuroinflammation was observed on day 4, even in the absence of ZIKV RNA. Interestingly, the RNA sensor <italic>RIG-I</italic> was upregulated on days 4 and 7 (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>), suggesting persistent immune activation. Although viral RNA was undetectable in the brain at later timepoints, spleen analysis may clarify the sustained neuroinflammation observed at day 28. As demonstrated in studies of SARS-CoV and TBEV (<xref ref-type="bibr" rid="B45">45</xref>, <xref ref-type="bibr" rid="B46">46</xref>), peripheral infection, such as in the spleen, could indirectly drive neuroinflammation. Further investigation with more sensitive assays will clarify whether residual viral RNA or peripheral immune signals drive inflammatory response in the brain, along with luminex or ELISA studies in brain tissue to validate our findings.</p>
<p>Bulk sequencing revealed upregulation of apoptosis, chronic inflammation, and mononuclear cell infiltration in the hippocampus (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref>), a key region involved in memory formation (<xref ref-type="bibr" rid="B47">47</xref>). If brain inflammation is not treated ongoing inflammation can lead to encephalitis associated with a mortality rate of 5.6&#x2013;5.8% and altered mental status (<xref ref-type="bibr" rid="B48">48</xref>). Prolonged inflammatory activation was seen in our mouse model, along with microglial activation being upregulated during chronic infection. ZIKV has been linked to cognitive deficits and altered mental status in humans; this underlying pathology may, in part, stem from neuroinflammation. The sustained increase in IFN-related genes in our sequencing data suggests that our transient blockade of IFN signaling is indeed temporary, supporting its critical role in viral response. The upregulation of <italic>CH25H</italic> gene, involved in cholesterol synthesis, was observed in ZIKV-infected brain. Additionally, lipid deposits were observed in the brain following ZIKV infection. These findings suggest the need for future investigations into lipid accumulation in ZIKV-associated cognitive dysfunction, given the role of lipids in Alzheimer&#x2019;s disease progression (<xref ref-type="bibr" rid="B49">49</xref>).</p>
<p>Notably, monocyte recruitment was increased during ZIKV infection, and appeared to drive inflammatory responses in the brain (<xref ref-type="bibr" rid="B25">25</xref>). Blocking monocyte infiltration reduced the expression of microglial activation genes. This is consistent with findings from other neurotropic viruses that infiltrating monocytes play a role in exacerbating neuroinflammation and activating microglia (<xref ref-type="bibr" rid="B25">25</xref>, <xref ref-type="bibr" rid="B50">50</xref>). Notably, inflammation and cell death occurred even when viral RNA was undetectable, implicating blood&#x2013;brain barrier (BBB) disruption. Reduced astrocyte numbers and downregulation of ECM-related genes in the hippocampus suggest BBB compromise at 28 dpi, potentially facilitating monocyte entry. Future studies using BBB permeability assays are necessary to confirm this. Monocyte infiltration, coupled with microglial expansion (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>) and supported by inhibitor studies (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8</bold>
</xref>), implicates monocytes as key drivers of neuroinflammation. Cells co-stained for sall1 and CCR2-EGFP (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6D</bold>
</xref>, arrow) may indicate monocyte-to-microglia transition, though further validation is needed. Prolonged CCR2 inhibition studies could help define its role in sustaining inflammation and microglial activation during chronic ZIKV infection.</p>
<p>In conclusion, ZIKV infection in immunocompetent adult mice resulted in brain inflammation, marked by monocyte infiltration and microglia activation. These microglia are likely activated by infiltrating monocytes during infection, with brain pathology persisting 28 days post-infection (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9</bold>
</xref>). Our findings advance the understanding of ZIKV-driven CNS inflammation and its potential long-term neurological impact.</p>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>Infiltrating monocytes heighten brain neuroinflammation by activating microglia following ZIKV. Monocytes infiltrate brain parenchyma after zika virus infection in the immunocompetent adult brain. Microglia become activated following zika virus infection and inflammation persists up to D28. The inhibition of monocytes reduces neuroinflammation in the immunocompetent adult brain.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-16-1597776-g009.tif">
<alt-text content-type="machine-generated">Illustration showing immune processes in the brain, including resting and activated microglia, monocyte interaction with the blood-brain barrier, and chronic inflammation. An arrow points to a mouse labeled &#x201c;Immunocompetent anti-IFNAR treated 6-9 week old C57BL/6 mice.&#x201d; Various cytokines like TNF&#x3b1;, IL6, IL1B, CH25H, and the SNP RS102895 are mentioned.</alt-text>
</graphic>
</fig>
</sec>
</body>
<back>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/<xref ref-type="supplementary-material" rid="SF1">
<bold>Supplementary Material</bold>
</xref>. Additionally Bulk RNA seq data produced from this study is accessible through NCBI. This data can be found here: BioProject ID: PRJNA1282613 with BioSample accessions: SAMN49653677, SAMN49653678, SAMN49653679, SAMN49653680, SAMN49653681, SAMN49653682, SAMN49653683, SAMN49653684, SAMN49653685. Further inquiries can be directed to the corresponding author.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The animal study was approved by Institutional Animal Care of the University of Virginia School of Medicine. The study was conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>JG: Software, Writing &#x2013; review &amp; editing, Visualization, Writing &#x2013; original draft, Investigation, Formal Analysis, Validation, Methodology, Data curation, Conceptualization. S-JP: Methodology, Writing &#x2013; review &amp; editing. LL: Writing &#x2013; review &amp; editing, Methodology. TC: Data curation, Validation, Writing &#x2013; review &amp; editing. AB: Validation, Writing &#x2013; review &amp; editing. C-YK: Writing &#x2013; review &amp; editing, Methodology, Conceptualization, Supervision. YH: Funding acquisition, Visualization, Resources, Methodology, Supervision, Investigation, Conceptualization, Writing &#x2013; review &amp; editing.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare that financial support was received for the research and/or publication of this article. This work was supported by NIH Grant (DK122737 to YH).</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>CX3CR1-EGFP and CCR2-CreER;R26R-EGFP (Ai6) mice werekindly provided by Dr. Chia-Yi Kuan (University of Virginia,Charlottesville, USA). ZIKA strain was provided by Dr. MichaelGale. Dr. Yang Liu helped analyze H&amp;E data. Schematic diagrams were created using <uri xlink:href="https://www.BioRender.com">BioRender.com</uri>.</p>
</ack>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="ai-statement">
<title>Generative AI statement</title>
<p>The author(s) declare that no Generative AI was used in the creation of this manuscript.</p>
</sec>
<sec id="s11" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s12" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fimmu.2025.1597776/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fimmu.2025.1597776/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Image1.tiff" id="SF1" mimetype="image/tiff">
<label>Supplementary Figure&#xa0;1</label>
<caption>
<p>Inflammation seen in hippocampus following ZIKV infection. <bold>(A, B)</bold> IL6 and TNFa RNA detection via RT-qPCR in brain regions. <bold>(C)</bold> TUNEL assay for D7 and D28 for hippocampus and cortex. UI, uninfected; BrS, brain Stem; CX, cortex; CB, cerebellum; H, hippocampus. Data represents the mean &#xb1; SD <sup>&#x2217;</sup>p &lt; 0.0332, <sup>&#x2217;&#x2217;</sup>p &lt; 0.0021.</p>
</caption>
</supplementary-material>
  <supplementary-material xlink:href="Image2.tiff" id="SF2" mimetype="image/tiff">
<label>Supplementary Figure&#xa0;2</label>
<caption>
<p>Lipid detection observed at 7dpi. <bold>(A)</bold> Oil red staining of brain tissue with quantification <bold>(B)</bold>. Data represents the mean &#xb1; SD <sup>&#x2217;</sup>p &lt; 0.0332.</p>
</caption>
</supplementary-material>
  <supplementary-material xlink:href="Image3.tiff" id="SF3" mimetype="image/tiff">
<label>Supplementary Figure&#xa0;3</label>
<caption>
<p>Bulk sequencing reveals diverse transcriptomic profile with chronic effects. <bold>(A)</bold>: Left Venn diagram depicts the counts of upregulated genes in D4 and D28 compared to UI that have a p value &lt; 0.05 and a log2foldchange &gt;0. Right Venn diagram shows downregulated genes in D4 and D28 compared to UI that have a p value &lt; 0.05 and a log2foldchange &lt; 0. <bold>(B, C)</bold> Top 10 genes found to be upregulated/downregulated in both D4 and D28 groups, with a p value &lt; 0.05. (n=3). <bold>(D)</bold> Gene expression differences comparing D4 to UI visualizing the top most downregulated genes in the D4 group. <bold>(E)</bold> Gene expression differences comparing D28 to UI visualizing the top most downregulated genes in the D28 group.</p>
</caption>
</supplementary-material>
  <supplementary-material xlink:href="Image4.tiff" id="SF4" mimetype="image/tiff">
<label>Supplementary Figure&#xa0;4</label>
<caption>
<p>Gating strategy for CCR2-creER-R26R EGFP (Ai6) mice for brain <bold>(A)</bold> and bone marrow <bold>(B)</bold>.</p>
</caption>
</supplementary-material>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ojha</surname> <given-names>CR</given-names>
</name>
<name>
<surname>Rodriguez</surname> <given-names>M</given-names>
</name>
<name>
<surname>Lapierre</surname> <given-names>J</given-names>
</name>
<name>
<surname>Muthu Karuppan</surname> <given-names>MK</given-names>
</name>
<name>
<surname>Branscome</surname> <given-names>H</given-names>
</name>
<name>
<surname>Kashanchi</surname> <given-names>F</given-names>
</name>
<etal/>
</person-group>. <article-title>Complementary mechanisms potentially involved in the pathology of zika virus</article-title>. <source>Front Immunol</source>. (<year>2018</year>) <volume>9</volume>:<elocation-id>2340</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2018.02340</pub-id>
</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Abdelsalam</surname> <given-names>M</given-names>
</name>
<name>
<surname>Ahmed</surname> <given-names>M</given-names>
</name>
<name>
<surname>Osaid</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Hamoudi</surname> <given-names>R</given-names>
</name>
<name>
<surname>Harati</surname> <given-names>R</given-names>
</name>
</person-group>. <article-title>Insights into Exosome Transport through the Blood&#x2013;Brain Barrier and the Potential Therapeutical Applications in Brain Diseases</article-title>. <source>Pharmaceuticals</source>. (<year>2023</year>) <volume>16</volume>:<fpage>571</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ph16040571</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sadeghieh</surname> <given-names>T</given-names>
</name>
<name>
<surname>Sargeant</surname> <given-names>JM</given-names>
</name>
<name>
<surname>Greer</surname> <given-names>AL</given-names>
</name>
<name>
<surname>Berke</surname> <given-names>O</given-names>
</name>
<name>
<surname>Dueymes</surname> <given-names>G</given-names>
</name>
<name>
<surname>Gachon</surname> <given-names>P</given-names>
</name>
<etal/>
</person-group>. <article-title>Zika virus outbreak in Brazil under current and future climate</article-title>. <source>Epidemics</source>. (<year>2021</year>) <volume>37</volume>:<fpage>100491</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.epidem.2021.100491</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Carteaux</surname> <given-names>G</given-names>
</name>
<name>
<surname>Maquart</surname> <given-names>M</given-names>
</name>
<name>
<surname>Bedet</surname> <given-names>A</given-names>
</name>
<name>
<surname>Contou</surname> <given-names>D</given-names>
</name>
<name>
<surname>Brugi&#xe8;res</surname> <given-names>P</given-names>
</name>
<name>
<surname>Fourati</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Zika virus associated with meningoencephalitis</article-title>. <source>N Engl J Med</source>. (<year>2016</year>) <volume>374</volume>:<page-range>1595&#x2013;6</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1056/NEJMc1602964</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Soares</surname> <given-names>CN</given-names>
</name>
<name>
<surname>Brasil</surname> <given-names>P</given-names>
</name>
<name>
<surname>Carrera</surname> <given-names>RM</given-names>
</name>
<name>
<surname>Sequeira</surname> <given-names>P</given-names>
</name>
<name>
<surname>De Filippis</surname> <given-names>AB</given-names>
</name>
<name>
<surname>Borges</surname> <given-names>VA</given-names>
</name>
<etal/>
</person-group>. <article-title>Fatal encephalitis associated with Zika virus infection in an adult</article-title>. <source>J Clin Virol</source>. (<year>2016</year>) <volume>83</volume>:<page-range>63&#x2013;5</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jcv.2016.08.297</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jeong</surname> <given-names>GU</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>S</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>DY</given-names>
</name>
<name>
<surname>Lyu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Yoon</surname> <given-names>GY</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>KD</given-names>
</name>
<etal/>
</person-group>. <article-title>Zika virus infection induces interleukin-1&#x3b2;-mediated inflammatory responses by macrophages in the brain of an adult mouse model</article-title>. <source>Goodrum F editor J Virol</source>. (<year>2023</year>) <volume>97</volume>:<page-range>e00556&#x2013;23</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/jvi.00556-23</pub-id>
</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roy</surname> <given-names>ER</given-names>
</name>
<name>
<surname>Chiu</surname> <given-names>G</given-names>
</name>
<name>
<surname>Li</surname> <given-names>S</given-names>
</name>
<name>
<surname>Propson</surname> <given-names>NE</given-names>
</name>
<name>
<surname>Kanchi</surname> <given-names>R</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>B</given-names>
</name>
<etal/>
</person-group>. <article-title>Concerted type I interferon signaling in microglia and neural cells promotes memory impairment associated with amyloid &#x3b2; plaques</article-title>. <source>Immunity</source>. (<year>2022</year>) <volume>55</volume>:<page-range>879&#x2013;94</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.immuni.2022.03.018</pub-id>
</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Haby</surname> <given-names>MM</given-names>
</name>
<name>
<surname>Pinart</surname> <given-names>M</given-names>
</name>
<name>
<surname>Elias</surname> <given-names>V</given-names>
</name>
<name>
<surname>Reveiz</surname> <given-names>L</given-names>
</name>
</person-group>. <article-title>Prevalence of asymptomatic Zika virus infection: a systematic review</article-title>. <source>Bull World Health Organ</source>. (<year>2018</year>) <volume>96</volume>:<fpage>402</fpage>&#x2013;<lpage>413D</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.2471/BLT.17.201541</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Halani</surname> <given-names>S</given-names>
</name>
<name>
<surname>Tombindo</surname> <given-names>PE</given-names>
</name>
<name>
<surname>O&#x2019;Reilly</surname> <given-names>R</given-names>
</name>
<name>
<surname>Miranda</surname> <given-names>RN</given-names>
</name>
<name>
<surname>Erdman</surname> <given-names>LK</given-names>
</name>
<name>
<surname>Whitehead</surname> <given-names>C</given-names>
</name>
<etal/>
</person-group>. <article-title>Clinical manifestations and health outcomes associated with Zika virus infections in adults: A systematic review</article-title>. <source>PloS Negl Trop Dis</source>. (<year>2021</year>) <volume>15</volume>:<elocation-id>e0009516</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.17648/htbr-2021-125090</pub-id>
</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schwartzmann</surname> <given-names>PV</given-names>
</name>
<name>
<surname>Ramalho</surname> <given-names>LNZ</given-names>
</name>
<name>
<surname>Neder</surname> <given-names>L</given-names>
</name>
<name>
<surname>Vilar</surname> <given-names>FC</given-names>
</name>
<name>
<surname>Ayub-Ferreira</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Romeiro</surname> <given-names>MF</given-names>
</name>
<etal/>
</person-group>. <article-title>Zika virus meningoencephalitis in an immunocompromised patient</article-title>. <source>Mayo Clin Proc</source>. (<year>2017</year>) <volume>92</volume>:<page-range>460&#x2013;6</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.mayocp.2016.12.019</pub-id>
</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alves-Leon</surname> <given-names>SV</given-names>
</name>
<name>
<surname>Lima</surname> <given-names>MDR</given-names>
</name>
<name>
<surname>Nunes</surname> <given-names>PCG</given-names>
</name>
<name>
<surname>Chimelli</surname> <given-names>LMC</given-names>
</name>
<name>
<surname>Rabelo</surname> <given-names>K</given-names>
</name>
<name>
<surname>Nogueira</surname> <given-names>RMR</given-names>
</name>
<etal/>
</person-group>. <article-title>Zika virus found in brain tissue of a multiple sclerosis patient undergoing an acute disseminated encephalomyelitis-like episode</article-title>. <source>Mult Scler J</source>. (<year>2019</year>) <volume>25</volume>:<page-range>427&#x2013;30</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1177/1352458518781992</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Azevedo</surname> <given-names>RSS</given-names>
</name>
<name>
<surname>Araujo</surname> <given-names>MT</given-names>
</name>
<name>
<surname>Martins Filho</surname> <given-names>AJ</given-names>
</name>
<name>
<surname>Oliveira</surname> <given-names>CS</given-names>
</name>
<name>
<surname>Nunes</surname> <given-names>BTD</given-names>
</name>
<name>
<surname>Cruz</surname> <given-names>ACR</given-names>
</name>
<etal/>
</person-group>. <article-title>Zika virus epidemic in Brazil. I. Fatal disease in adults: Clinical and laboratorial aspects</article-title>. <source>J Clin Virol</source>. (<year>2016</year>) <volume>85</volume>:<fpage>56</fpage>&#x2013;<lpage>64</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jcv.2016.10.024</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>De Sousa</surname> <given-names>JR</given-names>
</name>
<name>
<surname>Azevedo</surname> <given-names>RSS</given-names>
</name>
<name>
<surname>Martins Filho</surname> <given-names>AJ</given-names>
</name>
<name>
<surname>Araujo</surname> <given-names>MTF</given-names>
</name>
<name>
<surname>Moutinho</surname> <given-names>ERC</given-names>
</name>
<name>
<surname>Baldez Vasconcelos</surname> <given-names>BC</given-names>
</name>
<etal/>
</person-group>. <article-title>Correlation between apoptosis and in situ immune response in fatal cases of microcephaly caused by zika virus</article-title>. <source>Am J Pathol</source>. (<year>2018</year>) <volume>188</volume>:<page-range>2644&#x2013;52</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ajpath.2018.07.009</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Twarowski</surname> <given-names>B</given-names>
</name>
<name>
<surname>Herbet</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Inflammatory processes in alzheimer&#x2019;s disease&#x2014;Pathomechanism, diagnosis and treatment: A review</article-title>. <source>Int J Mol Sci</source>. (<year>2023</year>) <volume>24</volume>:<fpage>6518</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms24076518</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rippee-Brooks</surname> <given-names>MD</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>W</given-names>
</name>
<name>
<surname>Dong</surname> <given-names>J</given-names>
</name>
<name>
<surname>Pappolla</surname> <given-names>M</given-names>
</name>
<name>
<surname>Fang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Bao</surname> <given-names>X</given-names>
</name>
</person-group>. <article-title>Viral infections, are they a trigger and risk factor of alzheimer&#x2019;s disease</article-title>? <source>Pathogens</source>. (<year>2024</year>) <volume>13</volume>:<fpage>240</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/pathogens13030240</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jeong</surname> <given-names>H</given-names>
</name>
<name>
<surname>Shin</surname> <given-names>H</given-names>
</name>
<name>
<surname>Hong</surname> <given-names>S</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Physiological roles of monomeric amyloid-&#x3b2; and implications for alzheimer&#x2019;s disease therapeutics</article-title>. <source>Exp Neurobiol</source>. (<year>2022</year>) <volume>31</volume>:<fpage>65</fpage>&#x2013;<lpage>88</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.5607/en22004</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Eimer</surname> <given-names>WA</given-names>
</name>
<name>
<surname>Vijaya Kumar</surname> <given-names>DK</given-names>
</name>
<name>
<surname>Navalpur Shanmugam</surname> <given-names>NK</given-names>
</name>
<name>
<surname>Rodriguez</surname> <given-names>AS</given-names>
</name>
<name>
<surname>Mitchell</surname> <given-names>T</given-names>
</name>
<name>
<surname>Washicosky</surname> <given-names>KJ</given-names>
</name>
<etal/>
</person-group>. <article-title>Alzheimer&#x2019;s disease-associated &#x3b2;-amyloid is rapidly seeded by herpesviridae to protect against brain infection</article-title>. <source>Neuron</source>. (<year>2018</year>) <volume>99</volume>:<fpage>56</fpage>&#x2013;<lpage>63</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.neuron.2018.06.030</pub-id>
</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname> <given-names>SE</given-names>
</name>
<name>
<surname>Choi</surname> <given-names>H</given-names>
</name>
<name>
<surname>Shin</surname> <given-names>N</given-names>
</name>
<name>
<surname>Kong</surname> <given-names>D</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>NG</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>HY</given-names>
</name>
<etal/>
</person-group>. <article-title>Zika virus infection accelerates Alzheimer&#x2019;s disease phenotypes in brain organoids</article-title>. <source>Cell Death Discov</source>. (<year>2022</year>) <volume>8</volume>:<fpage>153</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41420-022-00958-x</pub-id>
</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vidal-Itriago</surname> <given-names>A</given-names>
</name>
<name>
<surname>Radford</surname> <given-names>RAW</given-names>
</name>
<name>
<surname>Aramideh</surname> <given-names>JA</given-names>
</name>
<name>
<surname>Maurel</surname> <given-names>C</given-names>
</name>
<name>
<surname>Scherer</surname> <given-names>NM</given-names>
</name>
<name>
<surname>Don</surname> <given-names>EK</given-names>
</name>
<etal/>
</person-group>. <article-title>Microglia morphophysiological diversity and its implications for the CNS</article-title>. <source>Front Immunol</source>. (<year>2022</year>) <volume>13</volume>:<elocation-id>997786</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2022.997786</pub-id>
</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Barres</surname> <given-names>BA</given-names>
</name>
</person-group>. <article-title>Microglia and macrophages in brain homeostasis and disease</article-title>. <source>Nat Rev Immunol</source>. (<year>2018</year>) <volume>18</volume>:<page-range>225&#x2013;42</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nri.2017.125</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>LR</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>JC</given-names>
</name>
<name>
<surname>Bao</surname> <given-names>JS</given-names>
</name>
<name>
<surname>Bai</surname> <given-names>QQ</given-names>
</name>
</person-group>. <article-title>Wang G qing. Interaction of microglia and astrocytes in the neurovascular unit</article-title>. <source>Front Immunol</source>. (<year>2020</year>) <volume>11</volume>:<elocation-id>1024</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2020.01024</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Ji</surname> <given-names>J</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Ren</surname> <given-names>G</given-names>
</name>
</person-group>. <article-title>The role of microglial exosomes in brain injury</article-title>. <source>Front Cell Neurosci</source>. (<year>2022</year>) <volume>16</volume>:<elocation-id>1003809</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fncel.2022.1003809</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>B</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>L</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Fu</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>A&#x3b2; and tau regulate microglia metabolism via exosomes in alzheimer&#x2019;s disease</article-title>. <source>Biomedicines</source>. (<year>2022</year>) <volume>10</volume>:<fpage>1800</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/biomedicines10081800</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Echevarria-Lima</surname> <given-names>J</given-names>
</name>
<name>
<surname>Moles</surname> <given-names>R</given-names>
</name>
</person-group>. <article-title>Monocyte and macrophage functions in oncogenic viral infections</article-title>. <source>Viruses</source>. (<year>2024</year>) <volume>16</volume>:<fpage>1612</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/v16101612</pub-id>
</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Andonegui</surname> <given-names>G</given-names>
</name>
<name>
<surname>Zelinski</surname> <given-names>EL</given-names>
</name>
<name>
<surname>Schubert</surname> <given-names>CL</given-names>
</name>
<name>
<surname>Knight</surname> <given-names>D</given-names>
</name>
<name>
<surname>Craig</surname> <given-names>LA</given-names>
</name>
<name>
<surname>Winston</surname> <given-names>BW</given-names>
</name>
<etal/>
</person-group>. <article-title>Targeting inflammatory monocytes in sepsis-associated encephalopathy and long-term cognitive impairment</article-title>. <source>JCI Insight</source>. (<year>2018</year>) <volume>3</volume>:<fpage>e99364</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1172/jci.insight.99364</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Spiteri</surname> <given-names>AG</given-names>
</name>
<name>
<surname>Wishart</surname> <given-names>CL</given-names>
</name>
<name>
<surname>Pamphlett</surname> <given-names>R</given-names>
</name>
<name>
<surname>Locatelli</surname> <given-names>G</given-names>
</name>
<name>
<surname>King</surname> <given-names>NJC</given-names>
</name>
</person-group>. <article-title>Microglia and monocytes in inflammatory CNS disease: integrating phenotype and function</article-title>. <source>Acta Neuropathol (Berl)</source>. (<year>2022</year>) <volume>143</volume>:<fpage>179</fpage>&#x2013;<lpage>224</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00401-021-02384-2</pub-id>
</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Charniga</surname> <given-names>K</given-names>
</name>
<name>
<surname>Cucunub&#xe1;</surname> <given-names>ZM</given-names>
</name>
<name>
<surname>Walteros</surname> <given-names>DM</given-names>
</name>
<name>
<surname>Mercado</surname> <given-names>M</given-names>
</name>
<name>
<surname>Prieto</surname> <given-names>F</given-names>
</name>
<name>
<surname>Ospina</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Estimating Zika virus attack rates and risk of Zika virus-associated neurological complications in Colombian capital cities with a Bayesian model</article-title>. <source>R Soc Open Sci</source>. (<year>2022</year>) <volume>9</volume>:<fpage>220491</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1098/rsos.220491</pub-id>
</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mart&#xed;nez-Rojas</surname> <given-names>PP</given-names>
</name>
<name>
<surname>Monroy-Mart&#xed;nez</surname> <given-names>V</given-names>
</name>
<name>
<surname>Agredano-Moreno</surname> <given-names>LT</given-names>
</name>
<name>
<surname>Jim&#xe9;nez-Garc&#xed;a</surname> <given-names>LF</given-names>
</name>
<name>
<surname>Ruiz-Ordaz</surname> <given-names>BH</given-names>
</name>
</person-group>. <article-title>Zika virus-infected monocyte exosomes mediate cell-to-cell viral transmission</article-title>. <source>Cells</source>. (<year>2024</year>) <volume>13</volume>:<fpage>144</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/cells13020144</pub-id>
</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Figueiredo</surname> <given-names>CP</given-names>
</name>
<name>
<surname>Barros-Arag&#xe3;o</surname> <given-names>FGQ</given-names>
</name>
<name>
<surname>Neris</surname> <given-names>RLS</given-names>
</name>
<name>
<surname>Frost</surname> <given-names>PS</given-names>
</name>
<name>
<surname>Soares</surname> <given-names>C</given-names>
</name>
<name>
<surname>Souza</surname> <given-names>INO</given-names>
</name>
<etal/>
</person-group>. <article-title>Zika virus replicates in adult human brain tissue and impairs synapses and memory in mice</article-title>. <source>Nat Commun</source>. (<year>2019</year>) <volume>10</volume>:<fpage>3890</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-019-11866-7</pub-id>
</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname> <given-names>N</given-names>
</name>
<name>
<surname>Choi</surname> <given-names>H</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>U</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>S</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>YB</given-names>
</name>
<name>
<surname>Shin</surname> <given-names>HY</given-names>
</name>
</person-group>. <article-title>Sustained microglial activation promotes synaptic loss and neuronal dysfunction after recovery from ZIKV infection</article-title>. <source>Int J Mol Sci</source>. (<year>2024</year>) <volume>25</volume>:<fpage>9451</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms25179451</pub-id>
</citation>
</ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>W</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>C</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>LB</given-names>
</name>
<name>
<surname>Bian</surname> <given-names>ZZ</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>JT</given-names>
</name>
<name>
<surname>Fan</surname> <given-names>DY</given-names>
</name>
<etal/>
</person-group>. <article-title>Immunocompetent mouse models revealed that S100A4 <sup>+</sup> monocytes/macrophages facilitate long-term Zika virus infection in the testes</article-title>. <source>Emerg Microbes Infect</source>. (<year>2024</year>) <volume>13</volume>:<fpage>2300466</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/22221751.2023.2300466</pub-id>
</citation>
</ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Balint</surname> <given-names>E</given-names>
</name>
<name>
<surname>Montemarano</surname> <given-names>A</given-names>
</name>
<name>
<surname>Feng</surname> <given-names>E</given-names>
</name>
<name>
<surname>Ashkar</surname> <given-names>AA</given-names>
</name>
</person-group>. <article-title>From mosquito bites to sexual transmission: evaluating mouse models of zika virus infection</article-title>. <source>Viruses</source>. (<year>2021</year>) <volume>13</volume>:<fpage>2244</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/v13112244</pub-id>
</citation>
</ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Komarasamy</surname> <given-names>TV</given-names>
</name>
<name>
<surname>Adnan</surname> <given-names>NAA</given-names>
</name>
<name>
<surname>James</surname> <given-names>W</given-names>
</name>
<name>
<surname>Balasubramaniam</surname> <given-names>VRMT</given-names>
</name>
</person-group>. <article-title>Zika virus neuropathogenesis: the different brain cells, host factors and mechanisms involved</article-title>. <source>Front Immunol</source>. (<year>2022</year>) <volume>13</volume>:<elocation-id>773191</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2022.773191</pub-id>
</citation>
</ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Magoro</surname> <given-names>T</given-names>
</name>
<name>
<surname>Dandekar</surname> <given-names>A</given-names>
</name>
<name>
<surname>Jennelle</surname> <given-names>LT</given-names>
</name>
<name>
<surname>Bajaj</surname> <given-names>R</given-names>
</name>
<name>
<surname>Lipkowitz</surname> <given-names>G</given-names>
</name>
<name>
<surname>Angelucci</surname> <given-names>AR</given-names>
</name>
<etal/>
</person-group>. <article-title>IL-1&#x3b2;/TNF-&#x3b1;/IL-6 inflammatory cytokines promote STAT1-dependent induction of CH25H in Zika virus&#x2013;infected human macrophages</article-title>. <source>J Biol Chem</source>. (<year>2019</year>) <volume>294</volume>:<page-range>14591&#x2013;602</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1074/jbc.RA119.007555</pub-id>
</citation>
</ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fixsen</surname> <given-names>BR</given-names>
</name>
<name>
<surname>Han</surname> <given-names>CZ</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Spann</surname> <given-names>NJ</given-names>
</name>
<name>
<surname>Saisan</surname> <given-names>P</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>Z</given-names>
</name>
<etal/>
</person-group>. <article-title>SALL1 enforces microglia-specific DNA binding and function of SMADs to establish microglia identity</article-title>. <source>Nat Immunol</source>. (<year>2023</year>) <volume>24</volume>:<page-range>1188&#x2013;99</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41590-023-01528-8</pub-id>
</citation>
</ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Toral-Rios</surname> <given-names>D</given-names>
</name>
<name>
<surname>Long</surname> <given-names>JM</given-names>
</name>
<name>
<surname>Ulrich</surname> <given-names>JD</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Strickland</surname> <given-names>MR</given-names>
</name>
<name>
<surname>Han</surname> <given-names>X</given-names>
</name>
<etal/>
</person-group>. <article-title>Cholesterol 25-hydroxylase mediates neuroinflammation and neurodegeneration in a mouse model of tauopathy</article-title>. <source>J Exp Med</source>. (<year>2024</year>) <volume>221</volume>:<elocation-id>e20232000</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1084/jem.20232000</pub-id>
</citation>
</ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bonneh-Barkay</surname> <given-names>D</given-names>
</name>
<name>
<surname>Wiley</surname> <given-names>CA</given-names>
</name>
</person-group>. <article-title>Brain extracellular matrix in neurodegeneration</article-title>. <source>Brain Pathol</source>. (<year>2009</year>) <volume>19</volume>:<page-range>573&#x2013;85</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1750-3639.2008.00195.x</pub-id>
</citation>
</ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname> <given-names>M</given-names>
</name>
<name>
<surname>Tuo</surname> <given-names>H</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>S</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>L</given-names>
</name>
</person-group>. <article-title>The roles of monocyte and monocyte-derived macrophages in common brain disorders</article-title>. <source>BioMed Res Int</source>. (<year>2020</year>) <volume>2020</volume>:<fpage>1</fpage>&#x2013;<lpage>11</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1155/2020/9396021</pub-id>
</citation>
</ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>HR</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>YY</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>CW</given-names>
</name>
<name>
<surname>Kuo</surname> <given-names>YM</given-names>
</name>
<name>
<surname>Kuan</surname> <given-names>IS</given-names>
</name>
<name>
<surname>Tiger Li</surname> <given-names>ZR</given-names>
</name>
<etal/>
</person-group>. <article-title>Fate mapping via CCR2-CreER mice reveals monocyte-to-microglia transition in development and neonatal stroke</article-title>. <source>Sci Adv</source>. (<year>2020</year>) <volume>6</volume>:<elocation-id>eabb2119</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/sciadv.abb2119</pub-id>
</citation>
</ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>W</given-names>
</name>
<name>
<surname>Li</surname> <given-names>G</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>D</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Pan</surname> <given-names>P</given-names>
</name>
<name>
<surname>Tian</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Zika virus infection induces host inflammatory responses by facilitating NLRP3 inflammasome assembly and interleukin-1&#x3b2; secretion</article-title>. <source>Nat Commun</source>. (<year>2018</year>) <volume>9</volume>:<fpage>106</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-017-02645-3</pub-id>
</citation>
</ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chu</surname> <given-names>HX</given-names>
</name>
<name>
<surname>Arumugam</surname> <given-names>TV</given-names>
</name>
<name>
<surname>Gelderblom</surname> <given-names>M</given-names>
</name>
<name>
<surname>Magnus</surname> <given-names>T</given-names>
</name>
<name>
<surname>Drummond</surname> <given-names>GR</given-names>
</name>
<name>
<surname>Sobey</surname> <given-names>CG</given-names>
</name>
</person-group>. <article-title>Role of CCR2 in inflammatory conditions of the central nervous system</article-title>. <source>J Cereb Blood Flow Metab</source>. (<year>2014</year>) <volume>34</volume>:<page-range>1425&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/jcbfm.2014.120</pub-id>
</citation>
</ref>
<ref id="B42">
<label>42</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname> <given-names>M</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Song</surname> <given-names>J</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>J</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>SY</given-names>
</name>
</person-group>. <article-title>Tissue-specific role of CX3CR1 expressing immune cells and their relationships with human disease</article-title>. <source>Immune Netw</source>. (<year>2018</year>) <volume>18</volume>(<issue>1</issue>):<elocation-id>e5</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.4110/in.2018.18.e5</pub-id>
</citation>
</ref>
<ref id="B43">
<label>43</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hickman</surname> <given-names>SE</given-names>
</name>
<name>
<surname>Allison</surname> <given-names>EK</given-names>
</name>
<name>
<surname>Coleman</surname> <given-names>U</given-names>
</name>
<name>
<surname>Kingery-Gallagher</surname> <given-names>ND</given-names>
</name>
<name>
<surname>El Khoury</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Heterozygous CX3CR1 deficiency in microglia restores neuronal &#x3b2;-amyloid clearance pathways and slows progression of alzheimer&#x2019;s like-disease in PS1-APP mice</article-title>. <source>Front Immunol</source>. (<year>2019</year>) <volume>10</volume>:<elocation-id>2780</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2019.02780</pub-id>
</citation>
</ref>
<ref id="B44">
<label>44</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yu</surname> <given-names>T</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>H</given-names>
</name>
<name>
<surname>Tian</surname> <given-names>J</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>L</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>X</given-names>
</name>
<etal/>
</person-group>. <article-title>P2Y12 regulates microglia activation and excitatory synaptic transmission in spinal lamina II neurons during neuropathic pain in rodents</article-title>. <source>Cell Death Dis</source>. (<year>2019</year>) <volume>10</volume>:<fpage>165</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41419-019-1425-4</pub-id>
</citation>
</ref>
<ref id="B45">
<label>45</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Granholm</surname> <given-names>AC</given-names>
</name>
</person-group>. <article-title>Long-term effects of SARS-coV-2 in the brain: clinical consequences and molecular mechanisms</article-title>. <source>J Clin Med</source>. (<year>2023</year>) <volume>12</volume>:<fpage>3190</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/jcm12093190</pub-id>
</citation>
</ref>
<ref id="B46">
<label>46</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pokorna Formanova</surname> <given-names>P</given-names>
</name>
<name>
<surname>Palus</surname> <given-names>M</given-names>
</name>
<name>
<surname>Salat</surname> <given-names>J</given-names>
</name>
<name>
<surname>H&#xf6;nig</surname> <given-names>V</given-names>
</name>
<name>
<surname>Stefanik</surname> <given-names>M</given-names>
</name>
<name>
<surname>Svoboda</surname> <given-names>P</given-names>
</name>
<etal/>
</person-group>. <article-title>Changes in cytokine and chemokine profiles in mouse serum and brain, and in human neural cells, upon tick-borne encephalitis virus infection</article-title>. <source>J Neuroinflammation</source>. (<year>2019</year>) <volume>16</volume>:<fpage>205</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12974-019-1596-z</pub-id>
</citation>
</ref>
<ref id="B47">
<label>47</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Knierim</surname> <given-names>JJ</given-names>
</name>
</person-group>. <article-title>The hippocampus</article-title>. <source>Curr Biol</source>. (<year>2015</year>) <volume>25</volume>:<page-range>R1116&#x2013;21</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cub.2015.10.049</pub-id>
</citation>
</ref>
<ref id="B48">
<label>48</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bystritsky</surname> <given-names>RJ</given-names>
</name>
<name>
<surname>Chow</surname> <given-names>FC</given-names>
</name>
</person-group>. <article-title>Infectious meningitis and encephalitis</article-title>. <source>Neurol Clin</source>. (<year>2022</year>) <volume>40</volume>:<fpage>77</fpage>&#x2013;<lpage>91</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ncl.2021.08.006</pub-id>
</citation>
</ref>
<ref id="B49">
<label>49</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yu</surname> <given-names>Q</given-names>
</name>
<name>
<surname>He</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Zubkov</surname> <given-names>D</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>S</given-names>
</name>
<name>
<surname>Kurochkin</surname> <given-names>I</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>X</given-names>
</name>
<etal/>
</person-group>. <article-title>Lipidome alterations in human prefrontal cortex during development, aging, and cognitive disorders</article-title>. <source>Mol Psychiatry</source>. (<year>2020</year>) <volume>25</volume>:<page-range>2952&#x2013;69</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41380-018-0200-8</pub-id>
</citation>
</ref>
<ref id="B50">
<label>50</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Varvel</surname> <given-names>NH</given-names>
</name>
<name>
<surname>Neher</surname> <given-names>JJ</given-names>
</name>
<name>
<surname>Bosch</surname> <given-names>A</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>W</given-names>
</name>
<name>
<surname>Ransohoff</surname> <given-names>RM</given-names>
</name>
<name>
<surname>Miller</surname> <given-names>RJ</given-names>
</name>
<etal/>
</person-group>. <article-title>Infiltrating monocytes promote brain inflammation and exacerbate neuronal damage after status epilepticus</article-title>. <source>Proc Natl Acad Sci</source>. (<year>2016</year>) <volume>113</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.1604263113</pub-id>
</citation>
</ref>
<ref id="B51">
<label>51</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>T</given-names>
</name>
<name>
<surname>Jin</surname> <given-names>X</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>G</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>F</given-names>
</name>
<name>
<surname>Jin</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Roles of crosstalk between astrocytes and microglia in triggering neuroinflammation and brain edema formation in 1,2-dichloroethane-intoxicated mice</article-title>. <source>Cells</source>. (<year>2021</year>) <volume>10</volume>:<fpage>2647</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/cells10102647</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>