A total of 130 NDMM patients admitted to Mianyang Central Hospital between June 2015 and August 2024 were enrolled in this study. All patients met the diagnostic criteria outlined in the International Myeloma Working Group (IMWG) guidelines (30). Clinical data collected included gender, age, lactate dehydrogenase (LDH) levels, β2-microglobulin (β2-MG) levels, and the proportions of peripheral blood (PB) Treg and Th17 cells within the CD4+ T cell population.

The following cell subtypes were analyzed in this study:Treg (CD3+CD4+CD25+FOXP3+) and Th17 (CD3+CD4+IL-17+) cells (31, 32). Flow cytometry was used to investigate the frequencies of Treg and Th17 cells.

For Th17 cells analysis, 250 μL of heparin-anticoagulated PB samples was diluted 1:1 with RPMI 1640 culture medium (Hyclone, catolog: SH30027.01). A 1 μL of 500× cell stimulator (Thermo Fisher Scientific, catalog 00-4975-93) was added and thoroughly mixed. The mixture was transferred to a 6-well plate and incubated at 37°C with 5% CO₂ for 5 hours. After incubation, red blood cells were lysed using a lysis buffer (Beyotime, catolog C3702). Cells were then harvested, washed, and stained for surface markers CD45 PerCP (catalog 045-104-3/clone 4A/Biotech), CD3 FITC (catalog 340542/clone SK7/BD), and CD4-PEcy7 (catalog 348799/clone SK3/BD). Intracellular cytokine staining was performed using the Intracellular Fixation & Permeabilization Buffer Set (eBiosciences, catalog 88-8824-00) according to the manufacturer’s instructions. Briefly, cells were fixed, permeabilized, and incubated with IL-17A PE (catalog 12-7179-42/clone eBio64 DEC 17/Thermo Fisher) for 30–40 minutes at room temperature in the dark. The percentage of IL-17A+ cells was calculated relative to the total CD3+CD4+ T cell population.

For Tregs analysis, red blood cells in whole blood samples were lysed, followed by surface staining for CD45 PerCP (catalog 045-104-3/clone 4A/Biotech), CD3 FITC (catalog 340542/clone SK7/BD), CD4-PEcy7 (catalog 348799/clone SK3/BD), and CD25 APC (catalog 567316/clone BC96/BD). Nuclear transcription factor FOXP3 staining was performed using the FOXP3/Transcription Factor Staining Buffer Set (eBiosciences, catalog 00-5523-00) according to the manufacturer’s instructions. Cells were fixed, permeabilized, and incubated with FOXP3 PE (catalog 12-4776-42/clone PCH101/Thermo Fisher) for 60 minutes at room temperature in the dark.

The proportions of Treg and Th17 cells were calculated as percentages of the total CD3+CD4+ T cell population. Samples were analyzed using a BD FACSCanto flow cytometer (BD Biosciences), and data were processed using DIVA software. The analysis of Treg and Th17 subsets was performed sequentially, as illustrated in Figure 1 . Detection of Treg and Th17 cells was conducted by Sichuan West China Kang Shengda Medical Testing Co., Ltd.

Fluorescence in situ hybridization (FISH) combined with immunofluorescence was used for cytogenetic analysis. All bone marrow (BM) samples were enriched for plasma cells using CD138 immunomagnetic bead sorting. Genetic abnormalities were evaluated according to the positive thresholds established by the European Myeloma Network (33). Specifically, 1q21 gain/amplification was defined as ≥20% of nuclei displaying at least three copies of 1q21. The del(17p) and del(13q) were defined as ≥20% of nuclei showing deletions at 17p13 and 13q14.3, respectively. Translocations, including t(11;14)(q13;q32), t(4;14)(p16;q32), t(6;14)(p21;q32), and t(14;16)(q32;q23), were defined as ≥10% of nuclei exhibiting the respective translocation patterns. FISH analysis for MM was conducted by Sichuan West China Kang Shengda Medical Testing Co., Ltd.

This study performed comprehensive molecular characterization of MYC gene in PB samples, including expression analysis, mutational screening and rearrangement detection. MYC gene expression levels were quantified using SYBR Green-based real-time quantitative PCR (RT-qPCR), with ABL1 serving as the endogenous reference gene for normalization. Absolute quantification was achieved through standard curve method to determine MYC and ABL1 copy numbers, with MYC/ABL1 ratio (expressed as percentage) calculated for expression normalization (Forward primer: 5’- CTCTCCGTCCTCGGATTCTC -3’; Reverse primer: 5’- ATCTTCTTGTTCCTCCTCAGAGT -3’). MYC gene rearrangements were identified by FISH targeting 8q24.21 locus. For mutation analysis, the entire MYC coding region and adjacent splice sites were examined by Sanger sequencing following PCR amplification, utilizing 7 PCR reactions and 14 sequencing runs to ensure complete coverage. Appropriate positive and negative controls were included throughout all experimental procedures to ensure data reliability. Detection of MYC gene was conducted by Sichuan West China Kang Shengda Medical Testing Co., Ltd.

Staging was performed using the Revised International Staging System (R-ISS) (34), Mayo Stratification of Myeloma and Risk-adapted Therapy (mSMART) (35), and the second revision of the International Staging System (R2-ISS) (36). For R2-ISS, baseline risk factors, including ISS stage, LDH elevation, del(17p), t(4;14), and 1q21+, were assigned weighted scores. Patients were stratified into four risk groups based on R2-ISS scores: low risk (R2-ISS I, 0 points), low-intermediate risk (R2-ISS II, 0.5–1 points), intermediate-high risk (R2-ISS III, 1.5–2.5 points), and high risk (R2-ISS IV, 3–5 points).

All patients were treated in accordance with the guidelines for the diagnosis and management of MM (37, 38). Final treatment plans were established by consensus between clinicians and the patient. Treatment regimens were categorized according to induction and consolidation strategies. Specifically, 67 patients received bortezomib-based therapy, 3 patients underwent immunomodulatory drug-based treatment, 56 patients were administered a combination of bortezomib and immunomodulators, and 4 patients were treated with daratumumab-based regimens. Treatment efficacy was evaluated based on the 2016 IMWG criteria (39), which categorize responses into strict complete response (sCR), complete response (CR), very good partial response (VGPR), partial response (PR), minimal response (MR), stable disease (SD), and progressive disease (PD). Some patients underwent autologous hematopoietic stem cell transplantation (ASCT) after achieving at least a PR. Patients who responded effectively to induction therapy continued with consolidation and maintenance therapy until disease relapse, progression, or the occurrence of severe adverse drug reactions requiring a change in treatment. Maintenance therapy predominantly involved the use of proteasome inhibitors (PIs) or immunomodulatory drugs (IMiDs). The median follow-up time was 27.6 months (range: 0.4–111.7 months). Progression-free survival (PFS) was defined as the time from diagnosis to relapse, death, or the end of follow-up. Overall survival (OS) was defined as the time from diagnosis to death from any cause or the end of follow-up.

All statistical analyses were performed using SPSS version 26.0, while GraphPad Prism 8.0 was used to visualize the summarized data. Normality was assessed using Shapiro-Wilk tests. Normally distributed continuous data were expressed as mean ± standard deviation and analyzed using the t-test. Non-normally distributed data were presented as median (range) and compared using the Mann–Whitney U test. The Kruskal–Wallis H test was used for comparisons among the three groups. Categorical variables were evaluated by Chi-square test or Fisher’s exact test, as appropriate. Receiver operating characteristic (ROC) curves were used to determine the optimal cutoff value. Univariate survival analyses were carried out using the Kaplan Meir methods. The prognostic performance of the combined R2-ISS/Treg/Th17 risk stratification model was quantitatively assessed using the concordance index (C-index), with calculation performed using R statistical software version 4.2.1. The C-index value of 1.0 indicates perfect prediction 0.5 indicates no predictive ability. A two-tailed p-value < 0.05 was considered statistically significant. When performing pairwise comparisons among the three groups, a P-value < 0.0167 (Bonferroni correction) was considered statistically significant.

A total of 130 NDMM patients admitted to Mianyang Central Hospital between June 2015 and August 2024 were enrolled in this study. Of these, 79 (60.8%) were male and 51 (39.2%) were female, with a median age of 63 years (range: 38–87 years). PFS was evaluable in 94 patients, and OS was evaluable in 96 patients. First relapse occurred in 39.4% of patients, with a median PFS of 30.7 months (95% CI: 26.58–34.82 months). The mortality rate was 9.4%, and the median OS was not reached. The 5-year survival rate was 68%. Among 85 patients assessable for R-ISS staging, 10.6% (9/85) were classified as stage I, 69.4% (59/85) as stage II, and 20.0% (17/85) as stage III. Among 81 patients assessable for R2-ISS staging, 9.9% (8/81) were classified as low risk, 11.1% (9/81) as low-intermediate risk, 59.3% (48/81) as intermediate-high risk, and 19.8% (16/81) as high risk. According to the Mayo mSMART 3.0 risk stratification, 38.5% of patients were classified as standard risk and 61.5% as high risk.

In the study involving 82 patients subjected to 1q21 testing, 57.3% (47 cases) manifested 1q21 gain/amplification. The distribution of ISS and R-ISS stages differed significantly between patients with 1q21 gain/amplification and those without 1q21 gain/amplification (p < 0.05). Specifically, pairwise comparisons demonstrated that a significantly higher proportion of patients with 1q21 gain/amplification were classified as ISS stage II and R-ISS stage III compared to those without 1q21 gain/amplification (p < 0.0167), Table 1 .

The proportion of patients with 1q21 gain/amplification who also harbored t(4;14) was significantly higher compared to those without 1q21 gain/amplification (34.8% vs. 2.9%, p = 0.000). However, no significant differences were observed between patients with and without 1q21 gain/amplification in the occurrence of other high-risk cytogenetic abnormalities, including t(14;16), del(17p), or p53 mutations (all p > 0.05). Importantly, the proportion of patients with 1q21 gain/amplification harboring at least one high-risk cytogenetic abnormality—such as del(17p), t(4;14), t(14;16), or p53 mutations—was markedly higher than that of patients without 1q21 gain/amplification (57.8% vs. 17.1%, p =0.000), as summarized in Table 1 .

The median Treg/Th17 ratio during remission in patients with 1q21 gain/amplification at initial diagnosis was 1.59 ± 0.56%, significantly higher than that in patients without 1q21 gain/amplification (0.85 ± 0.34%), with a p-value of 0.042 ( Figure 2A ). However, there was no significant difference in the Treg/Th17 ratio at diagnosis between the groups with and without 1q21 gain/amplification (p > 0.05; Figure 2B ), Table 1 .

Patients with 1q21 gain/amplification at diagnosis exhibited slightly higher Treg percentages at both diagnosis and remission compared to those without 1q21 gain/amplification, although the differences were not statistically significant (p > 0.05; Figures 2C, D ). Additionally, no significant differences in Th17 percentages were observed at diagnosis or remission between patients with and without 1q21 gain/amplification (p > 0.05; Figures 2E, F ), Table 1 .

The median PFS in patients with 1q21 gain/amplification was 23.70 months, slightly shorter than that in patients without 1q21 gain/amplification (44.83 months), although the difference was not statistically significant (χ² = 0.371, p = 0.542; Figure 3A ). Similarly, 1q21 gain/amplification status had no significant impact on OS (χ² = 1.430, p = 0.232; Figure 3B ).

To investigate potential associations between 1q21 abnormalities and Treg/Th17 immune regulation, we performed comprehensive MYC gene profiling of PB samples from MM patients. This included analysis of MYC rearrangements (by FISH), mutation screening (via sanger sequencing), and quantitative expression assessment (using RT-qPCR).

In our cohort of 17 newly diagnosed patients who underwent MYC rearrangement testing: one patient (5.9%) showed MYC rearrangement negativity with increased gene copy number; one patient (5.9%) demonstrated concurrent MYC rearrangement and 1q21 gain/amplification, and the remaining 15 patients (88.2%) showed no MYC structural abnormalities.

To comprehensively characterize MYC gene mutational profiles, we performed systematic sequencing analysis at three distinct clinical stages: initial diagnosis, remission, and recurrence. The complete MYC gene sequencing results for each disease phase are presented in Figure 4A . Given the lack of known hematological disease associations for any detected MYC mutations, we classified the sequencing results into two categories: no mutations and with mutations present (including COSMIC-listed, synonymous, and unannotated variants). At initial diagnosis, MYC mutations were detected in 84.6% (11/13) of patients with 1q21 gain/amplification, slightly higher than the 33.3% (1/3) observed in those without 1q21 gain/amplification (p =1.136), Table 1 . Although this difference did not reach statistical significance, the observed trend suggests a potential association between 1q21 gain/amplification and MYC mutational status.

Quantitative analysis of MYC gene expression revealed that at the initial diagnosis of patients (n = 41), the median level of MYC gene expression was 70.55% (range: 11.60 - 2384.14%). During the remission period of patients (n = 29), the expression of the MYC gene was 57.57 ± 32.76%. When the disease recurred (n = 14), the expression of the MYC gene increased again (127.62 ± 86.72%). MYC gene expression varied significantly across disease stages (initial diagnosis, remission, relapse; p=0.019). Further pairwise comparisons revealed that MYC gene expression was significantly higher during relapse compared to remission (t=3.855, p=0.011). Quantitative analysis revealed significantly higher MYC expression levels in patients with 1q21 gain/amplification (70.54 ± 32.62%, n=17) compared to those without 1q21 gain/amplification (32.76 ± 21.20%, n=4) during remission (p=0.042), as presented in Table 1 and Figure 4B . However, no significant difference in MYC expression was observed at initial diagnosis between patients with and without 1q21 gain/amplification (p=0.950, Table 1 ).

Using disease recurrence as the endpoint, ROC curve analysis identified the optimal Treg/Th17 ratio cutoff values at distinct disease stages: 1.0 (AUC = 0.750) at initial diagnosis, 0.7 (AUC = 0.583) during remission, and 1.0 (AUC = 0.671) at recurrence. At the initial diagnosis, there was no statistically significant difference in MYC gene expression between the group with an elevated Treg/Th17 ratio (>1.0, n = 4) and the group with a decreased Treg/Th17 ratio (≤1.0, n = 6), with expression levels of 104.64% and 98.12%, respectively (p = 0.888), Figure 4C . Likewise, there was no statistically significant difference in the MYC gene expression level during remission between the group with an elevated Treg/Th17 ratio (>1.0 n = 4) and the group with a decreased Treg/Th17 ratio (≤1.0, n = 6) at the initial diagnosis (79.72% vs. 83.80%, p = 0.819), Figure 4D . Patients with an elevated Treg/Th17 ratio (>0.7, n=7) during remission demonstrated MYC gene expression levels of 45.70 ± 28.41%, those with a reduced Treg/Th17 ratio (≤0.7, n=3) during remission showed MYC expression levels of 30.60 ± 24.92%. However, statistical analysis indicated no significant difference between these groups (t=0.793, p=0.451), Figure 4E .

Given the limited sample size in our study, we further examined the relationship between 1q21 amplification, MYC expression, FOXP3 and IL-17A using the MMRF database and GEO dataset (GSE190042). Since these genomic databases lacked direct measurements of Treg and Th17 cell frequencies, we analyzed FOXP3 (a specific Treg transcription factor) and IL-17A (the defining cytokine of Th17 cells) expression levels as surrogate markers.

The MMRF database comprised 774 CD138⁺ BM samples, including 182 (23.5%) with 1q21 gain/amplification, 586 (75.7%) without, and 6 unevaluable cases. Patients with 1q21 gain/amplification exhibited significantly higher FOXP3 expression (median: 0.18, range: 0–1.02) than those without (median: 0.16, range: 0.00–0.80; Z= 2.230, p= 0.026). In contrast, IL-17A expression did not differ significantly (p= 0.932), nor did the FOXP3/IL-17A ratio (p= 0.418). MYC expression was marginally higher in the 1q21 gain/amplification group (median: 5.78, range: 0.30–9.73 vs. 5.61, range: 0.12–9.25; p= 0.078). Patients were stratified into high-MYC (expression above median) and low-MYC (expression below median) groups. The high-MYC group demonstrated significantly reduced FOXP3 expression (median: 0.15, range: 0.00-1.02) compared to the low-MYC group (median: 0.19, range: 0.00-0.77; Z = 4.983, p =0.000). While IL-17A expression showed a modest but significant increase in the high-MYC group (median: 0.00, range: 0.00-3.47 vs. 0.00, range: 0.00-0.58; Z = 2.068, p = 0.039), the FOXP3/IL-17A ratio remained comparable between groups (p = 0.647). Analysis of the GEO dataset (GSE190042) included 93 MM patients, with 72 NDMM cases. The cohort included 48 patients with 1q21 gain/amplification and 38 patients without 1q21 gain/amplification. There were no significant differences in FOXP3, IL-17A, and MYC expression between the two groups (p=0.057, 0.338, and 0.114, respectively). When stratified by median MYC expression, the FOXP3/IL-17A ratio showed borderline elevation (high MYC: 1.60 ± 0.14 vs low: 1.54 ± 0.10, p=0.055), potentially indicating a biologically relevant trend. Notably, low expression levels of FOXP3 and IL-17A were observed, which were correlated with CD138 enrichment in the tested samples. Despite this, these findings offer valuable biological insights.

Among the patients available for Treg and Th17 analysis, only one patient received immunomodulator drug-based therapy and one patient received daratumumab-based therapy, respectively. The regimens are mainly classified into bortezomib-based therapy and combination therapy of bortezomib and IMiDs. There was no significant difference in the levels of Treg or Th17 between the two treatment regimens at any stage (initial diagnosis, remission, or recurrence) ( Table 2 ).

A total of 34 patients were evaluated for Treg and Th17 levels at diagnosis. Analysis revealed no significant correlation between Treg or Th17 expression levels and key clinical parameters, including white blood cell count, lymphocyte-to-monocyte ratio, platelet -to- lymphocyte ratio (PLR), and LDH levels (p > 0.05). We evaluated the relationship between Treg or Th17 levels and optimal treatment response. The analysis revealed that the median baseline Th17 level in patients achieving a PR or better response was 3.34% (range: 0.19–10.80%), significantly higher than that in patients without PR (0.29%, range: 0–2.18%), the difference was statistically significant (Z=2.127, p=0.033). However, no significant differences were observed between responders (PR or better) and non-responders in Treg levels at diagnosis, the Treg/Th17 ratio at diagnosis, Th17 levels after 4–6 treatment cycles, or Th17 levels after 8–12 treatment cycles (p = 0.748, 0.616, 1.000, and 0.111, respectively). The median Treg/Th17 ratio at diagnosis was 0.62 (range: 0–32.26). With the Treg/Th17 cutoff value of 1.0 at initial diagnosis established by ROC curve analysis, patients were categorized into an elevated group (ratio > 1.0) and a reduced group (ratio ≤ 1.0). The PFS in the elevated group was significantly shorter (13.87 months) than that in the reduced group (30.67 months), demonstrating a statistically significant difference (χ² = 7.606, p = 0.006, Figure 5A ). In contrast, the OS in the elevated group was 35.7 months, compared to 38.0 months in the reduced group, with no significant statistical difference (χ² = 0.002, p = 0.964, Figure 5B ).

A total of 16 patients were assessed for Treg and Th17 levels at remission. The median Treg/Th17 ratio at remission was 1.25 (range: 0.57–6.09). Using relapse as the endpoint, ROC curve analysis determined an optimal Treg/Th17 ratio cutoff of 0.7 at remission. Patients were stratified into an elevated Treg/Th17 ratio group (ratio > 0.7) and a reduced Treg/Th17 ratio group (ratio ≤ 0.7). Analysis demonstrated that the Treg/Th17 ratio at remission had no significant effect on PFS (χ² = 0.112, p = 0.738; Figure 5C ).

A total of 19 patients were evaluated for Treg and Th17 levels at relapse. The median Treg/Th17 ratio at relapse was 0.53 (range: 0–16.20). Using overall survival as the endpoint, ROC curve analysis identified an optimal Treg/Th17 ratio cutoff of 1.0 at disease relapse. Patients were stratified into an elevated Treg/Th17 ratio group (ratio > 1.0) and a reduced Treg/Th17 ratio group (ratio ≤ 1.0). Analysis revealed that the median OS in the elevated ratio group was 61.6 months, while the median OS in the reduced ratio group was not reached. However, no statistically significant difference was observed between the two groups (χ² = 1.412, p = 0.235; Figure 5D ).

This study demonstrated that neither the Mayo mSMART 3.0 stratification nor the traditional R-ISS staging had no significant impact on PFS (p > 0.05). Although the median PFS was longer in patients with R2-ISS stage I or II than in patients with stage III or IV, the difference was not statistically significant (p > 0.05), Table 3 . Similarly, no statistically significant difference in PFS was observed between R2-ISS stage I– II and stage III–IV patients (χ² = 2.017, p = 0.156, Figure 6A ), nor between R2-ISS stage I–III and stage IV patients (χ² = 0.661, p = 0.416, Figure 6B ).

Given that R2-ISS staging does not incorporate immune-related biomarkers, we assessed the prognostic value of combining R2-ISS staging with the Treg/Th17 ratio at diagnosis. R2-ISS stages I, II, III and IV were assigned scores of 1, 2, 3, and 4, respectively, while a baseline Treg/Th17 ratio > 1.0 was assigned a score of 1. A novel risk stratification index was developed based on the sum of the R2-ISS stage score and the baseline Treg/Th17 ratio score. Patients with a total score of 1–3 were classified as low-risk (12 cases), and those with a score of 4–5 were classified as high-risk (9 cases). Analysis demonstrated that high-risk patients, as defined by the combined R2-ISS staging and Treg/Th17 ratio at diagnosis, exhibited significantly worse PFS compared to low-risk patients (χ² = 5.211, p = 0.022, Figure 6C ). The prognostic performance of the stratification models for PFS was evaluated using the concordance index (C-index). The combined R2-ISS staging and Treg/Th17 ratio at diagnosis achieved a C-index of 0.8, outperforming R-ISS staging (0.50), R2-ISS staging (0.562), and Mayo mSMART 3.0 stratification (0.61), indicating superior predictive accuracy, Figure 6D .