Female C57BL/6 mice (Jackson Laboratories #000664) and female BALB/c mice (Jackson Laboratories #000651), aged 5–8 weeks, were used for the study. Animal experiments were performed in full compliance with the Guide for the Care and Use of Laboratory Animals, 8th edition (37), under a protocol approved by Baylor College of Medicine’s Institutional Animal Care and Use Committee (IACUC) under assurance number D16-00475. The T. cruzi H1 strain (TcI), transfected with the pTRIX2-RE9h plasmid containing the thermostable, red-shifted firefly luciferase gene PpyRE9h (38–40), designated H1 K68 was grown on monolayers of the C2C12 mouse myocyte cell line (ATCC CRL-1772) in RPMI media supplemented with 5% fetal bovine serum and 1X Penicillin/Streptomycin (cRPMI) to propagate tissue culture trypomastigotes (TCT) (41). Culture media containing TCT was collected, parasites were pelleted by centrifugation, washed once with sterile medical grade saline, and resuspended in sterile medical grade saline.

T. cruzi H1 K68 strain (TcI) is a mouse model for Chronic Chagasic cardiomyopathy (CCC) and was selected to ensure the survival of the animals during the study (41, 42). Ninety-six mice (48 BALB/c and 48 C57BL/6) were randomly assigned to form infected or control groups ( Table 1 ). The infected groups (24 BALB/and 24 C57BL/6) received by intraperitoneal route 100μL of saline solution containing 5000 trypomastigotes of T. cruzi H1 K68, generated in our laboratory ( Table 1 ) (41). The control groups (24 BALB/c and 24 C57BL/6) received the same volume of saline solution intraperitoneally ( Table 1 ). Blood was collected by tail vein microsampling from all infected mice every week beginning at 7 days post-infection (DPI) to follow parasitemia by quantitative PCR. Mice were monitored daily for morbidity; no clinical signs or mortality were observed during the study. At the study endpoints, 14, 28, and 49 DPI, all mice were humanely euthanized, and hearts, whole blood, femur, and spleens were collected for analysis ( Figure 1 ).

According to the manufacturer’s guidelines, DNA was extracted from whole blood and frozen heart tissue (20mg) using a PDQeX Nucleic Acid Extractor (MicroGEM). To measure blood and tissue parasite burden, quantitative real-time PCR was performed using TaqMan Fast Advanced master mix (Life Technologies) and oligonucleotides specific for the satellite region of T. cruzi nuclear DNA (primers 5′-ASTCGGCTGATCGTTTTCGA-3′ and 5′-AATTCCTCCAAGCAGCGGATA-3′ and probe 5′-6-FAM-CACACACTGGACACCAA-MGB-3′. T. cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH)using the following primers: 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’ GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; (Life Technologies, CA, USA). After normalization, parasite burden was calculated based on the standard curve of known parasite concentrations. GraphPad Prism software was used to plot parasite equivalents per milliliter of blood over time, and the area under the curve (AUC) was calculated for each animal to determine overall parasitemia. Cardiac parasite burdens were calculated based on a standard curve and expressed as the number of parasites per milligram of tissue (43).

Spleens were rinsed in sterile 1X PBS, then transferred to a gentleMACS C Tube containing 3 mL of sterile 1X PBS. The tissue was homogenized using a gentleMACS Dissociator (Miltenyi Biotech, Surrey, UK). Red blood cells in the spleen homogenates were subsequently lysed with ACK lysis buffer (Lonza, 10-548E). The lysis solution was diluted 5-fold with RPMI medium supplemented with 10% fetal bovine serum FBS, 1× penicillin-streptomycin (Pen-Strep), and l-glutamine (cRPMI medium). Then splenocytes were pelleted by centrifugation for 5 min at 300 × g. Splenocytes were resuspended in 5 mL of cRPMI medium and passed through 40μm strainers (BD Biosciences, 352340). Cells were counted using acridine orange-propidium iodide (AOPI) live/dead dye and a Cellometer Auto 2000 automated cell counter. Then, 1 × 10⁶ live splenocytes were incubated for each sample in a 96-well non-tissue culture plate. For intracellular staining, splenocytes were incubated with 50 ng/mL phorbol 12-myristate 13-acetate (PMA)–500 ng/mL ionomycin, or medium only for 5 h at 37°C in 5% CO_2. These cells were then analyzed by flow cytometry and Luminex.

Bone marrow was extracted from the femurs of each mouse using a 25 G x 5/8 in. needle and 10 mL syringe into RPMI-1640 media supplemented with 10% fetal bovine serum FBS, 1× penicillin-streptomycin (Pen-Strep), and l-glutamine (cRPMI medium). The suspension was filtered through 40μm strainers (BD Biosciences, 352340). Cells were counted using acridine orange-propidium iodide (AOPI) live/dead dye and a Cellometer Auto 2000 automated cell counter. Then, 1×10⁶ live cells were incubated for each sample in a 96-well non-tissue culture plate. These cells were then analyzed by flow cytometry.

To measure CD4- and CD8- responses, splenocytes were collected 5 hours post restimulation for flow cytometry labeling, washed with PBS, and stained with Live/Dead NIR fixable viability dye, anti-CD3e PE (phycoerythrin)/Dazzle 594, anti-CD4 Alexa Fluor 700, and anti-CD8a peridinin chlorophyll protein (PerCP)-Cy5.5. Tfh was evaluated with anti-CD44 fluorescein isothiocyanate (FITC), anti-CD185 (CXCR5) BV421 Brilliant Violet 421 (BV-421) and anti-CD279 (PD-1) PE (phycoerythrin)-Cy7 (PE-Cy7) ( Supplementary Table S1 ). To evaluate intracellular cytokine production, 4.1 μg/ml brefeldin A was added to splenocytes during the 5 h of restimulation. Splenocytes were stained for surface markers as described above, fixed with BD Cytofix/Cytoperm, and permeabilized according to the manufacturer’s instructions. Permeabilized splenocytes were stained with anti-IFN-γ Alexa Fluor 647, anti-TNF Brilliant Violet 605 (BV-605), IL-4 Brilliant Violet 711 (BV-711) and IL-21 phycoerythrin (PE) ( Supplementary Table S1 ). To evaluated B cells, splenocytes or bone marrow cells were collected and stained with Live/Dead Aqua fixable viability dye, anti-CD4 FITC, anti-CD8 FITC, anti-Ly-6G/Ly-6C (Gr-1) FITC, anti-F4/80 FITC and anti-CD11c FITC, anti-CD19 BV-421 or BV-711, anti-CD38 PerCP-Cy5.5 or BV-711, anti-CD86 allophycocyanin (APC), anti- CD184 (CXCR4) PE, anti-mouse CD95 (Fas) BV-605, anti-CD138 APC, anti-CD45R (B220) PE-eFluor 610, anti-IgD Alexa Fluor 700, anti-IgM PE-Cy7 and anti-IgG1 PerCP-Cy5.5 ( Supplementary Table S1 ). Samples were acquired on an Attune instrument, and at least 100,000 total events in a live gate were analyzed using FlowJo software. Cells were gated on forward and side scatter for lymphocytes, exclusion of viability dye, and singlet populations. T cells ( Supplementary Figure S1 ), Tfh cells ( Supplementary Figure S2 ), CXCR5⁺CD8⁺ cells ( Supplementary Figure S3 ), B cells in the spleen ( Supplementary Figure S4 ), and B cells in bone marrow ( Supplementary Figure S5 ) were determined based on FMO. Absolute numbers were calculated by multiplying the frequency of live cells from the population of interest by the total number of cells collected from the bone marrow. Data were plotted using GraphPad Prism software.

Cell-free supernatant from re-stimulated splenocytes was collected after 5 h and frozen at -80°C until Luminex analysis. Cytokines levels of IL-2, IL-4, IL-6, IL-10, IFN-γ, and TNF-α in supernatants were measured by Luminex-based assay using the Milliplex MAP Mouse kit (Millipore) as previously described (44).

Indirect ELISAs were conducted to measure T. cruzi parasite antibody titers from serum. 96-well NUNC ELISA plates were coated overnight at 4°C with 2 μg/mL of T. cruzi H1 K68 strain parasite lysate (45) in 1x coating buffer (KPL). The coating buffer was discarded the following day, and the plates were blocked with assay buffer (0.1% BSA/1X PBS/0.05%Tween 20) for 2 h at room temperature. Mouse serum was serially diluted two-fold in assay buffer, starting at a 1:200 dilution. For the negative control, pooled naïve mouse sera were also diluted to 1:200. ELISA plates were washed using a BioTek 405 TS plate washer and PBST (1X PBS/0.05%Tween 20). Diluted mouse serum and the controls were added to the washed ELISA plates in duplicate at 100 μL/well and incubated for 2 h at room temperature. Following incubation, the plates were washed four times. Then, 100 μL/well of the appropriate secondary antibodies were added: 1:6000 diluted goat anti-mouse IgM HRP (Lifespan Bioscience), goat anti-mouse IgG1 HRP (Lifespan Bioscience), goat anti-mouse IgG2a HRP (Lifespan Bioscience), or 1:40000 diluted goat anti-mouse Ig2c HRP (Lifespan Bioscience). After 1 h of incubation at room temperature, the ELISA plates were washed five times. Then, 100 μL of TMB substrate (KPL) was added to each well and incubated for 15 minutes. The reaction was stopped by adding 100 μL/well 1M HCl, and the absorbance at 450 nm was measured using an Epoch 2 spectrophotometer (Biotek). Duplicate values of the measured O.D. at 450 nm were averaged for data analysis. The titer cutoff value was calculated as follows: titer cutoff = average negative control + 3 x standard deviation of the negative control. The titer was determined for each mouse serum sample by taking the corresponding dilution factor of the highest dilution with an average O.D. value above the titer cutoff. If a sample did not show an average O.D. value above the titer cutoff at 1:200, an arbitrary titer value of 67 was assigned (baseline).

Statistical analysis was performed using GraphPad Prism software version 9.3.1 for Windows (GraphPad Software, San Diego, California, USA). Significance was calculated by the Normality test followed by the parametric Unpaired t-test or nonparametric Mann-Whitney test. P values ≤0.05 were considered significant. The figures’ P-values ≤0.05, ≤0.01, ≤0.001, and ≤0.0001 are represented as one, two, three, and four symbol characters, respectively.

BALB/c mice exhibit a classical Tfh cell response, including expansion of IL-21-producing Tfh cells, compared to C57BL/6 mice during H1 K68 T. cruzi infection. Tfh cell response was evaluated by flow cytometry. Results showed that BALB/c infected mice compared to naïve show an increase in CD4⁺CD44⁺CXCR5^hiPD-1⁺ Tfh cells at 14, 28, and 49 DPI, which is not present in the C57BL/6 model ( Figure 2A ). In the same direction, when IL-21 Tfh-producing cells are evaluated, an expansion of CD4⁺CD44⁺CXCR5⁺IL-21⁺ cells are observed in BALB/c infected mice compared to naïve in all time points but not in C57BL/6 ( Figure 2B ). In addition, these cells are expanded in BALB/c infected mice compared to C57BL/6 infected mice at 28 and 49 DPI ( Figure 2B ). Otherwise, when CD4⁺CD44⁺CXCR5⁺IFN-γ⁺ cells are evaluated, we observe an expansion in C57BL/6 infected mice compared to naïve at 14, 28, and 49 DPI, while in BALB/c mice this increase is present only at 28 and 49 DPI ( Figure 2D ). Analyzing the infected group from both mouse models, there is an expansion of these cells in C57BL/6 compared to BALB/c mice in all time points ( Figure 2D ). Interestingly, evaluating CD4⁺CD44⁺CXCR5⁺ cells that are both IFN-γ⁺ and IL-21⁺, C57BL/6 infected mice show an increase of these cells compared to naïve and to BALB/c infected mice at 14 DPI ( Figure 2E ). However, at 28 DPI this population is only expanded in BALB/c infected mice compared to naïve ( Figure 2E ). Yet at 49 DPI, this polyfunctional cells are expanded in both infected mouse models compared to naïve, and in BALB/c infected mice compared to C57BL/6 infected mice ( Figure 2E ).

Finally, the evaluation of CD4⁺CD44⁺CXCR5⁺IL-4⁺ cells showed that in the infected group from both models, these cells are expanded at 14, 28, and 49 DPI compared to naïve ( Figure 2C ). But at 49DPI BALB/c infected mice also present an expansion of these cells compared to C57BL/6 infected group ( Figure 2C ). A Uniform Manifold Approximation and Projection (UMAP) was generated to analyze cytokine production by CD4⁺CD44⁺CXCR5⁺ T cells at 14 DPI ( Figure 2F ). Results showed that most IFN-γ⁺ cells overlap with CD44⁺CXCR5⁺, contrarily to IL-21⁺ cells. In contrast, IL-4⁺ cells are spread in CD4⁺ regions that are CD44⁺CXCR5⁺ and not positive for these markers ( Figure 2F ).

CD8⁺CXCR5⁺ T cells, including IL-21-producing subsets, are expanded in both BALB/c and C57BL/6 mice during H1 K68 T. cruzi infection, with C57BL/6 mice showing a more pronounced expansion at 14 DPI. Recent work in different models and diseases has identified unique subsets of CD8⁺ T cells expressing the chemokine receptor CXCR5, which directs these cells into secondary lymphoid follicles (47). Comparing H1 K68 T. cruzi infection using BALB/c and C57BL/6 mice, flow cytometry results showed that IL-21 CD8⁺CXCR5⁺ producing cells, that have been described as antibody-enhancement (B cell “helper”) subset (48, 49), are increased in infected mice compared to naïve in both models only at 14 DPI ( Figure 3A ). CD8⁺CXCR5⁺IL-4⁺ population is expanded exclusively in C57BL/6 infected mice compared to naïve at 14 and 49 DPI ( Figure 3B ). IL-21 or IL-4 CD8⁺CXCR5⁺ producing cells are also expanded in C57BL/6 infected mice compared to BALB/c infected mice at 14DPI ( Figures 3A, B ). Another CD8⁺CXCR5⁺ subset that has been reported as antibody-suppressor (50, 51) and described as CD8⁺CD44⁺CXCR5⁺PD-1^-CXCR5⁺IFN-γ⁺ cells was also evaluated. Results showed that these cells are increased in the infected group compared to naïve in both models at 14, 28, and 49 DPI ( Figure 3C ).

BALB/c mice exhibit an earlier and stronger expansion of germinal center B cells compared to C57BL/6 mice during H1 K68 T. cruzi infection, with BALB/c mice producing higher levels of parasite-specific IgG1. To start the B cell immune response characterization, germinal center (GC) B cells were evaluated by flow cytometry. Results showed that in BALB/c infected mice, the expansion of CD19⁺CD38^-FAS⁺ GC B cells starts at 14 DPI, massively expands at 28 DPI, and continues at 49 DPI ( Figure 4A ). In C57BL/6 mice, the expansion of GC B cells in infected mice compared to naïve only happens at 28 DPI and continues at 49 DPI ( Figure 4A ). Also, this population is expanded in BALB/c infected mice compared to C57BL/6 infected mice at 14 DPI ( Figure 4A ). When the dark zone (DZ), CD19⁺CD38^-FAS⁺ CXCR4⁺CD86^- cells, and the light zone (LZ), CD19⁺CD38^-FAS⁺ CXCR4^-CD86⁺ cells, components of the GC B cells were evaluated, we observe a significant increase in both populations in BALB/c infected mice at 14, 28 and 49 DPI compared to naïve ( Figures 4B,C ). Meanwhile, in C57BL/6 infected mice, only LZ GC B cells increase starting at 28 DPI and continuing at 49 DPI ( Figures 4B, C ).

Following the B cell response characterization, memory B cells (MBC) and antibody-secreting cells (ASC) were evaluated by flow cytometry. Comparing naïve and infected groups, we observe an increase in the isotype switched C19⁺CD38⁺IgM^- MBC cells in BALB/c infected mice at 14, 28, and 49 DPI. In C57BL/6 infected mice, this expansion is present only at 14 and 28 DPI ( Figure 4D ). In addition, this population is expanded in BALB/c infected mice compared to C57BL/6 infected mice at 14 and 28 DPI ( Figure 4D ). IgG1⁺MBC were also analyzed, results showed that these cells are highly expanded in BALB/c infected mice compared to naïve at 28 and 49 DPI, while in C57BL/6 infected mice, this population is increased only at 28 DPI ( Figure 4E ). These cells are also expanded in BALB/c infected mice compared to C57BL/6 infected mice at 28 and 49 DPI ( Figure 4E ). The percentage of CD19⁺IgD^-CD138⁺ ASC is reduced in BALB/c infected mice compared to the naïve at 14 DPI ( Figure 4F ). However, at 28 DPI, these cells are expanded in BALB/c and C57BL/6 infected mice compared to the naïve groups ( Figure 4F ). Additionally, IgM, IgG1, and IgG2a for BALB/c mice, and IgG2c for C57BL/6 mice, T. cruzi-specific antibody titers were analyzed by ELISA. Results showed no significant differences in IgM production between BALB/c and C57BL/6 mice ( Figure 4G ). Also, higher titers of parasite-specific IgG1 are produced in BALB/c compared to C57BL/6 infected mice at 28 and 49 DPI ( Figure 4H ). However, C57BL/6 Ig2c titers were higher than BALB/c Ig2a at 14 DPI, and no differences were observed at 28 and 49 DPI ( Figure 4I ).

In response to H1 K68 T. cruzi infection, both BALB/c and C57BL/6 mice show a reduction in total B cell and antibody-secreting cell populations in the bone marrow at earlier time points (14 and 28 DPI). But by 49 DPI, there is an increase in B cell numbers in both strains, with C57BL/6 mice showing a rebound in ASC population. B cell immune response to H1 K68 T. cruzi infection was also evaluated in the bone marrow. Flow cytometry analysis showed that the percentage of B220⁺CD19⁺ total B cells decreases when we compare C57BL/6 naïve to infected mice at 14 and 28 DPI ( Figure 5A ). In addition, we observe a reduction in the number of these cells at 28 DPI ( Figure 5B ). BALB/c infected mice present a reduction in the frequency of total B cells at 28 DPI ( Figure 5A ). At 49 DPI, in both models, the infected mice have an increment in the number of these cells compared to the naïve ( Figure 5B ). ASC were also evaluated, the percentage of CD19⁺IgD^-CD138⁺ cells decreased when we compared BALB/c naïve to infected mice at 14 and 28 DPI ( Figure 5C ). C57BL/6 infected mice present a reduction in ASC frequency at 28 DPI, yet an increment at 49 DPI compared to the naïve ( Figure 5C ). The number of this population decreased in BALB/c infected mice compared to naïve at 28 DPI and increased in C57BL/6 infected mice compared to the control at 49 DPI ( Figure 5D ).

BALB/c mice exhibit significantly higher parasitemia at 7 and 14 DPI and higher cardiac parasite burden at 28 DPI compared to C57BL/6 mice during H1 K68 T. cruzi infection. To compare T. cruzi infection between the two mouse models, BALB/c and C57BL/6 mice were infected with T. cruzi H1 K68, as described above. Parasites in blood were monitored weekly from 7 to 49 DPI ( Figure 6A ). Cardiac parasite burden was evaluated at the endpoints 14, 28, and 49 DPI ( Figure 6B ). BALB/c mice had significantly increased parasitemia at 7 and 14 DPI and cardiac parasite burden at 28 DPI compared to the C57BL/6 mice model ( Figure 6A, B ).

C57BL/6 mice exhibit a Th1 skewed immune response, with higher levels of IFN-γ and TNF-α while BALB/c mice show a Th2 response, characterized by higher IL-4 production, during H1 K68 T. cruzi infection. The characterization of the immune response by multiplex analysis of secreted cytokines was also performed. At 14 DPI, higher levels of IFN-γ and TNF- α were generated in C57BL/6 compared to BALB/c-infected mice, that continues at 28 DPI for IFN-γ ( Figures 7A, F ). Still, at 14 DPI, we have a significant increase of IL-4 in C57BL/6 compared to BALB/c, whereas, at 28 and 49 DPI, the concentration of IL-4 is higher in BALB/c than in C57BL/6 infected mice ( Figure 7D ). At 28 and 49 DPI, the levels of IL-2 and IL-10 are also higher in BALB/c compared to C57BL/6 infected mice ( Figures 7B, E ). Additionally, comparing infected to naïve mice, in C57BL/6 there are increased levels of IL-2 at 14 DPI and reduced levels at 28 and 49 DPI ( Figure 7B ). IL-6 is increased in C57BL/6 infected mice throughout the acute infection ( Figure 7C ). In BALB/c and C57BL/6 mice, IFN-γ and IL-4 are increased in the infected group compared to naïve throughout the acute infection ( Figures 7A, D ). While IL-2 is reduced at 28 and 49 DPI, and TNF-α only in BALB/c at 28 DPI ( Figures 7B, F ). Cytokine-producing CD4⁺ and CD8⁺ T-cells were also evaluated by flow cytometry to compare BALB/c and C57BL/6 mice responses to H1 K68 T. cruzi infection ( Supplementary Figure S6 ).