<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2024.1514613</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Immunology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>A novel liquid-liquid phase separation-related gene signature for predicting prognosis in colon cancer</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Wang</surname>
<given-names>Shuo</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2873727"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Hou</surname>
<given-names>Sen</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2033975"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Jiang</surname>
<given-names>Shan</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1558614"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Chao</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1289967"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Zhang</surname>
<given-names>Peipei</given-names>
</name>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Ye</surname>
<given-names>Yingjiang</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/995367"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Gao</surname>
<given-names>Zhidong</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1108745"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Department of Gastroenterological Surgery, Peking University People&#x2019;s Hospital</institution>, <addr-line>Beijing</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Laboratory of Surgical Oncology, Peking University People&#x2019;s Hospital</institution>, <addr-line>Beijing</addr-line>, <country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Department of Gastroenterology, Shandong Provincial Hospital Affiliated to Shandong First Medical University</institution>, <addr-line>Jinan, Shandong</addr-line>, <country>China</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>Key Laboratory for Neuroscience, Ministry of Education/National Health and Family Planning Commission, Department of Biochemistry, School of Basic Medical Sciences, Peking University Health Science Center</institution>, <addr-line>Beijing</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Zhiwen Luo, Fudan University, China</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Yi-Qing Qu, Shandong University, China</p>
<p>Peng Xia, The University of Chicago, United States</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Zhidong Gao, <email xlink:href="mailto:gaozhidong@pkuph.edu.cn">gaozhidong@pkuph.edu.cn</email>; Yingjiang Ye, <email xlink:href="mailto:yeyingjiang@pkuph.edu.cn">yeyingjiang@pkuph.edu.cn</email>; Peipei Zhang, <email xlink:href="mailto:peipei.zhang@pku.edu.cn">peipei.zhang@pku.edu.cn</email>
</p>
</fn>
<fn fn-type="equal" id="fn003">
<p>&#x2020;These authors have contributed equally to this work and share first authorship</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>19</day>
<month>12</month>
<year>2024</year>
</pub-date>
<pub-date pub-type="collection">
<year>2024</year>
</pub-date>
<volume>15</volume>
<elocation-id>1514613</elocation-id>
<history>
<date date-type="received">
<day>21</day>
<month>10</month>
<year>2024</year>
</date>
<date date-type="accepted">
<day>04</day>
<month>12</month>
<year>2024</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2024 Wang, Hou, Jiang, Wang, Zhang, Ye and Gao</copyright-statement>
<copyright-year>2024</copyright-year>
<copyright-holder>Wang, Hou, Jiang, Wang, Zhang, Ye and Gao</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>An increasing body of evidence indicates that dysregulation of liquid-liquid phase separation (LLPS) in cellular processes is implicated in the development of diverse tumors. Nevertheless, the association between LLPS and the prognosis, as well as the tumor immune microenvironment, in individuals with colon cancer remains poorly understood.</p>
</sec>
<sec>
<title>Methods</title>
<p>We conducted a comprehensive evaluation of the LLPS cluster in 1010 colon cancer samples from the TCGA and GEO databases, utilizing the expression profiles of LLPS-related prognostic differentially expressed genes (DEGs). Subsequently, a LLPS-related gene signature was constructed to calculate the LLPS-related risk score (LRRS) for each individual patient.</p>
</sec>
<sec>
<title>Results</title>
<p>Two LLPS subtypes were identified. Substantial variations were observed between the two LLPS subtypes in terms of prognosis, pathway activity, clinicopathological characteristics, and immune characteristics. Patients with high LRRS exhibited worse prognosis and poorer response to immunotherapy. LRRS was found to be correlated with the clinicopathological characteristics, genomic alterations, and the potential response to immune checkpoint inhibitors therapy of colon cancer patients. Additionally, the biological function of a key gene POU4F1 was verified <italic>in vitro</italic>.</p>
</sec>
<sec>
<title>Conclusions</title>
<p>This study highlights the crucial role of LLPS in colon cancer, LRRS can be used to predict the prognosis of colon cancer patients and aid in the identification of more effective immunotherapy strategies.</p>
</sec>
</abstract>
<kwd-group>
<kwd>liquid-liquid phase separation</kwd>
<kwd>colon cancer</kwd>
<kwd>prognosis</kwd>
<kwd>immunotherapy</kwd>
<kwd>nomogram</kwd>
</kwd-group>
<contract-num rid="cn001">82303089</contract-num>
<contract-num rid="cn002">Y-xsk2021-0004</contract-num>
<contract-sponsor id="cn001">National Natural Science Foundation of China<named-content content-type="fundref-id">10.13039/501100001809</named-content>
</contract-sponsor>
<contract-sponsor id="cn002">Beijing Xisike Clinical Oncology Research Foundation<named-content content-type="fundref-id">10.13039/100018904</named-content>
</contract-sponsor>
<counts>
<fig-count count="10"/>
<table-count count="3"/>
<equation-count count="1"/>
<ref-count count="54"/>
<page-count count="18"/>
<word-count count="6352"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Cancer Immunity and Immunotherapy</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Colorectal cancer ranks third for cancer incidence and second for cancer mortality globally (<xref ref-type="bibr" rid="B1">1</xref>). While advancements in surgery, chemotherapy, and immunotherapy have extended patient survival, the challenge of recurrence and metastasis persists (<xref ref-type="bibr" rid="B2">2</xref>). Consequently, there is an urgent necessity to continuously develop novel prognostic models for precise risk stratification and enhance treatment efficacy.</p>
<p>In addition to membrane-bound organelles, such as mitochondria, nucleus, and endoplasmic reticulum, cells also contain a substantial quantity of liquid-like membraneless organelles that function to compartmentalize proteins and nucleic acids, enabling the performance of specialized biological processes (<xref ref-type="bibr" rid="B3">3</xref>, <xref ref-type="bibr" rid="B4">4</xref>). The formation of these membraneless organelles relies on liquid-liquid phase separation (LLPS), which allows for swift exchange of components with the adjacent cellular matrix or other organelles due to the absence of membranes, thereby contributing to the maintenance of a relatively stable intracellular environment (<xref ref-type="bibr" rid="B5">5</xref>, <xref ref-type="bibr" rid="B6">6</xref>).</p>
<p>The intricate process of membraneless organelle formation involves the coordination of scaffolds, regulators, and clients (<xref ref-type="bibr" rid="B7">7</xref>, <xref ref-type="bibr" rid="B8">8</xref>). Initially, scaffolds establish the structural framework, followed by the involvement of clients, while regulators play a crucial role in maintaining the proper functioning of membraneless organelles. The detrimental effects of aberrant LLPS exhibited by proteins such as TDP-43, FUS, and Tau in neurodegenerative diseases have been extensively validated (<xref ref-type="bibr" rid="B9">9</xref>&#x2013;<xref ref-type="bibr" rid="B12">12</xref>). Recent studies have also highlighted the significant role of LLPS in the onset and progression of diverse cancers (<xref ref-type="bibr" rid="B13">13</xref>&#x2013;<xref ref-type="bibr" rid="B15">15</xref>). For instance, the transcription co-activators YAP and TAZ regulate the transcriptional process during tumor advancement through LLPS. Pathological fusion of genes leads to aberrant occurrences or pathological loss of LLPS, thereby promoting tumor progression (<xref ref-type="bibr" rid="B16">16</xref>, <xref ref-type="bibr" rid="B17">17</xref>).</p>
<p>In light of these findings, this study aims to collect gene expression data and clinical information from the TCGA-COAD and GEO cohorts, with the objective of constructing an innovative prognostic model based on LLPS gene expression patterns of these colon cancer patients. Ultimately, the colon cancer patients were divided into two LLPS subtypes exhibiting distinct prognosis, clinicopathological characteristics and tumor immune microenvironments. This study, for the first time, established a LLPS-related gene signature in colon cancer to quantify the LLPS levels in individual patients. This novel model holds promise for facilitating personalized prognosis prediction and better treatment choices for colon cancer patients.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Overall flowchart</title>
<p>The overall flowchart of this study was shown in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>. Firstly, we screened out the differentially expressed genes (DEGs) between tumor and normal tissues in the TCGA-COAD cohort, followed by intersecting with LLPS-related genes obtained from DrLLPS database. Then, prognostic LLPS-related DEGs were identified by univariate Cox regression. Based on the expression profiles of these genes, unsupervised clustering analysis was performed to identify different LLPS patterns in colon cancer patients. Subsequently, we investigated the heterogeneity of two LLPS subtypes. In addition, the Least Absolute Shrinkage Selection Operator (LASSO) Cox regression is used to construct LLPS-related gene signature to calculate the LRRS. The robustness of signature is evaluated by multiple dimensions.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>The overall flow diagram of this study.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1514613-g001.tif"/>
</fig>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Datasets and preprocessing</title>
<p>RNA sequencing gene expression profile (including count and TPM value), somatic mutation and clinical information of TCGA-COAD cohort were downloaded from the Cancer Genome Atlas (TCGA) database (<ext-link ext-link-type="uri" xlink:href="https://portal.gdc.cancer.gov/">https://portal.gdc.cancer.gov/</ext-link>). The count value was used to identify the DEGs between tumor and normal tissues via &#x201c;limma&#x201d; R package (<xref ref-type="bibr" rid="B18">18</xref>). The normalized series matrix file of GSE39582 was directly downloaded from GEO database (<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/geo/">https://www.ncbi.nlm.nih.gov/geo/</ext-link>) (<xref ref-type="bibr" rid="B19">19</xref>). The &#x201c;ComBat&#x201d; function of the &#x201c;sva&#x201d; R package was used to correct the batch effects of non-biological technical biases of TCGA-COAD TPM values and GSE39582 expression data. Patients without survival data were excluded from further analyses (<xref ref-type="bibr" rid="B20">20</xref>). Following the exclusion of normal tissue samples and data lacking overall survival (OS) information, the subsequent analysis was conducted on 448 samples from the TCGA-COAD cohort and 562 samples from the GSE39582 cohort. Data were analyzed with R (version 4.1.0).</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Source of LLPS-related gene data</title>
<p>A total of 4494 LLPS-related genes, of which 90 were scaffolds (2.00%), 487 were regulators (10.84%), and 3917 were clients (87.16%) (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S1</bold>
</xref>) in Homo sapiens involving 36 condensates were obtained from the DrLLPS database (<ext-link ext-link-type="uri" xlink:href="http://llps.biocuckoo.cn/">http://llps.biocuckoo.cn/</ext-link>), which is a comprehensive database containing 437887 LLPS related proteins from 164 eukaryotes (<xref ref-type="bibr" rid="B21">21</xref>).</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Unsupervised clustering identification of LLPS subtypes of colon cancer patients</title>
<p>Firstly, the empirical Bayesian method of &#x201c;limma&#x201d; R package was used to identify DEGs between tumor and normal tissues in the TCGA-COAD cohort based on the screening criteria of P&lt;0.05 and |log2FC|&gt;1 (<xref ref-type="bibr" rid="B22">22</xref>). Then, intersect with 4494 LLPS-related genes, followed by univariate Cox regression analysis. A total of 253 prognostic LLPS-related DEGs were identified. Based on the expression of 253 prognostic LLPS-related DEGs mentioned above, unsupervised clustering analysis was performed using the &#x201c;ConsensuClusterPlus&#x201d; package to identify different subtypes of LLPS in colon cancer patients (<xref ref-type="bibr" rid="B23">23</xref>).</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Gene set variation analysis</title>
<p>GSVA is a non-parametric, unsupervised method for estimating variation of gene set enrichment through the samples of an expression data set (<xref ref-type="bibr" rid="B24">24</xref>). To investigate the differences in Kyoto Encyclopedia of Genes and Genomes (KEGG) signaling pathways among different LLPS subtypes, we conducted GSVA enrichment analysis using the &#x201c;GSVA&#x201d; R package (<xref ref-type="bibr" rid="B24">24</xref>). The gene set &#x201c;c2. cp. kegg. v2023.1. Hs. symbols&#x201d; was download from the MSigDB database (<ext-link ext-link-type="uri" xlink:href="https://www.gsea-msigdb.org/gsea/msigdb">https://www.gsea-msigdb.org/gsea/msigdb</ext-link>). Adjusted P-value less than 0.05 is considered statistically significant.</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Functional enrichment</title>
<p>Gene Ontology (GO) annotates genes to three categories including biological processes, molecular functions, and cellular components (<xref ref-type="bibr" rid="B25">25</xref>). GO enrichment analysis was performed using the &#x201c;enrichGO&#x201d; function of the &#x201c;clusterProfiler&#x201d; R package (<xref ref-type="bibr" rid="B26">26</xref>).</p>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Evaluation of immune cell infiltration and immune function</title>
<p>Single Sample Gene Set Enrichment Analysis (ssGSEA), which is an extension of Gene Set Enrichment Analysis (GSEA), is used to assess the relative abundance of various immune cell infiltrations and immune functions in patients with colon cancer. Two gene sets, containing 23 and 29 types of immune cell markers respectively (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Tables S2</bold>
</xref>, <xref ref-type="supplementary-material" rid="SM1">
<bold>S3</bold>
</xref>), are employed to evaluate the tumor microenvironment and immune functions of different LLPS subtypes in colon cancer (<xref ref-type="bibr" rid="B27">27</xref>, <xref ref-type="bibr" rid="B28">28</xref>). The immune scores, stromal scores, ESTIMATE scores, and tumor purity of colon cancer patients was calculated by the &#x201c;estimate&#x201d; R package (<xref ref-type="bibr" rid="B29">29</xref>). The xCELL, TIMER, quanTIseq, EPIC, ConsensusTME, and ABIS methods from the &#x201c;immunedeconv&#x201d; R package are utilized to evaluate the correlation between the LRRS and immune cell infiltration (<xref ref-type="bibr" rid="B30">30</xref>). Expression levels of 45 immune checkpoint-related genes were analyzed between LLPS clusters (<xref ref-type="bibr" rid="B31">31</xref>).</p>
</sec>
<sec id="s2_8">
<label>2.8</label>
<title>Prediction of immune checkpoint inhibitor therapy response</title>
<p>The Tumor Immune Dysfunction and Exclusion (TIDE) algorithm (<ext-link ext-link-type="uri" xlink:href="http://tide.dfci.harvard.edu/">http://tide.dfci.harvard.edu/</ext-link>) was used to evaluate the tumor immune scape potential of colon cancer patients from their expression profiles (<xref ref-type="bibr" rid="B32">32</xref>, <xref ref-type="bibr" rid="B33">33</xref>). Patients with lower TIDE scores was more likely to show stronger responses to immune therapy. The immunophenotypic score (IPS) data was download from The Cancer Immunome Atlas (TCIA) database (<ext-link ext-link-type="uri" xlink:href="https://tcia.at/home">https://tcia.at/home</ext-link>). Then compared the IPS between different LLPS clusters to evaluate the responsiveness to anti-PD-1 or anti-CTLA-4 therapy (<xref ref-type="bibr" rid="B34">34</xref>).</p>
</sec>
<sec id="s2_9">
<label>2.9</label>
<title>Construction and validation of a LLPS-related gene signature</title>
<p>To construct a LLPS-related gene signature, 253 prognostic LLPS-related DEGs were used to build a LASSO Cox regression model. LRRS was calculated as follows:</p>
<disp-formula>
<mml:math display="block" id="M1">
<mml:mrow>
<mml:mtext mathvariant="bold-italic">LRRS</mml:mtext>
<mml:mo>=</mml:mo>
<mml:munderover>
<mml:mo>&#x2211;</mml:mo>
<mml:mrow>
<mml:mtext mathvariant="bold-italic">i</mml:mtext>
<mml:mo>=</mml:mo>
<mml:mn mathvariant="bold">1</mml:mn>
</mml:mrow>
<mml:mstyle mathvariant="bold-italic" mathsize="normal">
<mml:mi>n</mml:mi>
</mml:mstyle>
</mml:munderover>
<mml:mrow>
<mml:mo stretchy="false">(</mml:mo>
<mml:mrow>
<mml:mtext mathvariant="bold-italic">Coe</mml:mtext>
<mml:msub>
<mml:mtext mathvariant="bold-italic">f</mml:mtext>
<mml:mtext mathvariant="bold-italic">i</mml:mtext>
</mml:msub>
<mml:mo>&#x2217;</mml:mo>
<mml:mo>&#xa0;</mml:mo>
<mml:mtext mathvariant="bold-italic">Ex</mml:mtext>
<mml:msub>
<mml:mtext mathvariant="bold-italic">p</mml:mtext>
<mml:mtext mathvariant="bold-italic">i</mml:mtext>
</mml:msub>
</mml:mrow>
<mml:mo stretchy="false">)</mml:mo>
</mml:mrow>
</mml:mrow>
</mml:math>
</disp-formula>
<p>where Coef<sub>i</sub> and Exp<sub>i</sub> represent the LASSO coefficient and the corresponding gene expression level, respectively. Patients with colon cancer were stratified into low and high LRRS groups according to the median value of LRRS. Univariate and multivariate Cox regression analyses were conducted on LRRS in conjunction with clinical characteristics to identify independent prognostic factors. A nomogram was constructed utilizing these independent prognostic factors. Receiver operating characteristic (ROC) curve analysis were applied to assess the accuracy of nomogram, LRRS, and clinical characteristics in predicting OS of colon cancer patients. The concordance index (C-index) was employed to assess the prognostic capability of nomogram, LRRS, and clinical characteristics. The calibration curves were used to evaluate the precision of the nomogram in terms of the agreement between the observed and predicted OS outcomes at the 1st, 3rd, and 5th years.</p>
</sec>
<sec id="s2_10">
<label>2.10</label>
<title>Analyses of genomic alterations</title>
<p>The mutation profiles and frequencies were visualized using the &#x201c;maftools&#x201d; R package. The tumor mutation burden (TMB) was defined as the number of mutations per megabase (mut/Mb) (<xref ref-type="bibr" rid="B35">35</xref>). The copy number variation (CNV) data was acquired from UCSC Xena (<ext-link ext-link-type="uri" xlink:href="https://xena.ucsc.edu/">https://xena.ucsc.edu/</ext-link>) database. Then identify the copy number amplifications or deletions of model gene in the cohort.</p>
</sec>
<sec id="s2_11">
<label>2.11</label>
<title>Cell culture</title>
<p>HCT-8 cells were purchased from Wuhan Pricella Biotechnology Co., Ltd. The cells were cultured in RPMI-1640 medium (Gibco, USA) supplement with 10% Fetal Bovine Serum (FBS, Invitrogen Corporation, USA) and 1% penicillin/streptomycin (Gibco, USA) and incubated in humidified incubator containing 5% CO2 at 37 &#xb0;C.</p>
</sec>
<sec id="s2_12">
<label>2.12</label>
<title>Lentivirus transfection</title>
<p>Cells (5&#x2009;&#xd7;&#x2009;10<sup>5</sup> cells/well) were seeded in the six-well plate. After cell attachment, lentivirus carrying overexpression plasmid was added to the culture medium, supplemented with polybrene to reach a final concentration of 1&#x2009;&#xb5;g/mL. The lentivirus was removed and replaced with normal growth medium at 12&#xa0;h transfection. 48&#xa0;h after transfection, 1 &#x3bc;g/mL puromycin was added to screen for stable cells for one week.</p>
</sec>
<sec id="s2_13">
<label>2.13</label>
<title>Quantitative real-time polymerase chain reaction</title>
<p>Total RNA was extracted using RNA Extraction Reagent TRIzol (Invitrogen, USA). Then RNA concentration was determined with a spectrophotometer. The RNA was further reverse-transcribed to cDNA using cDNA synthesis kit (Bio-Rad, USA). cDNA was amplified with SYBR Green Supermix (Bio-Rad, USA). The 2<sup>&#x2212;&#x394;&#x394;Ct</sup> method (&#x394;&#x394;CT = &#x394;Ct control&#x2212;&#x394;Ct sample) was used to calculate the amplification fold. Primer sequences are shown in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Primer sequences.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">Gene</th>
<th valign="middle" align="left">Forward</th>
<th valign="top" align="left">Reverse</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">POU4F1</td>
<td valign="middle" align="left">GAGCACCACCATTATTACCACCTC</td>
<td valign="top" align="left">AACACGCAGACAGAACAACTAGC</td>
</tr>
<tr>
<td valign="middle" align="left">GAPDH</td>
<td valign="middle" align="left">GTCTCCTCTGACTTCAACAGCG</td>
<td valign="top" align="left">ACCACCCTGTTGCTGTAGCCAA</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_14">
<label>2.14</label>
<title>CCK8 assay</title>
<p>The cells were seeded at 1&#xd7;10<sup>5</sup> cells/100 &#x3bc;l in 96 well plates (100 &#x3bc;L/well) and incubated for 24 hours. Add 10 &#x3bc;L of CCK-8 solution (Dojindo, China) to each well and incubate at 37&#xb0;C for 1-4 hours. The absorbance was determined at 450 nm using the absorbance microplate reader (Bio-Rad, USA).</p>
</sec>
<sec id="s2_15">
<label>2.15</label>
<title>Clone formation assay</title>
<p>Cell suspension was diluted to the final concentration of 10<sup>3</sup> cells/mL. Then the cells were seeded into six-well plates (1 mL/well) and incubate for 10 days. After the clones were formed, the cells were fixed with 4% paraformaldehyde for 30&#xa0;min and stained with crystal violet staining solution for 20&#xa0;min. Finally, the cells were washed with PBS and photographed. The experiment was repeated at least three times.</p>
</sec>
<sec id="s2_16">
<label>2.16</label>
<title>Wound healing assay</title>
<p>5x10<sup>5</sup> cells were seeded in each well of a six-well plate and when the cells were grown to 90% confluency, a straight line was scratched across the cell monolayer with a 200&#x2009;&#x3bc;L pipette tip. Then, add medium containing 1% serum to each well after washed with PBS. Cell migration was observed and photographed at 0&#xa0;h and 24&#xa0;h under the microscope. The experiment was repeated at least three times.</p>
</sec>
<sec id="s2_17">
<label>2.17</label>
<title>Transwell assay</title>
<p>2 &#xd7; 10<sup>4</sup> cells were added to the upper chamber with serum-free medium (Gibco, USA). 600 &#x3bc;L of complete medium was added to the lower chamber. After 24 hours of incubation, the cells in the upper chamber were removed with cotton swabs, and the cells on the lower surface of the chamber were fixed with 4% paraformaldehyde for 30 minutes, and then stained with crystal violet for 30 minutes. Finally, five visual fields were randomly selected to be photographed with the microscope (Olympus, Japan).</p>
</sec>
<sec id="s2_18">
<label>2.18</label>
<title>Statistical analysis</title>
<p>The Kruskal-Wilcoxon test was used to compare statistical differences between two groups. While statistical differences among more than two groups was compared using the Kruskal-Wallis test. The correlation between expression of model genes was assessed through the Spearman correlation analysis. The survival curves for the prognostic analysis were generated via the Kaplan-Meier method and the significance of differences were identified by log-rank tests. All statistical p value were two-side, with p&#x2009;&lt;&#x2009;0.05 as statistically significance. All data processing was done in R 4.1.0 software.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Identification of LLPS subtypes in colon cancer patients based on prognostic LLPS-related differentially expressed genes</title>
<p>To identify the LLPS-related DEGs, we conducted the following screening. Firstly, according to the screening criteria of adj. p&lt;0.05 and | log2FC |&gt;1, 8002 DEGs between tumor samples and normal samples were obtained from the TCGA-COAD cohort. Among them, 3584 were upregulated and 4418 were downregulated in tumor samples compared with normal samples (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S4</bold>
</xref>). Subsequently, after intersecting with 4494 LLPS-related genes, 980 LLPS-related DEGs were identified, of which 444 were upregulated and 536 were downregulated in tumor samples (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S5</bold>
</xref>). Then, these LLPS-related DEGs were subjected to univariate Cox regression analysis to identify 253 prognostic LLPS-related DEGs (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>), of which 3 were scaffolds, 26 were regulators, and 224 were clients (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S6</bold>
</xref>).</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Identification of LLPS subtypes in colon cancer patients based on prognostic LLPS-related differentially expressed genes. <bold>(A)</bold> Venn diagram identified 253 prognostic LLPS-related DEGs in colon cancer. <bold>(B)</bold> Consensus matrix of unsupervised clustering of the TCGA-COAD and GSE39582 cohorts for k = 2. <bold>(C)</bold> Heatmap showed the expression levels of 253 prognostic LLPS-related DEGs among LLPS subtypes. <bold>(D)</bold> Survival curves of OS in two LLPS clusters based on 1010 colon cancer patients from the TCGA-COAD and GSE39582 cohorts. <bold>(E)</bold> Heatmap of KEGG gene sets by GSVA. <bold>(F)</bold> GO enrichment analyses for 253 prognosis LLPS-related DEGs.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1514613-g002.tif"/>
</fig>
<p>Based on the expression levels of the 253 prognostic LLPS-related DEGs mentioned above, we performed unsupervised clustering analysis on the merged TCGA-COAD and GSE39582 cohorts, and ultimately divided 1010 colon cancer patients into two subtypes: LLPS cluster A (n=744) and cluster B (n=266) (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>). The significant differences in the expression of 253 prognosis LLPS-related DEGs between the two subtypes were observed in the heatmap (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>). Prognostic analysis indicated a significant survival difference between the two subtypes of LLPS. Cluster A had a better overall survival outcome than cluster B (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>).</p>
<p>To explore the potential molecular mechanisms underlying the LLPS subtype of colon cancer, we performed GSVA to evaluate the differential KEGG gene sets between the two subtypes. The results showed that cluster A exhibited associations with cell cycle, DNA replication and mismatch repair, whereas cluster B demonstrated associations with the MAPK signaling pathway and JAK-STAT signaling pathway (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2E</bold>
</xref>). Additionally, we performed GO&#xa0;enrichment analyses on 253 prognosis LLPS-related DEGs (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2F</bold>
</xref>).</p>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Clinicopathological and immune characteristics between different LLPS subtypes</title>
<p>We attempted to compare the clinicopathological characteristics of colon cancer patients in two different LLPS clusters. Compared to cluster B, cluster A had more patients with age greater than 65 years and higher proportion of stage I and stage II, which may explain why the overall survival outcome of cluster A is better. No statistically significant variances were observed between the two clusters in terms of gender and MSI status distribution (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Clinicopathological characteristics between different LLPS clusters. Comparisons of age, gender, survival status, MSI status, stage, T, N and M stage among LLPS subtypes. *<italic>P</italic> &lt; 0.05, ***<italic>P</italic> &lt; 0.001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1514613-g003.tif"/>
</fig>
<p>Subsequently, we conducted a comparative analysis of immune cell infiltration among the two subtypes of LLPS. Results derived from two distinct gene sets consistently indicated that cluster B exhibited a higher degree of immune cell infiltration (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4A, B</bold>
</xref>). Employing the ESTIMATE algorithm, we predicted the abundance of stromal and immune cells across different subtypes. The analysis revealed that cluster A exhibited lower ESTIMATE, immune, and stromal scores compared to cluster B, indirectly reflecting a higher tumor purity in cluster A (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4C, D</bold>
</xref>). Then, we compared the immune functions between the two LLPS subtypes. Notably, cluster B demonstrated significantly elevated functions, particularly in aspects such as immune check-point (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4E</bold>
</xref>). A detailed differential analysis highlighted that the expression levels of key immune checkpoint molecules, including CD274 (PD-L1), CTLA4, LAG3, and TIGIT, were markedly higher in cluster B compared to cluster A (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4F</bold>
</xref>). Finally, we compared the IPS between the two LLPS clusters. Cluster A demonstrated a significantly elevated IPS, suggesting a more promising immunotherapeutic response potential (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4G</bold>
</xref>). TIDE analysis indicated that cluster A had a lower TIDE score, further corroborating its enhanced likelihood of responding favorably to immunotherapeutic interventions (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4H</bold>
</xref>).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Immune characteristics between different LLPS clusters. <bold>(A, B)</bold> The levels of immune cell infiltrations in two LLPS clusters. <bold>(C)</bold> Comparisons of immune, stromal, and ESTIMATE scores among two LLPS clusters. <bold>(D)</bold> Comparison of tumor purity among two LLPS clusters. <bold>(E)</bold> The scores of immune functions between two LLPS clusters. <bold>(F)</bold> Comparisons of IPS between two LLPS clusters. <bold>(G)</bold> Expression levels of immune checkpoint genes between two LLPS clusters. <bold>(H)</bold> TIDE score between two LLPS clusters. *<italic>P</italic> &lt; 0.05, **<italic>P</italic> &lt; 0.01, ***<italic>P</italic> &lt; 0.001. ns, not significant.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1514613-g004.tif"/>
</fig>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Construction and evaluation of the LLPS-related gene signature</title>
<p>Next, 253 prognostic LLPS-related DEGs were subjected to LASSO Cox regression to construct a LLPS-related gene signature for predicting the prognosis of colon cancer. According to the ratio of 1:1, 1010 colon cancer patients were randomly divided into a train group and a test group. The detailed clinical information of the train group, test group and total group is shown in <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>. Ultimately, 14 genes were identified (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A, B</bold>
</xref>), comprising 7 protective genes and 7 risk genes, with their respective risk coefficients detailed in <xref ref-type="table" rid="T3">
<bold>Table&#xa0;3</bold>
</xref>. The LRRS of each colon cancer patient can be calculated by summing the product of the expression levels of each gene and the corresponding risk coefficients. The area under the curve (AUC) values were evaluated by ROC curve. The LRRS had the highest AUC value in the 3rd year, reaching 0.730. Additionally, AUC values of 0.677 and 0.697 were observed in the first and fifth years, respectively (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>). According to the median value of LRRS, colon cancer patients in the train and test group were divided into high and low risk groups, respectively. The distribution of LRRS, survival time, status, and expression heatmaps of risk model genes among high- and low-risk patients in the total, train, and test groups were displayed (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5D&#x2013;F</bold>
</xref>). The prognostic analysis of the overall survival time of CRC patients revealed that those with high LLPS scores exhibited poorer prognoses in all the three groups (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5G</bold>
</xref>). Furthermore, a comparative analysis of progression free survival in the TCGA-COAD cohort (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5H</bold>
</xref>) and recurrence-free survival in the GSE39582 cohort (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5I</bold>
</xref>) demonstrated that individuals with higher LRRS experienced inferior prognoses in the total, train and test groups.</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Clinical information of total, train and test groups.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Covariates</th>
<th valign="top" align="left">Total</th>
<th valign="top" align="left">Train</th>
<th valign="top" align="left">Test</th>
<th valign="top" align="left">P Value</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">Age</td>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left">0.6346</td>
</tr>
<tr>
<td valign="top" align="left">&lt;=65</td>
<td valign="top" align="left">406(40.2%)</td>
<td valign="top" align="left">199(39.41%)</td>
<td valign="top" align="left">207(40.99%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">&gt;65</td>
<td valign="top" align="left">603(59.7%)</td>
<td valign="top" align="left">306(60.59%)</td>
<td valign="top" align="left">297(58.81%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">unknown</td>
<td valign="top" align="left">1(0.1%)</td>
<td valign="top" align="left">0(0%)</td>
<td valign="top" align="left">1(0.2%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">Gender</td>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left">0.6136</td>
</tr>
<tr>
<td valign="top" align="left">Female</td>
<td valign="top" align="left">467(46.24%)</td>
<td valign="top" align="left">229(45.35%)</td>
<td valign="top" align="left">238(47.13%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">Male</td>
<td valign="top" align="left">543(53.76%)</td>
<td valign="top" align="left">276(54.65%)</td>
<td valign="top" align="left">267(52.87%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">Stage</td>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left">0.31</td>
</tr>
<tr>
<td valign="top" align="left">Stage 0</td>
<td valign="top" align="left">4(0.4%)</td>
<td valign="top" align="left">1(0.2%)</td>
<td valign="top" align="left">3(0.59%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">Stage I</td>
<td valign="top" align="left">107(10.59%)</td>
<td valign="top" align="left">55(10.89%)</td>
<td valign="top" align="left">52(10.3%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">Stage II</td>
<td valign="top" align="left">438(43.37%)</td>
<td valign="top" align="left">226(44.75%)</td>
<td valign="top" align="left">212(41.98%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">Stage III</td>
<td valign="top" align="left">328(32.48%)</td>
<td valign="top" align="left">164(32.48%)</td>
<td valign="top" align="left">164(32.48%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">Stage IV</td>
<td valign="top" align="left">122(12.08%)</td>
<td valign="top" align="left">51(10.1%)</td>
<td valign="top" align="left">71(14.06%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">unknown</td>
<td valign="top" align="left">11(1.09%)</td>
<td valign="top" align="left">8(1.58%)</td>
<td valign="top" align="left">3(0.59%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">T</td>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left">0.2114</td>
</tr>
<tr>
<td valign="top" align="left">Tis</td>
<td valign="top" align="left">4(0.4%)</td>
<td valign="top" align="left">1(0.2%)</td>
<td valign="top" align="left">3(0.59%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">T1</td>
<td valign="top" align="left">21(2.08%)</td>
<td valign="top" align="left">14(2.77%)</td>
<td valign="top" align="left">7(1.39%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">T2</td>
<td valign="top" align="left">120(11.88%)</td>
<td valign="top" align="left">62(12.28%)</td>
<td valign="top" align="left">58(11.49%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">T3</td>
<td valign="top" align="left">669(66.24%)</td>
<td valign="top" align="left">326(64.55%)</td>
<td valign="top" align="left">343(67.92%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">T4</td>
<td valign="top" align="left">175(17.33%)</td>
<td valign="top" align="left">97(19.21%)</td>
<td valign="top" align="left">78(15.45%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">unknown</td>
<td valign="top" align="left">21(2.08%)</td>
<td valign="top" align="left">5(0.99%)</td>
<td valign="top" align="left">16(3.17%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">N</td>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left">0.5609</td>
</tr>
<tr>
<td valign="top" align="left">N0</td>
<td valign="top" align="left">565(55.94%)</td>
<td valign="top" align="left">291(57.62%)</td>
<td valign="top" align="left">274(54.26%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">N1</td>
<td valign="top" align="left">235(23.27%)</td>
<td valign="top" align="left">122(24.16%)</td>
<td valign="top" align="left">113(22.38%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">N2</td>
<td valign="top" align="left">178(17.62%)</td>
<td valign="top" align="left">84(16.63%)</td>
<td valign="top" align="left">94(18.61%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">unknown</td>
<td valign="top" align="left">32(3.17%)</td>
<td valign="top" align="left">8(1.58%)</td>
<td valign="top" align="left">24(4.75%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">M</td>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left">0.0919</td>
</tr>
<tr>
<td valign="top" align="left">M0</td>
<td valign="top" align="left">879(87.03%)</td>
<td valign="top" align="left">447(88.51%)</td>
<td valign="top" align="left">432(85.54%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">M1</td>
<td valign="top" align="left">123(12.18%)</td>
<td valign="top" align="left">52(10.3%)</td>
<td valign="top" align="left">71(14.06%)</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">unknown</td>
<td valign="top" align="left">8(0.79%)</td>
<td valign="top" align="left">6(1.19%)</td>
<td valign="top" align="left">2(0.4%)</td>
<td valign="top" align="left"/>
</tr>
</tbody>
</table>
</table-wrap>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Construction and evaluation of the LLPS-related gene signature. <bold>(A, B)</bold> LASSO Cox regression analysis to construct a LLPS-related gene signature. <bold>(C)</bold> Time-dependent ROC curve analysis in the total group. <bold>(D&#x2013;F)</bold> The distribution of LRRS, survival time, status, and heatmaps of risk model genes among high- and low-risk patients in the total, train, and test groups. <bold>(G)</bold> Survival curves of OS in the total, train, and test groups. <bold>(H)</bold> Survival curves of PFS in the total, train, and test groups in the TCGA-COAD cohort. <bold>(I)</bold> Survival curves of RFS in the total, train, and test groups in the GSE39582 cohort.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1514613-g005.tif"/>
</fig>
<table-wrap id="T3" position="float">
<label>Table&#xa0;3</label>
<caption>
<p>LASSO coefficients of 14 LLPS-related risk genes.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">Gene</th>
<th valign="middle" align="left">coefficients</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">AGAP3</td>
<td valign="middle" align="left">1.636</td>
</tr>
<tr>
<td valign="middle" align="left">AKR1C1</td>
<td valign="middle" align="left">1.107</td>
</tr>
<tr>
<td valign="middle" align="left">CACNB1</td>
<td valign="middle" align="left">1.514</td>
</tr>
<tr>
<td valign="middle" align="left">CDK2</td>
<td valign="middle" align="left">-2.137</td>
</tr>
<tr>
<td valign="middle" align="left">CLMN</td>
<td valign="middle" align="left">1.620</td>
</tr>
<tr>
<td valign="middle" align="left">DMKN</td>
<td valign="middle" align="left">0.446</td>
</tr>
<tr>
<td valign="middle" align="left">NRG1</td>
<td valign="middle" align="left">-1.501</td>
</tr>
<tr>
<td valign="middle" align="left">OGDHL</td>
<td valign="middle" align="left">-0.787</td>
</tr>
<tr>
<td valign="middle" align="left">POU4F1</td>
<td valign="middle" align="left">2.759</td>
</tr>
<tr>
<td valign="middle" align="left">PRMT1</td>
<td valign="middle" align="left">-4.322</td>
</tr>
<tr>
<td valign="middle" align="left">PSMA7</td>
<td valign="middle" align="left">-2.110</td>
</tr>
<tr>
<td valign="middle" align="left">RAB15</td>
<td valign="middle" align="left">1.962</td>
</tr>
<tr>
<td valign="middle" align="left">SNAI1</td>
<td valign="middle" align="left">1.189</td>
</tr>
<tr>
<td valign="middle" align="left">SYN2</td>
<td valign="middle" align="left">1.101</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>Development and evaluation of nomogram</title>
<p>We want to build a survival prediction model for colon cancer patients that can be applied in clinical practice. To this end, we first conducted univariate and multivariate Cox regression analyses of LRRS and clinical information with overall survival. The results indicated that the LRRS is an independent prognostic factor for OS. In univariate Cox regression analyses, the hazard ratio (HR) of LRRS was 1.154 with a 95% confidence interval (CI) of 1.122-1.187 (p&lt;0.001, <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>). In multivariate Cox regression analyses, the HR of LRRS was 1.127 with a 95% CI of 1.087-1.169 (p&lt;0.001, <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>). In addition, age and TNM stage were also independent prognostic factors. Subsequently, a nomogram was developed by integrating age, TNM stage, and LLPS risk (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>). By calculating the score of each variable, the 1-, 3-, and 5-years survival of colon cancer patients can easily estimate by drawing a vertical line. The ROC curve demonstrated that the LRRS had excellent accuracy in predicting OS, with an AUC of 0.680, surpassing the predictive ability of any other clinical feature. Furthermore, the nomogram showed an even higher AUC of 0.792 (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6D</bold>
</xref>). Meanwhile, the concordance index indicated that the nomogram had the highest predictive accuracy, followed by LRRS (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6E</bold>
</xref>). The calibration curves also illustrate that there is a good agreement between the observed and predicted OS outcomes at the 1st, 3rd, and 5th years for the nomogram (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6F</bold>
</xref>).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Development and evaluation of nomograms. <bold>(A, B)</bold> Univariate and multivariate Cox regression analyses of LRRS and clinical information with overall survival. <bold>(C)</bold> Nomogram was developed by integrating age, TNM stage, and LLPS risk. <bold>(D)</bold> ROC curve analysis of nomogram, LRRS and clinical information. <bold>(E)</bold> Concordance index of LRRS and clinical information. <bold>(F)</bold> Calibration plots to assess the accuracy of nomogram. **<italic>P</italic> &lt; 0.01, ***<italic>P</italic> &lt; 0.001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1514613-g006.tif"/>
</fig>
</sec>
<sec id="s3_5">
<label>3.5</label>
<title>Clinicopathological and immune characteristics between the two LRRS groups</title>
<p>We conducted a comparison of the LRRS among various LLPS clusters, revealing that cluster B exhibited a significantly higher LRRS compared to cluster A (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7A</bold>
</xref>). The relationship between LLPS clusters, LRRS, clinical stage, and survival status is shown in <xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7B</bold>
</xref>. Notably, a majority of patients within Cluster B were categorized into the high LRRS group, consistent with the results in <xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7A</bold>
</xref>. Then, the Wilcoxon test was used to calculate the correlation between LRRS and clinicopathological features including age, gender, clinical stage, and survival status. The results showed that high LRRS was associated with high clinical stage and poor prognosis, but not with age and gender. The LRRS gradually increased from stage I to stage IV (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7C</bold>
</xref>).</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Clinicopathological and immune characteristics between the two LRRS groups. <bold>(A)</bold> Cluster B exhibited a significantly higher LRRS compared to cluster <bold>(A, B)</bold> Sankey diagram of LLPS clusters, LRRS, clinical stage, and survival status. <bold>(C)</bold> Comparisons of age, gender, clinical stage, and survival status between the high and low LRRS groups. <bold>(D)</bold> Correlation between LRRS and immune cell infiltration. <bold>(E)</bold> Correlation between LRRS and immune function. <bold>(F)</bold> Correlation between LRRS and expression levels of immune checkpoint genes. <bold>(G)</bold> Correlation between LRRS and immune, stromal, ESTIMATE scores, and tumor purity. *<italic>P</italic> &lt; 0.05, **<italic>P</italic> &lt; 0.01, ***<italic>P</italic> &lt; 0.001. ns, not significant.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1514613-g007.tif"/>
</fig>
<p>Subsequently, employing a panel of methodologies including xCELL, TIMER, quanTIseq, EPIC, ConsensusTME, and ABIS, we investigated the correlation between LRRS and immune cell infiltration. The findings indicated that T cell NK, macrophage, dendritic cell, cancer associated fibroblast, and monocyte were positively correlated with LRRS, while basophil and T cell CD4+ memory were negatively correlated with LRRS (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7D</bold>
</xref>). An immune functional correlation analysis revealed that LRRS was positively correlated with immune functions such as immune checkpoint and T cell co-inhibition (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7E</bold>
</xref>). Consistently, LRRS was positively correlated with the expression of immune inhibitory molecules such as CD274, LAIR1, and NRP1 (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7F</bold>
</xref>). In our final analysis, we assessed the relationship between LRRS and comprehensive immunological scores, including immune, stromal, ESTIMATE scores, and tumor purity. The results demonstrated that LRRS was positively correlated with immune, stromal, and ESTIMATE scores, but negatively correlated with tumor purity (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7G</bold>
</xref>). In summary, these analyses underscore that while the high LRRS group shows enhanced immune cell infiltration, it paradoxically exhibits a higher state of immune suppression.</p>
</sec>
<sec id="s3_6">
<label>3.6</label>
<title>Genomic alterations of two LRRS groups</title>
<p>Next, we analyzed the top 20 mutated genes in the two different groups (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8A</bold>
</xref>). The gene mutation frequencies were found to be similar between the two groups. APC, TP53, and TTN are the three genes with the highest mutation frequency. Additionally, the TMB was evaluated between the high and low LRRS groups, revealing no significant difference in TMB levels (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8B</bold>
</xref>). However, survival analysis showed that the prognosis of the high TMB group was significantly worse than that of the low TMB group (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8C</bold>
</xref>). Therefore, we wonder whether it is possible to combine TMB and LRRS to stratify patients, and the results showed that this combination could better predict patient prognosis. The group with high TMB and high LRRS had the worst prognosis, followed by the group with low TMB and high LRRS (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8D</bold>
</xref>).</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Genomic alterations of two LRRS groups. <bold>(A)</bold> The mutation frequency of the top 20 genes in the high and low LRRS group. <bold>(B)</bold> The TMB value showed no significant difference between the high and low LRRS group. <bold>(C)</bold> Survival curves of OS in high and low TMB groups. <bold>(D)</bold> Survival curves of OS in four groups (high-TMB + high-LRRS, high-TMB + low-LRRS, low-TMB + high-LRRS, low-TMB + low-LRRS). ns, not significant.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1514613-g008.tif"/>
</fig>
</sec>
<sec id="s3_7">
<label>3.7</label>
<title>Landscape of LLPS-related risk genes in colon cancer</title>
<p>A total of 14 genes were utilized in the construction of the LLPS-related gene signature. Among these genes, AGAP3, CDK2, DMKN, PRMT1, PSMA7, POU4F1, RAB15 and SNAI1 were up-regulated in tumor tissue compared with normal tissue in TCGA-COAD cohort, while the remaining genes were down-regulated in tumor tissue (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9A</bold>
</xref>). Hazard ratios (95% CI) of these genes were calculated by univariate Cox hazard analysis (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9B</bold>
</xref>). In terms of gene types, these 14 genes consisted of 11 clients, 2 regulators, and 1 scaffold. Except for the scaffold SYN2, there existed an expression correlation among other genes (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9C</bold>
</xref>). Next, we summarized the incidence of somatic mutations of 14 LLPS-related genes in TCGA-COAD cohort. Among 399 tumor samples, only 64 (16.04%) exhibited mutations in the model genes. The gene with the highest mutation frequency was NRG1, but only 5%, indicating that these LLPS-related model genes are conserved in the progression of colon cancer (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9D</bold>
</xref>). The statistical results of CNV alteration frequency showed that the CNV alteration was prevalent in 14 model genes. Specifically, copy number amplification was more pronounced in CACNB1, CDK2, DMKN, and SNAI1, while CLMN, NRG1, OGDHL, PRMT1, and SYN2 mainly exhibit copy number deletion, consistent with their mRNA expression (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9E</bold>
</xref>). The location of CNV changes of these genes on chromosomes was shown in <xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9F</bold>
</xref>.</p>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>Landscape of LLPS-related risk genes in colon cancer. <bold>(A)</bold> Volcano plot of DEGs between tumor and normal tissues in TCGA-COAD cohort. <bold>(B)</bold> Univariate COX regression analysis of the hazard ratio between14 model genes and overall survival in TCGA-COAD cohort. <bold>(C)</bold> The interaction between 14 model genes in colon cancer. <bold>(D)</bold> The mutation frequency of 14 model genes in 399 colon cancer patients from TCGA-COAD cohort. <bold>(E)</bold> The CNV variation frequency of 14 model genes in TCGA-COAD cohort. <bold>(F)</bold> The location of CNV alteration of 14 model genes on 23 chromosomes.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1514613-g009.tif"/>
</fig>
</sec>
<sec id="s3_8">
<label>3.8</label>
<title>POU4F1 promoted proliferation and migration of HCT-8 cells</title>
<p>Given that POU4F1 is a regulator which may play a key role in the LLPS process, we conducted an overexpression study of POU4F1 in HCT-8 cells to elucidate its effects on cell proliferation and migration. POU4F1 overexpression were achieved by lentivirus transfection (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10A</bold>
</xref>). Further investigations were conducted to determine the proliferation and migration of HCT-8 cells. The CCK8 assay showed cell proliferation increased after POU4F1 overexpression (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10B</bold>
</xref>). Meanwhile, an elevated number of clones were observed followed by POU4F1 upregulation (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10C</bold>
</xref>). Subsequently, wound healing assay was performed and the results showed that the overexpression of POU4F1 resulted in a significant enhancement of the cell migration (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10D</bold>
</xref>). Transwell migration assay also showed that the number of migrated cells in the POU4F1-overexpressing group was greater than that in the control group (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10E</bold>
</xref>). The findings above suggested that POU4F1 facilitated both proliferation and migration of HCT-8 cells.</p>
<fig id="f10" position="float">
<label>Figure&#xa0;10</label>
<caption>
<p>POU4F1 promoted proliferation and migration of HCT-8 cells. <bold>(A)</bold> qRT&#x2013;PCR analysis of POU4F1 in OE-POU4F1 and control groups. <bold>(B)</bold> Assessment of the proliferation of HCT-8 cells transfected with OE-POU4F1 and vector by CCK8 assay. <bold>(C)</bold> Representative images and quantitative analysis of clone formation in OE-POU4F1 and vector cells. <bold>(D)</bold> Representative images and quantitative analysis of wound healing assay of HCT-8 cells transfected with OE-POU4F1 and vector. <bold>(E)</bold> Assessment of the migration of HCT-8 cells transfected with OE-POU4F1 and vector by Transwell assay. Error bars denote means &#xb1; standard deviation (SD). n = 3 biological repeats for each group. OE-POU4F1: POU4F1 overexpression group; vector: control group; *<italic>P</italic> &lt; 0.05, ***<italic>P</italic> &lt; 0.001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1514613-g010.tif"/>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>Numerous studies have shown that the LLPS process of proteins is closely related to the occurrence and development of various diseases, especially neurodegenerative diseases and tumors. Given that the majority of research has concentrated on the LLPS of single protein in disease progression, a comprehensive exploration of LLPS-associated genes holds significant importance in the identification of novel tumor subtypes and the prediction of prognosis.</p>
<p>In this study, we attempted to explore the role of LLPS-related genes in colon cancer, which has a high incidence and mortality rate in the world. Based on the expression levels of 253 prognostic LLPS-related DEGs, an unsupervised clustering was used to classify 1010 colon cancer patients from the TCGA-COAD and GSE39582 cohorts into two different LLPSS subtypes. The two LLPS&#xa0;subtypes have different prognosis, pathway activity, clinicopathological features, and immune infiltration. To our knowledge, this is the first study to characterize the LLPS-related gene signature in colorectal cancer. In order to better conduct personalized comprehensive evaluation, all 1010 patients were divided into a train group and a test group in a 1:1 ratio. A LLPS-related risk score, namely LRRS including 14 genes was constructed using LASSO Cox regression. By calculating the LRRS for each patient in the cohort, patients were divided into high and low risk groups. LRRS was associated with the prognosis, clinicopathological features and genomic changes of colon cancer patients.</p>
<p>Currently, multiple studies have shown that the LLPS of intracellular molecules can affect tumor progression through various biological processes. The SUMOylated RNF168 catalyzed by SENP1 prevents the occurrence of LLPS, allowing RNF168 to be recruited to DNA damage sites for nonhomologous DNA end-joining, thereby maintaining genomic stability and even making tumor cells resistant to chemotherapy (<xref ref-type="bibr" rid="B36">36</xref>). The LLPS of YAP and TAZ compartmentalizes key cofactors to regulate tumor development by activating the transcription of target gene (<xref ref-type="bibr" rid="B37">37</xref>, <xref ref-type="bibr" rid="B38">38</xref>). The LLPS of YBX1 enhanced by circASH2 promotes the decay of TPM4 transcripts, effectively inhibiting the metastasis of hepatocellular carcinoma by mediating cytoskeleton remodeling (<xref ref-type="bibr" rid="B39">39</xref>). The LLPS of an aberrant chimera NUP98-HOXA9, generated by recurrent chromosomal translocation of NUP98, can bind to and enhance the activation of target genes, promoting the development of acute leukemia (<xref ref-type="bibr" rid="B40">40</xref>).</p>
<p>The high LRRS group showed higher levels of immune cell infiltration and immune related functional scores, indicating that it has higher immunogenicity. We attempt to explain this phenomenon from the perspective of genomic alterations. We analyzed the top 20 mutated genes in the high and low LRRS groups. TP53, MUC16 and USH2A have higher mutation frequencies in the high LRRS group, while the mutation frequencies of RYR2 and OBSCN are higher in the low LRRS group. Growing evidence suggests that TP53, one of the most famous tumor suppressor genes in various cancers, contributes to the regulation of tumor immune response (<xref ref-type="bibr" rid="B41">41</xref>, <xref ref-type="bibr" rid="B42">42</xref>). It has been found that TP53 mutations can significantly activate the innate immune pathway in CRC (<xref ref-type="bibr" rid="B41">41</xref>). MUC16, which encodes the well-known cancer antigen 125 (CA-125), has a very high mutation frequency in multiple tumors. A study involving 10195 patients across 30 solid tumors in the TCGA database showed that MUC16 mutations resulted in higher abundance of immune cells in the tumor microenvironment and increased expression of multiple inhibitory checkpoints (<xref ref-type="bibr" rid="B43">43</xref>). The above researches support for the higher immunogenicity in the high LRRS group. It is necessary to conduct further research to investigate the specific mechanism by which these gene mutations regulate the tumor immune microenvironment.</p>
<p>LRRS consists of 14 prognostic LLPS-related differentially expressed genes, including 1 scaffold, 2 regulators and 11 clients. Synaptin II, as a scaffold, is encoded by SYN2, which is one of the three genes encoding synaptic proteins. Synaptin II is involved in droplet and postsynaptic density, playing a crucial role in controlling synapse formation and growth, neuron maturation and renewal, as well as the mobilization, docking, fusion, and recycling of synaptic vesicles (<xref ref-type="bibr" rid="B44">44</xref>). In addition, there have been reported that the expression level of SYN2 is significantly related to the prognosis of breast cancer, suggesting that it may play a role (<xref ref-type="bibr" rid="B45">45</xref>). The regulator POU4F1, a transcription factor of the POU gene family, is mainly expressed in neuronal cells and can activate the transcriptional activity of the antiapoptotic gene bcl-2 to protect neuronal cells from apoptosis (<xref ref-type="bibr" rid="B46">46</xref>). Its role has been validated in breast cancer, melanoma, thyroid cancer and glioma (<xref ref-type="bibr" rid="B47">47</xref>&#x2013;<xref ref-type="bibr" rid="B50">50</xref>). Several studies suggest that POU4F1 may be a hub gene in certain signature of colorectal cancer, yet its specific role has not been experimentally validated (<xref ref-type="bibr" rid="B51">51</xref>&#x2013;<xref ref-type="bibr" rid="B53">53</xref>). We successfully overexpressed the transcription factor POU4F1 in HCT8 cells and observed a significant enhancement in both cell proliferation and migration. These findings underscore the pivotal role of POU4F1 in the oncogenic process of CRC, thereby broadening our understanding of its contribution to tumorigenesis. However, the particular function of POU4F1 in the LLPS process has not been thoroughly investigated, and we believe this will be an entirely new field. The other regulator PRMT1 is one of the major protein arginine methyltransferases in mammals. Due to the substrate of PRMT1 regulate various biological functions, the dysregulation of arginine methylation caused by PRMT1 may lead to the progression of cancer (<xref ref-type="bibr" rid="B54">54</xref>). A total of 6 out of 11 clients can participate in postsynaptic density. Among them, AKR1C1 and OGDHL can also participate in nucleolus. The other two members of Nucleolus are NRG1 and PSMA7. DMKN participates in p-body. CDK2 is quite comprehensive and participates in various membraneless organelles including nucleolus, centrosome/spindle pole body and stress granule. SNAI1 is a unique protein that cannot be classified, and further research is needed to determine the localization of the droplets it forms. Although we understand the types of membraneless organelles involved in these model genes, further exploration is still needed on the specific roles played by some model genes in tumor progression.</p>
<p>Anyway, there are several limitations in our study. First, all analyses were performed based on the retrospective data of TCGA and GEO databases, using prospective data would be more convincing. Second, due to the lack of the treatment-related information in GSE39582 cohort, all of the relevant analyses only used data from TCGA database. Finally, our study did not elucidate the specific molecular mechanisms of model genes in the progression of colon cancer, and further experiments evidence are needed in the future.</p>
</sec>
<sec id="s5" sec-type="conclusions">
<label>5</label>
<title>Conclusion</title>
<p>In summary, we divided colon cancer patients into two subtypes of LLPS, which have different prognosis, pathway activity, clinicopathological features and immune cell infiltration. In addition, we constructed an LLPS-related gene signature to predict the prognosis of colon cancer patients. Patients with high LRRS have worse prognosis and poorer response to immunotherapy. Our findings might contribute to personalized prognosis prediction and better treatment options for colon cancer patients, but further studies are needed to confirm this point.</p>
</sec>
</body>
<back>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Material</bold>
</xref>.</p>
</sec>
<sec id="s7" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>Ethical approval was not required for the studies on humans in accordance with the local legislation and institutional requirements because only commercially available established cell lines were used.</p>
</sec>
<sec id="s8" sec-type="author-contributions">
<title>Author contributions</title>
<p>SW: Conceptualization, Data curation, Software, Writing &#x2013; original draft. SH: Methodology, Resources, Validation, Writing &#x2013; original draft. SJ: Formal analysis, Visualization, Writing &#x2013; original draft. CW: Funding acquisition, Investigation, Writing &#x2013; original draft. PZ: Writing &#x2013; review &amp; editing. YY: Funding acquisition, Writing &#x2013; review &amp; editing. ZG: Project administration, Supervision, Writing &#x2013; review &amp; editing.</p>
</sec>
<sec id="s9" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare financial support was received for the research, authorship, and/or publication of this article. This research was funded by the National Natural Science Foundation of China, grant number 82303089 and Beijing Xisike Clinical Oncology Research Foundation, grant number Y-xsk2021-0004.</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>We sincerely acknowledge the developers of these public databases including TCGA, GEO and DrLLPS.</p>
</ack>
<sec id="s10" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s11" sec-type="ai-statement">
<title>Generative AI statement</title>
<p>The author(s) declare that no Generative AI was used in the creation of this manuscript.</p>
</sec>
<sec id="s12" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s13" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fimmu.2024.1514613/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fimmu.2024.1514613/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Table1.xlsx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sung</surname> <given-names>H</given-names>
</name>
<name>
<surname>Ferlay</surname> <given-names>J</given-names>
</name>
<name>
<surname>Siegel</surname> <given-names>RL</given-names>
</name>
<name>
<surname>Laversanne</surname> <given-names>M</given-names>
</name>
<name>
<surname>Soerjomataram</surname> <given-names>I</given-names>
</name>
<name>
<surname>Jemal</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>Global cancer statistics 2020: globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries</article-title>. <source>CA Cancer J Clin</source>. (<year>2021</year>) <volume>71</volume>:<page-range>209&#x2013;49</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.3322/caac.21660</pub-id>
</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dekker</surname> <given-names>E</given-names>
</name>
<name>
<surname>Tanis</surname> <given-names>PJ</given-names>
</name>
<name>
<surname>Vleugels</surname> <given-names>JLA</given-names>
</name>
<name>
<surname>Kasi</surname> <given-names>PM</given-names>
</name>
<name>
<surname>Wallace</surname> <given-names>MB</given-names>
</name>
</person-group>. <article-title>Colorectal cancer</article-title>. <source>Lancet</source>. (<year>2019</year>) <volume>394</volume>:<page-range>1467&#x2013;80</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/s0140-6736(19)32319-0</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Banani</surname> <given-names>SF</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>HO</given-names>
</name>
<name>
<surname>Hyman</surname> <given-names>AA</given-names>
</name>
<name>
<surname>Rosen</surname> <given-names>MK</given-names>
</name>
</person-group>. <article-title>Biomolecular condensates: organizers of cellular biochemistry</article-title>. <source>Nat Rev Mol Cell Biol</source>. (<year>2017</year>) <volume>18</volume>:<page-range>285&#x2013;98</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nrm.2017.7</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gomes</surname> <given-names>E</given-names>
</name>
<name>
<surname>Shorter</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>The molecular language of membraneless organelles</article-title>. <source>J Biol Chem</source>. (<year>2019</year>) <volume>294</volume>:<page-range>7115&#x2013;27</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1074/jbc.TM118.001192</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alberti</surname> <given-names>S</given-names>
</name>
<name>
<surname>Gladfelter</surname> <given-names>A</given-names>
</name>
<name>
<surname>Mittag</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>Considerations and challenges in studying liquid-liquid phase separation and biomolecular condensates</article-title>. <source>Cell</source>. (<year>2019</year>) <volume>176</volume>:<page-range>419&#x2013;34</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cell.2018.12.035</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname> <given-names>YG</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>H</given-names>
</name>
</person-group>. <article-title>Phase separation in membrane biology: the interplay between membrane-bound organelles and membraneless condensates</article-title>. <source>Dev Cell</source>. (<year>2020</year>) <volume>55</volume>:<fpage>30</fpage>&#x2013;<lpage>44</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.devcel.2020.06.033</pub-id>
</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Espinosa</surname> <given-names>JR</given-names>
</name>
<name>
<surname>Joseph</surname> <given-names>JA</given-names>
</name>
<name>
<surname>Sanchez-Burgos</surname> <given-names>I</given-names>
</name>
<name>
<surname>Garaizar</surname> <given-names>A</given-names>
</name>
<name>
<surname>Frenkel</surname> <given-names>D</given-names>
</name>
<name>
<surname>Collepardo-Guevara</surname> <given-names>R</given-names>
</name>
</person-group>. <article-title>Liquid network connectivity regulates the stability and composition of biomolecular condensates with many components</article-title>. <source>Proc Natl Acad Sci U.S.A</source>. (<year>2020</year>) <volume>117</volume>:<page-range>13238&#x2013;47</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.1917569117</pub-id>
</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Marques</surname> <given-names>MA</given-names>
</name>
<name>
<surname>de Oliveira</surname> <given-names>GAP</given-names>
</name>
<name>
<surname>Silva</surname> <given-names>JL</given-names>
</name>
</person-group>. <article-title>The chameleonic behavior of P53 in health and disease: the transition from a client to an aberrant condensate scaffold in cancer</article-title>. <source>Essays Biochem</source>. (<year>2022</year>) <volume>66</volume>:<page-range>1023&#x2013;33</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1042/ebc20220064</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sekar</surname> <given-names>D</given-names>
</name>
<name>
<surname>Tusubira</surname> <given-names>D</given-names>
</name>
<name>
<surname>Ross</surname> <given-names>K</given-names>
</name>
</person-group>. <article-title>Tdp-43 and neat long non-coding rna: roles in neurodegenerative disease</article-title>. <source>Front Cell Neurosci</source>. (<year>2022</year>) <volume>16</volume>:<elocation-id>954912</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fncel.2022.954912</pub-id>
</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ji</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Li</surname> <given-names>F</given-names>
</name>
<name>
<surname>Qiao</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Modulating liquid-liquid phase separation of fus: mechanisms and strategies</article-title>. <source>J Mater Chem B</source>. (<year>2022</year>) <volume>10</volume>:<page-range>8616&#x2013;28</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1039/d2tb01688e</pub-id>
</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Portz</surname> <given-names>B</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>BL</given-names>
</name>
<name>
<surname>Shorter</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Fus and tdp-43 phases in health and disease</article-title>. <source>Trends Biochem Sci</source>. (<year>2021</year>) <volume>46</volume>:<page-range>550&#x2013;63</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.tibs.2020.12.005</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Boyko</surname> <given-names>S</given-names>
</name>
<name>
<surname>Surewicz</surname> <given-names>WK</given-names>
</name>
</person-group>. <article-title>Tau liquid-liquid phase separation in neurodegenerative diseases</article-title>. <source>Trends Cell Biol</source>. (<year>2022</year>) <volume>32</volume>:<page-range>611&#x2013;23</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.tcb.2022.01.011</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mehta</surname> <given-names>S</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Liquid-liquid phase separation drives cellular function and dysfunction in cancer</article-title>. <source>Nat Rev Cancer</source>. (<year>2022</year>) <volume>22</volume>:<page-range>239&#x2013;52</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41568-022-00444-7</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tong</surname> <given-names>X</given-names>
</name>
<name>
<surname>Tang</surname> <given-names>R</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>W</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>X</given-names>
</name>
<etal/>
</person-group>. <article-title>Liquid-liquid phase separation in tumor biology</article-title>. <source>Signal Transduct Target Ther</source>. (<year>2022</year>) <volume>7</volume>:<fpage>221</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41392-022-01076-x</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>B</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Dai</surname> <given-names>T</given-names>
</name>
<name>
<surname>Qin</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>H</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>Liquid-liquid phase separation in human health and diseases</article-title>. <source>Signal Transduct Target Ther</source>. (<year>2021</year>) <volume>6</volume>:<fpage>290</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41392-021-00678-1</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mao</surname> <given-names>S</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>H</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Phase separation of yap mediated by coiled-coil domain promotes hepatoblastoma proliferation via activation of transcription</article-title>. <source>J Gastroenterol Hepatol</source>. (<year>2023</year>) <volume>38</volume>:<page-range>1398&#x2013;407</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/jgh.16173</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wei</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>H</given-names>
</name>
<name>
<surname>Yee</surname> <given-names>PP</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Zheng</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>Paraspeckle protein nono promotes taz phase separation in the nucleus to drive the oncogenic transcriptional program</article-title>. <source>Adv Sci (Weinh)</source>. (<year>2021</year>) <volume>8</volume>:<elocation-id>e2102653</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/advs.202102653</pub-id>
</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ritchie</surname> <given-names>ME</given-names>
</name>
<name>
<surname>Phipson</surname> <given-names>B</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>D</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Law</surname> <given-names>CW</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>W</given-names>
</name>
<etal/>
</person-group>. <article-title>Limma powers differential expression analyses for rna-sequencing and microarray studies</article-title>. <source>Nucleic Acids Res</source>. (<year>2015</year>) <volume>43</volume>:<elocation-id>e47</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkv007</pub-id>
</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Marisa</surname> <given-names>L</given-names>
</name>
<name>
<surname>de Reyni&#xe8;s</surname> <given-names>A</given-names>
</name>
<name>
<surname>Duval</surname> <given-names>A</given-names>
</name>
<name>
<surname>Selves</surname> <given-names>J</given-names>
</name>
<name>
<surname>Gaub</surname> <given-names>MP</given-names>
</name>
<name>
<surname>Vescovo</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>Gene expression classification of colon cancer into molecular subtypes: characterization, validation, and prognostic value</article-title>. <source>PloS Med</source>. (<year>2013</year>) <volume>10</volume>:<elocation-id>e1001453</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pmed.1001453</pub-id>
</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Leek</surname> <given-names>JT</given-names>
</name>
<name>
<surname>Johnson</surname> <given-names>WE</given-names>
</name>
<name>
<surname>Parker</surname> <given-names>HS</given-names>
</name>
<name>
<surname>Jaffe</surname> <given-names>AE</given-names>
</name>
<name>
<surname>Storey</surname> <given-names>JD</given-names>
</name>
</person-group>. <article-title>The sva package for removing batch effects and other unwanted variation in high-throughput experiments</article-title>. <source>Bioinformatics</source>. (<year>2012</year>) <volume>28</volume>:<page-range>882&#x2013;3</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/bioinformatics/bts034</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ning</surname> <given-names>W</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>S</given-names>
</name>
<name>
<surname>Mei</surname> <given-names>B</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>P</given-names>
</name>
<etal/>
</person-group>. <article-title>Drllps: A data resource of liquid-liquid phase separation in eukaryotes</article-title>. <source>Nucleic Acids Res</source>. (<year>2020</year>) <volume>48</volume>:<page-range>D288&#x2013;d95</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkz1027</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Law</surname> <given-names>CW</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>W</given-names>
</name>
<name>
<surname>Smyth</surname> <given-names>GK</given-names>
</name>
</person-group>. <article-title>Voom: precision weights unlock linear model analysis tools for rna-seq read counts</article-title>. <source>Genome Biol</source>. (<year>2014</year>) <volume>15</volume>:<fpage>R29</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/gb-2014-15-2-r29</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wilkerson</surname> <given-names>MD</given-names>
</name>
<name>
<surname>Hayes</surname> <given-names>DN</given-names>
</name>
</person-group>. <article-title>Consensusclusterplus: A class discovery tool with confidence assessments and item tracking</article-title>. <source>Bioinformatics</source>. (<year>2010</year>) <volume>26</volume>:<page-range>1572&#x2013;3</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/bioinformatics/btq170</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>H&#xe4;nzelmann</surname> <given-names>S</given-names>
</name>
<name>
<surname>Castelo</surname> <given-names>R</given-names>
</name>
<name>
<surname>Guinney</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Gsva: gene set variation analysis for microarray and rna-seq data</article-title>. <source>BMC Bioinf</source>. (<year>2013</year>) <volume>14</volume>:<elocation-id>7</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1471-2105-14-7</pub-id>
</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ashburner</surname> <given-names>M</given-names>
</name>
<name>
<surname>Ball</surname> <given-names>CA</given-names>
</name>
<name>
<surname>Blake</surname> <given-names>JA</given-names>
</name>
<name>
<surname>Botstein</surname> <given-names>D</given-names>
</name>
<name>
<surname>Butler</surname> <given-names>H</given-names>
</name>
<name>
<surname>Cherry</surname> <given-names>JM</given-names>
</name>
<etal/>
</person-group>. <article-title>Gene ontology: tool for the unification of biology</article-title>. <source>Gene Ontology Consortium. Nat Genet</source>. (<year>2000</year>) <volume>25</volume>:<page-range>25&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/75556</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>T</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>E</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>M</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>P</given-names>
</name>
<name>
<surname>Dai</surname> <given-names>Z</given-names>
</name>
<etal/>
</person-group>. <article-title>Clusterprofiler 4.0: A universal enrichment tool for interpreting omics data</article-title>. <source>Innovation (Camb)</source>. (<year>2021</year>) <volume>2</volume>:<elocation-id>100141</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.xinn.2021.100141</pub-id>
</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>B</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Li</surname> <given-names>B</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>D</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>YL</given-names>
</name>
</person-group>. <article-title>M(6)a regulator-mediated methylation modification patterns and tumor microenvironment infiltration characterization in gastric cancer</article-title>. <source>Mol Cancer</source>. (<year>2020</year>) <volume>19</volume>:<fpage>53</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12943-020-01170-0</pub-id>
</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>He</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>C</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X</given-names>
</name>
</person-group>. <article-title>Classification of triple-negative breast cancers based on immunogenomic profiling</article-title>. <source>J Exp Clin Cancer Res</source>. (<year>2018</year>) <volume>37</volume>:<fpage>327</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s13046-018-1002-1</pub-id>
</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yoshihara</surname> <given-names>K</given-names>
</name>
<name>
<surname>Shahmoradgoli</surname> <given-names>M</given-names>
</name>
<name>
<surname>Mart&#xed;nez</surname> <given-names>E</given-names>
</name>
<name>
<surname>Vegesna</surname> <given-names>R</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>H</given-names>
</name>
<name>
<surname>Torres-Garcia</surname> <given-names>W</given-names>
</name>
<etal/>
</person-group>. <article-title>Inferring tumour purity and stromal and immune cell admixture from expression data</article-title>. <source>Nat Commun</source>. (<year>2013</year>) <volume>4</volume>:<fpage>2612</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/ncomms3612</pub-id>
</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sturm</surname> <given-names>G</given-names>
</name>
<name>
<surname>Finotello</surname> <given-names>F</given-names>
</name>
<name>
<surname>Petitprez</surname> <given-names>F</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>JD</given-names>
</name>
<name>
<surname>Baumbach</surname> <given-names>J</given-names>
</name>
<name>
<surname>Fridman</surname> <given-names>WH</given-names>
</name>
<etal/>
</person-group>. <article-title>Comprehensive evaluation of transcriptome-based cell-type quantification methods for immuno-oncology</article-title>. <source>Bioinformatics</source>. (<year>2019</year>) <volume>35</volume>:<page-range>i436&#x2013;i45</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/bioinformatics/btz363</pub-id>
</citation>
</ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>He</surname> <given-names>R</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>M</given-names>
</name>
<name>
<surname>He</surname> <given-names>L</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Man</surname> <given-names>C</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X</given-names>
</name>
<etal/>
</person-group>. <article-title>Integrated analysis of necroptosis-related genes for prognosis, immune microenvironment infiltration, and drug sensitivity in colon cancer</article-title>. <source>Front Med (Lausanne)</source>. (<year>2022</year>) <volume>9</volume>:<elocation-id>845271</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmed.2022.845271</pub-id>
</citation>
</ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Li</surname> <given-names>K</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>W</given-names>
</name>
<name>
<surname>Wan</surname> <given-names>C</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>P</given-names>
</name>
<etal/>
</person-group>. <article-title>Large-scale public data reuse to model immunotherapy response and resistance</article-title>. <source>Genome Med</source>. (<year>2020</year>) <volume>12</volume>:<elocation-id>21</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s13073-020-0721-z</pub-id>
</citation>
</ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jiang</surname> <given-names>P</given-names>
</name>
<name>
<surname>Gu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Pan</surname> <given-names>D</given-names>
</name>
<name>
<surname>Fu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Sahu</surname> <given-names>A</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>X</given-names>
</name>
<etal/>
</person-group>. <article-title>Signatures of T cell dysfunction and exclusion predict cancer immunotherapy response</article-title>. <source>Nat Med</source>. (<year>2018</year>) <volume>24</volume>:<page-range>1550&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41591-018-0136-1</pub-id>
</citation>
</ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Charoentong</surname> <given-names>P</given-names>
</name>
<name>
<surname>Finotello</surname> <given-names>F</given-names>
</name>
<name>
<surname>Angelova</surname> <given-names>M</given-names>
</name>
<name>
<surname>Mayer</surname> <given-names>C</given-names>
</name>
<name>
<surname>Efremova</surname> <given-names>M</given-names>
</name>
<name>
<surname>Rieder</surname> <given-names>D</given-names>
</name>
<etal/>
</person-group>. <article-title>Pan-cancer immunogenomic analyses reveal genotype-immunophenotype relationships and predictors of response to checkpoint blockade</article-title>. <source>Cell Rep</source>. (<year>2017</year>) <volume>18</volume>:<page-range>248&#x2013;62</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.celrep.2016.12.019</pub-id>
</citation>
</ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mayakonda</surname> <given-names>A</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>DC</given-names>
</name>
<name>
<surname>Assenov</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Plass</surname> <given-names>C</given-names>
</name>
<name>
<surname>Koeffler</surname> <given-names>HP</given-names>
</name>
</person-group>. <article-title>Maftools: efficient and comprehensive analysis of somatic variants in cancer</article-title>. <source>Genome Res</source>. (<year>2018</year>) <volume>28</volume>:<page-range>1747&#x2013;56</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1101/gr.239244.118</pub-id>
</citation>
</ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wei</surname> <given-names>M</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Liao</surname> <given-names>L</given-names>
</name>
<name>
<surname>Tian</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zheng</surname> <given-names>X</given-names>
</name>
</person-group>. <article-title>Senp1 decreases rnf168 phase separation to promote DNA damage repair and drug resistance in colon cancer</article-title>. <source>Cancer Res</source>. (<year>2023</year>) <volume>83</volume>:<page-range>2908&#x2013;23</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/0008-5472.Can-22-4017</pub-id>
</citation>
</ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cai</surname> <given-names>D</given-names>
</name>
<name>
<surname>Feliciano</surname> <given-names>D</given-names>
</name>
<name>
<surname>Dong</surname> <given-names>P</given-names>
</name>
<name>
<surname>Flores</surname> <given-names>E</given-names>
</name>
<name>
<surname>Gruebele</surname> <given-names>M</given-names>
</name>
<name>
<surname>Porat-Shliom</surname> <given-names>N</given-names>
</name>
<etal/>
</person-group>. <article-title>Phase separation of yap reorganizes genome topology for long-term yap target gene expression</article-title>. <source>Nat Cell Biol</source>. (<year>2019</year>) <volume>21</volume>:<page-range>1578&#x2013;89</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41556-019-0433-z</pub-id>
</citation>
</ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>T</given-names>
</name>
<name>
<surname>Gutman</surname> <given-names>O</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>H</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Henis</surname> <given-names>YI</given-names>
</name>
<etal/>
</person-group>. <article-title>Phase separation of taz compartmentalizes the transcription machinery to promote gene expression</article-title>. <source>Nat Cell Biol</source>. (<year>2020</year>) <volume>22</volume>:<page-range>453&#x2013;64</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41556-020-0485-0</pub-id>
</citation>
</ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>B</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>H</given-names>
</name>
<name>
<surname>He</surname> <given-names>J</given-names>
</name>
<name>
<surname>Jin</surname> <given-names>B</given-names>
</name>
<name>
<surname>Tian</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Li</surname> <given-names>W</given-names>
</name>
<etal/>
</person-group>. <article-title>Cytoskeleton remodeling mediated by circrna-ybx1 phase separation suppresses the metastasis of liver cancer</article-title>. <source>Proc Natl Acad Sci U.S.A</source>. (<year>2023</year>) <volume>120</volume>:<elocation-id>e2220296120</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.2220296120</pub-id>
</citation>
</ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ahn</surname> <given-names>JH</given-names>
</name>
<name>
<surname>Davis</surname> <given-names>ES</given-names>
</name>
<name>
<surname>Daugird</surname> <given-names>TA</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>S</given-names>
</name>
<name>
<surname>Quiroga</surname> <given-names>IY</given-names>
</name>
<name>
<surname>Uryu</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>Phase separation drives aberrant chromatin looping and cancer development</article-title>. <source>Nature</source>. (<year>2021</year>) <volume>595</volume>:<page-range>591&#x2013;5</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41586-021-03662-5</pub-id>
</citation>
</ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mu&#xf1;oz-Fontela</surname> <given-names>C</given-names>
</name>
<name>
<surname>Mandinova</surname> <given-names>A</given-names>
</name>
<name>
<surname>Aaronson</surname> <given-names>SA</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>SW</given-names>
</name>
</person-group>. <article-title>Emerging roles of P53 and other tumour-suppressor genes in immune regulation</article-title>. <source>Nat Rev Immunol</source>. (<year>2016</year>) <volume>16</volume>:<page-range>741&#x2013;50</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nri.2016.99</pub-id>
</citation>
</ref>
<ref id="B42">
<label>42</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cui</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>G</given-names>
</name>
</person-group>. <article-title>Immunomodulatory function of the tumor suppressor P53 in host immune response and the tumor microenvironment</article-title>. <source>Int J Mol Sci</source>. (<year>2016</year>) <volume>17</volume>:<page-range>1942</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms17111942</pub-id>
</citation>
</ref>
<ref id="B43">
<label>43</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Han</surname> <given-names>X</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Association of muc16 mutation with response to immune checkpoint inhibitors in solid tumors</article-title>. <source>JAMA Netw Open</source>. (<year>2020</year>) <volume>3</volume>:<elocation-id>e2013201</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1001/jamanetworkopen.2020.13201</pub-id>
</citation>
</ref>
<ref id="B44">
<label>44</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Longhena</surname> <given-names>F</given-names>
</name>
<name>
<surname>Faustini</surname> <given-names>G</given-names>
</name>
<name>
<surname>Brembati</surname> <given-names>V</given-names>
</name>
<name>
<surname>Pizzi</surname> <given-names>M</given-names>
</name>
<name>
<surname>Benfenati</surname> <given-names>F</given-names>
</name>
<name>
<surname>Bellucci</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>An updated reappraisal of synapsins: structure, function and role in neurological and psychiatric disorders</article-title>. <source>Neurosci Biobehav Rev</source>. (<year>2021</year>) <volume>130</volume>:<fpage>33</fpage>&#x2013;<lpage>60</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.neubiorev.2021.08.011</pub-id>
</citation>
</ref>
<ref id="B45">
<label>45</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lai</surname> <given-names>GE</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>J</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>CL</given-names>
</name>
<name>
<surname>Mai</surname> <given-names>CJ</given-names>
</name>
<name>
<surname>Lai</surname> <given-names>YM</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>ZQ</given-names>
</name>
<etal/>
</person-group>. <article-title>A combination of transcriptome and methylation analyses reveals the role of lncrna hotairm1 in the proliferation and metastasis of breast cancer</article-title>. <source>Gland Surg</source>. (<year>2022</year>) <volume>11</volume>:<page-range>826&#x2013;36</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.21037/gs-22-164</pub-id>
</citation>
</ref>
<ref id="B46">
<label>46</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Latchman</surname> <given-names>DS</given-names>
</name>
</person-group>. <article-title>The brn-3a transcription factor</article-title>. <source>Int J Biochem Cell Biol</source>. (<year>1998</year>) <volume>30</volume>:<page-range>1153&#x2013;7</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/s1357-2725(98)00090-9</pub-id>
</citation>
</ref>
<ref id="B47">
<label>47</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>D</given-names>
</name>
<name>
<surname>Jia</surname> <given-names>HY</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>N</given-names>
</name>
<name>
<surname>Li</surname> <given-names>SJ</given-names>
</name>
</person-group>. <article-title>Pou4f1 confers trastuzumab resistance in her2-positive breast cancer through regulating erk1/2 signaling pathway</article-title>. <source>Biochem Biophys Res Commun</source>. (<year>2020</year>) <volume>533</volume>:<page-range>533&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bbrc.2020.09.003</pub-id>
</citation>
</ref>
<ref id="B48">
<label>48</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>L</given-names>
</name>
<name>
<surname>Yue</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>J</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>T</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>W</given-names>
</name>
<etal/>
</person-group>. <article-title>Pou4f1 Promotes the Resistance of Melanoma to Braf Inhibitors through Mek/Erk Pathway Activation and Mitf up-Regulation</article-title>. <source>Cell Death Dis</source>. (<year>2020</year>) <volume>11</volume>:<fpage>451</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41419-020-2662-2</pub-id>
</citation>
</ref>
<ref id="B49">
<label>49</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jung</surname> <given-names>SN</given-names>
</name>
<name>
<surname>Kang</surname> <given-names>YE</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>GH</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>L</given-names>
</name>
<name>
<surname>Oh</surname> <given-names>C</given-names>
</name>
<name>
<surname>Jin</surname> <given-names>YL</given-names>
</name>
<etal/>
</person-group>. <article-title>Brn3a/pou4f1 functions as a tumor suppressor by targeting C-met/stat3 signaling in thyroid cancer</article-title>. <source>J Clin Endocrinol Metab</source>. (<year>2020</year>) <volume>105</volume>:<page-range>dgaa316</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1210/clinem/dgaa316</pub-id>
</citation>
</ref>
<ref id="B50">
<label>50</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tang</surname> <given-names>N</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Xihuang pill facilitates glioma cell pyroptosis via the pou4f1/stat3 axis</article-title>. <source>Funct Integr Genomics</source>. (<year>2023</year>) <volume>23</volume>:<fpage>334</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10142-023-01263-1</pub-id>
</citation>
</ref>
<ref id="B51">
<label>51</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>M</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>C</given-names>
</name>
<name>
<surname>Miao</surname> <given-names>J</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>X</given-names>
</name>
<etal/>
</person-group>. <article-title>Identifying and evaluating a disulfidptosis-related gene signature to predict prognosis in colorectal adenocarcinoma patients</article-title>. <source>Front Immunol</source>. (<year>2024</year>) <volume>15</volume>:<elocation-id>1344637</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2024.1344637</pub-id>
</citation>
</ref>
<ref id="B52">
<label>52</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Li</surname> <given-names>H</given-names>
</name>
<name>
<surname>Li</surname> <given-names>W</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Jia</surname> <given-names>W</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Identification and verification of a prognostic signature based on a mirna-mrna interaction pattern in colon adenocarcinoma</article-title>. <source>Front Cell Dev Biol</source>. (<year>2023</year>) <volume>11</volume>:<elocation-id>1161667</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fcell.2023.1161667</pub-id>
</citation>
</ref>
<ref id="B53">
<label>53</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cui</surname> <given-names>G</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>C</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Shon</surname> <given-names>K</given-names>
</name>
<name>
<surname>Gu</surname> <given-names>R</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>C</given-names>
</name>
<etal/>
</person-group>. <article-title>Development of an exosome-related and immune microenvironment prognostic signature in colon adenocarcinoma</article-title>. <source>Front Genet</source>. (<year>2022</year>) <volume>13</volume>:<elocation-id>995644</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fgene.2022.995644</pub-id>
</citation>
</ref>
<ref id="B54">
<label>54</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Schapira</surname> <given-names>M</given-names>
</name>
<name>
<surname>Arrowsmith</surname> <given-names>CH</given-names>
</name>
<name>
<surname>Barsyte-Lovejoy</surname> <given-names>D</given-names>
</name>
</person-group>. <article-title>Protein arginine methylation: from enigmatic functions to therapeutic targeting</article-title>. <source>Nat Rev Drug Discovery</source>. (<year>2021</year>) <volume>20</volume>:<page-range>509&#x2013;30</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41573-021-00159-8</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>