A review of published cases of PGM3 variants in humans from 2014 to 2023 was conducted. The cases included 44 affected individuals and were analyzed to summarize their clinical manifestations, immunophenotyping, genetic mutations, therapeutic approaches, and survival outcomes. Subsequently, Kaplan–Meier analysis was performed using GraphPad Prism 9 to determine the overall probability of survival for patients with PGM3 deficiency over time.

Human samples were obtained in accordance with the ethical guidelines of the University of Freiburg (ethical approval number 302/13_171483) after obtaining informed consent from all the study participants. The human B cell line BJAB was previously provided by Professor Eibel of the Institute of Immunology in Freiburg and was subsequently cryopreserved in our laboratory. The PGM3 inhibitor FR054 was synthesized by Prof. Ferdinando Chiaradonna’s laboratory (20, 21). Cells were treated with or without PGM3 inhibitor at the indicated concentrations for 72 h or 96 h and used for further analysis.

Human BJAB cells were cultured in RPMI1640 supplemented with 10% fetal calf serum (FCS) and 1% penicillin–streptomycin (100 U/ml). HEK293T cells were cultured in DMEM medium supplemented with 10% FCS and 1% penicillin–streptomycin (100 U/ml). Primary human T cells were isolated from healthy donors and maintained in penicillin-streptomycin containing X-VIVO20 medium supplemented with 10% FCS, with or without the cytokines described to induce T cell polarization. All the cells were incubated at 37°C in a humidified atmosphere containing 5% CO₂.

To generate PGM3 knockout BJAB cells, single guide RNAs (sgRNAs) targeting the PGM3 sequence were cloned into the LentiCas9-GFP vector. The plasmid was then co-transfected with psPAX2 and pMD2.G packaging plasmids into HEK293T cells at a 4:3:1 ratio using XtremeGene HP transfection. After 24 h and 48 h, lentiviral particles were harvested, filtered (40 µM), and used to transduce BJAB cells by spinoculating at 2,000 rpm for 2 h with 4 μg/ml polybrene. The cells were sorted and diluted to a concentration of 1 cell/400 µl, and 200 µl of the solution was plated in each well of a 96-well plate. The expanded clones were evaluated for PGM3 knockout efficiency by Western blot analysis. Two pairs of sgRNA sequences (5’-3’) targeting PGM3 were designed: (1) sense CACCGGACTGCTGGATTTCGAACGA and antisense AAACTCGTTCGAAATCC-AGCAGTC; (2) sense CACCGTATGGAAAGGC-AACTATAGA and antisense AAACTCTATAGTTGCCTTTCCATA.

To reconstitute wild-type and mutant PGM3, site-directed mutagenesis using two-step PCR introduced variants into the 542aa PGM3 cDNA sequence. This was performed using the pMXs-IRES-GFP-PGM3 plasmid as a template and the primers listed in Table 1 . The purified PCR products were subjected to digestion and ligation using a linearized pMXs-IRES-mCherry retroviral vector as the recipient plasmid. The plasmid, together with the pCL-ampho packaging plasmid, was co-transfected at a 1:1 ratio into HEK293T cells using XtremeGene HP. The resulting retrovirus was harvested from the supernatant at 24-hour and 48-hour post-transfection. The virus was used to spinoculate PGM3-deficient BJAB cells with 4 μg/ml polybrene at 2,000 rpm for 2 h. After 7 days of incubation, mCherry-positive cells were sorted, expanded, and subjected to evaluation and assay for PGM3 expression.

The expression of PGM3 protein in the cell lysates was quantified by Western blotting. Cells were lysed in cold RIPA lysis buffer (50 mM Tris–HCl pH 8.0, 150 mM NaCl, 1% SDS, 0.5% sodium deoxycholate, and 1× complete protease inhibitor cocktail) for 20 min at 4°C. The protein concentration in the cell lysates was determined using a Pierce BCA protein assay kit according to the manufacturer’s instructions. The results were calculated using GraphPad Prism 9 software. Protein samples (50 µg) were resolved by SDS-PAGE and transferred to a nitrocellulose membrane. The membrane was then incubated overnight with anti-PGM3 antibody (Sigma). Protein expression levels on the Western blots were quantified by densitometry analysis using the ImageJ software. The expression of tubulin or GAPDH was used to quantify protein loading.

Primary human CD4⁺ T cells were isolated from peripheral blood mononuclear cells (PBMCs) of healthy donors using a negative selection kit (Miltenyi Biotec). Naïve CD4+ T cells were stained with fluorochrome-conjugated antibodies and purified by sorting CD4⁺CD25⁻CCR7⁺CD45RA⁺ cells.

To assess proliferation, naive T cells were labeled with CellTrace Violet dye (1:1,000) and cultured in 96-well plates precoated with anti-CD3 (OKT3, 2 μg/ml) and soluble anti-CD28 (CD28.2, 1 μg/ml) antibodies. At 72 h post-stimulation, cells were harvested and analyzed for complex N-glycans using PHA-L lectin staining, O-GlcNAc by immunostaining, glycolysis, and mitochondrial respiration using a Seahorse instrument. At 5 days post-stimulation, cell division was evaluated by flow cytometry to determine the dilution of CellTrace Violet, which serves as an indicator of cell division.

For cell polarization, naïve CD4⁺ T cells were activated on anti-CD3 antibody-coated plates (2 μg/ml) with soluble anti-CD28 antibodies (2 μg/ml) and the following cytokines: IL-12 (25 ng/ml) for Th1, IL-4 (40 ng/ml) and IL-2 (100 U/ml) for Th2, TGFβ (15 μg/ml) and IL-2 (100 U/ml) for Treg, and IL-1β (12.5 ng/ml), IL-6 (25 ng/ml), IL-21 (25 ng/ml), IL-23 (12.5 ng/ml) and TGFβ (5 ng/ml) for Th17 subset differentiation. After 5–7 days, the cells were re-stimulated with PMA (500 ng/ml) and ionomycin (100 ng/ml) in the presence of brefeldin A (10 μg/ml) for 4 h, and the expression of IFN-γ, IL-4, IL-17,and FoxP3 in Tregs was measured by flow cytometry. The data were acquired on a Fortessa flow cytometer, analyzed using FlowJo VX software, and subsequently quantified using GraphPad Prism.

CD4+ T cells were isolated and metabolically quenched with cold water/methanol/chloroform/(1:1:1). After incubation and centrifugation, the polar phase was purified by centrifugal filtration (Amicon, Merck) and evaporated under vacuum for storage at −20°C until analysis. UDP-GlcNAc levels in the samples were quantified by HPLC (Jasco Europe, Italy) using a C18 column (Kinetex, 4.6 mm × 250 mm i.d., 5 um particle size, 100 Å pore size, Phenomenex) with a guard column using a method adapted from a previous study (22). The working system was operated at 40°C and a flow rate of 1 mL/min. Samples (20 μl) were injected, and compounds were separated over a 75 min gradient using buffer A (100 mM potassium phosphate + 8 mM tetrabutylammonium hydrogen sulfate) and buffer B (100% acetonitrile) as follows: 0 min–12 min 100% A; 12 min–34 min 0%–30% B; 34 min–40 min 30% B; 40 min–50 min 30%–0% B; 50 min–75 min 100% A. UDP-GlcNAc was detected at 254 nm and quantified by comparison with standard curves. To maintain the performance, the column was washed after each sample set with solutions for 30 min each: 50% acetonitrile-50% phase A without ion-pair agents to remove retained analytes, 20% acetonitrile-80% water to remove salts, and 80% acetonitrile-20% water for storage.

Statistical analyses were performed using GraphPad Prism 9. Student’s t-test was used to ascertain the significance of the difference between two groups, whereas one-way analysis of variance (ANOVA) was used to evaluate the disparity among the means of three or more independent groups. A p-value of less than 0.05 was considered to indicate statistical significance. The level of statistical significance is indicated as follows: *p <0.05, **p <0.01, ***p <0.001, and ****p <0.0001.

A review of 44 cases from 21 families with biallelic PGM3 mutations during the period 2014–2023 stratified the phenotypes as hyper IgE syndrome-like [HIES, 26 patients (3, 5, 8)], combined immunodeficiencies [CID, seven patients (2, 6, 10, 12)], and severe combined immunodeficiencies [SCID, 11 patients (4, 7, 13, 15)] ( Table 2 ). Characteristic features included the presence of infections (93%) and atopy (84%) at a median age of 1 year ( Figures 2A, B ). Recurrent respiratory tract infections occurred in 39/42 patients. The most common diagnoses were pneumonia (n = 32), otitis media (n = 21), and bronchiectasis (n = 13). Cutaneous infections are also common, typified by abscesses of the head, neck, and axilla. Eight patients had infections such as gastroenteritis, osteomyelitis, esophagitis, septicemia, or encephalitis (3, 5, 6, 8, 10). Bacterial pathogens were predominant (29/42), including Staphylococcus aureus, Pseudomonas aeruginosa, and Proteus mirabilis. Eighteen patients had viral infections (VZV, EBV, RSV, etc.), and 13 had candidiasis. Marked eczematous eruptions including eczema, asthma, and multiple allergies, occurred in 37 patients between early infancy and childhood. Nonimmunological features were frequently observed. These include skeletal defects in utero to childhood (61%), neurological disorders (48%), developmental delay (61%), and failure to thrive (40%). Other multisystem effects included renal, cardiac, and gastrointestinal involvement (23%). Of note, eight cases had prominent skeletal malformations in utero or at birth (4, 9, 15). Taken together, these clinical manifestations revealed a profound, early onset immunological disorder associated with multi-organ disease with a wide range of ages of onset ( Figures 2A, B ).

The current treatment options are of limited benefit to patients with PGM3 mutations. Of the 44 patients, 39 received conventional antimicrobial treatment and prophylaxis to control infections, with only incomplete efficacy. Administration of intravenous immunoglobulin (IVIG) yielded minimal benefit. After intensive care, 14 patients still died of overwhelming infections or organ failure at a median age of 2 years (range 5 days to 27 years) (2–5, 7–10, 15). Hematopoietic stem cell transplantation (HSCT) resulted in complete immunological reconstitution in three out of four cases (4, 11, 12). However, two recipients still had developmental delays but normal cognition after transplantation (4). The sole death occurred in an infant transplanted at 8 months due to severe complications (15). The overall survival rate was 80% at 3 years, decreasing to 66% and 56% at 16 years and 44 years, respectively ( Figure 2C ). These findings highlight the challenges in controlling infections and eczema with appropriate therapies and prophylaxis. Additionally, HSCT may pose risks related to underlying multiorgan diseases.

Hematological features were reported in 38 patients, including lymphopenia (65%), eosinophilia (54%), neutropenia (43%), anemia (35%), bone marrow failure (11%), and thrombocytopenia (3%) ( Figure 2D ). Elevated serum IgE levels were present in 25/32 (78%) patients (range, 650–141,300 IU/ml; median, 9,320 IU/ml; normal, <130 IU/ml). Other serum IgA, IgG, and IgM levels varied among the patients.

The most common documented immunological feature was a reduction in CD4+ T lymphocyte count, which was observed in 32 of the 34 patients (94%, range 4–913/ul, median 312/ul) ( Table 3 , Figure 2D ). Notably, all nine patients who underwent further T cell phenotyping exhibited a reduction in naïve CD4+ T cells, accompanied by an increase in effector memory subsets. In addition, in the two patients with normal CD4+ T cell counts, this trend was observed. These results suggest that PGM3 deficiency leads to impaired CD4+ T cell production and enhanced differentiation. Deficits in CD8+ T cells were documented in 71% of cases, and high CD8+ T cell counts were observed in 20% of cases. B cells are also frequently affected (71%), with a reduction in memory subsets in most cases. Further functional characterization revealed defective T cell expansion following mitogenic stimulation by anti-CD3/CD28 antibodies, phytohemagglutinin (PHA), purified protein derivative (PPD), or tetanus antigens (TT) in 15 of 20 patients (75%). Two studies have reported a decrease in T-cell receptor excision circles (TRECS) associated with an increase in κ-deletion recombination excision circles (KRECs) (7, 10). Four studies evaluated T helper (Th) cell profiling towards hyperactive Th2 responses as evidenced by increased interleukin 4 (IL-4) production in contrast to variable Th1 (detected by IFNγ), Th17 (IL-17) and regulatory T (Treg) cell measurements (3, 5, 10, 12).

Some studies have shown that patients with PGM3 insufficiency have recurrent infections associated with T lymphopenia, without skeletal or neurological involvement (11, 13). This indicated an important function of PGM3 in T cell development. Therefore, we tested T cell subsets from cells derived from two patients with PGM3 L83S and D502Y (3) mutations by flow cytometry. Our data showed extremely low percentages of naïve CD4+ T cell subsets (4.24% and 0.27%, respectively) in both patients compared with healthy controls (50.9%–55.7%) ( Figures 2E, F ). Furthermore, our in vitro assays on patient-derived effector memory cells revealed hyperactive Th1 and Th2 differentiation ( Figure 2F ). Unfortunately, we were unable to determine the levels of Th17 subsets due to limited blood resources. Consistent with the reviewed data, our results showed that depleted naive CD4+ T cell pools, in contrast to expanded effector memory subsets, may be a key feature of PGM3 insufficiency.

Molecular profiling revealed 21 distinct disease-causing mutations distributed across all four functional domains of the encoded PGM3 protein ( Figure 3A ). The D502Y and E529Q substitutions within the active site loop directly disrupt the phosphate binding function, whereas others are located between neighboring loops. The latter mutations are likely to alter the stabilizing effect of the loops or protein structure, directly or indirectly affecting protein stability or activity (4, 5). The resulting aberrant protein folding and instability appear to underlie reduced protein expression, enzymatic activity, and subsequent changes in protein glycosylation and show a robust genotype-phenotype correlation (3–6, 8, 10). Variants that cause minimal residual PGM3 expression, such as E340del and D502Y, correlate with more profoundly reduced synthesis of UDP-GlcNAc and more severe phenotypes presented in patients compared to L83S (3). The SCID phenotype or the fatal disease-associated variants, N246S and I322T are due to nearly undetectable protein levels and/or enzymatic activity (4, 6). Therefore, we hypothesized that the residual level of PGM3 expression and activity would indicate phenotypic severity.

To test the putative genotype-phenotype correlations, we used a CRISPR-based knockout and genetic reconstitution approach in human B cells (BJAB cells) to compare the residual levels of PGM3 expression resulting from 12 different variants ( Figure 3B ). This allowed for a side-by-side comparison of multiple disease-associated PGM3 alleles without the confounding effects of endogenous proteins. Western blot results showed that all 12 mutant PGM3 constructs were associated with reduced protein expression compared to the wild type (WT). The residual levels varied among individual mutations. Variants from SCID-CID cases (D239H, F379L, and I322T) showed less than 10% WT levels compared to 20%–30% in HIES-like cases (L83S, E340del, and D325E). However, the effects of the two variants reported in compound heterozygosity suggest partial additivity. In addition to reduced protein expression, variants that differentially affect enzymatic activity and subsequent UDP-GlcNAc synthesis and glycosylation are likely to further explain the complex genotype–phenotype relationships in this disorder.

The predominant immunophenotype in patients with PGM3 mutations is a marked decrease in CD4+ T cells in vivo, together with impaired cell differentiation in response to TCR-mediated stimulation in vitro (3, 5). This suggests an important role for PGM3 in TCR-mediated CD4+ T cell proliferation and differentiation. To investigate this, we used FR054, an inhibitor designed to inhibit PGM3 activity (20, 21), in cultures with human-derived CD4+ T cells. We first activated the cells using plate-bound anti-CD3/CD28 antibodies, quantified UDP-GlcNAc synthesis, and then analyzed cell growth, levels of complex N-glycans and O-GlcNAcylation, glycolysis, and mitochondrial respiration. Our data showed that 72 h of TCR-mediated cell stimulation increased UDP-GlcNAc levels fourfold compared to that in control cells. Treatment of cells with the PGM3 inhibitor reduced UDP-GlcNAc synthesis in a dose-dependent manner, as it caused 20% and 100% reductions at 40 μM and 80 μM, respectively, and almost blocked synthesis to the basal level observed prior to stimulation ( Figure 4A ). Notably, PGM3 inhibition impaired the TCR-induced cell proliferation. Cell count analysis showed a significant decrease in cell proliferation in parallel with a reduction in UDP-GlcNAc ( Figure 4B ). Similar decreasing trends were observed in the detection of complex N-glycans (indicated by PHA-L intensity, Figure 4C ) on the cell surface and intracellular levels of O-GlcNAcylation, suggesting that even a small decrease in UDP-GlcNAc attenuated the synthesis of both complex N-glycans and O-GlcNAc during cell proliferation ( Figure 4D ). We also investigated the effects of PGM3 inhibition on metabolic pathways, specifically glycolysis and mitochondrial respiration, as reflected by changes in the extracellular acidification rate (ECAR) and oxygen consumption rate (OCR). As expected, 72 h of TCR stimulation significantly increased the glycolytic rate and mitochondrial respiration in control cells ( Figure 4E ). Treatment with the PGM3 inhibitor led to a dose-dependent reduction in both glycolysis and mitochondrial respiration ( Figure 4E ). Taken together, our results indicate that PGM3 inhibition impairs TCR-mediated cell proliferation through a reduction in UDP-GlcNAc levels, reduction in cell membrane complex N-glycans, and intracellular protein O-GlcNAcylation, associated with a significant decrease in cell energy and anabolic pathways.

Given that restimulated effector memory CD4+ T cells from a PGM3-mutant patient showed enhanced differentiation into Th1 and Th2 subsets, we investigated the role of PGM3 in modulating the differentiation of CD4+ T cell subsets. In in vitro studies, naïve CD4+ T cells were stimulated with anti-CD3/CD28 antibodies to induce polarization in the presence of subset-specific cytokines with or without low doses (≤40 μM) of the PGM3 inhibitor. Compared to vehicle controls, the presence of 10 μM–20 μM PGM3 inhibitor in culture significantly increased Th1 and Th2 differentiation, as measured by intracellular staining for IFNγ and IL-4, while 40 μM inhibitor further enhanced IL-4+ cells but not IFNγ+ cells ( Figures 5A–C ). In contrast, 20 μM PGM3 inhibitor significantly suppressed Th17 (IL-17+) and Treg (CD25+ FoxP3+) cell differentiation, whereas 40 μM caused a more profound reduction ( Figures 5D–G ). Taken together, we have shown that partial inhibition of PGM3 activity preferentially enhances Th1 and Th2 differentiation and attenuates Th17 and Treg cell differentiation.

In summary, these findings identified PGM3 as a novel regulator that affects CD4+ T cell proliferation and CD4+ T cell subset differentiation, providing new insights into heterogeneous clinical manifestations such as atopic diseases, variable infections, and autoimmune diseases, as listed in our review data.