<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2024.1486816</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Immunology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>MiR-130c-5p targets the SHVV <italic>n</italic> gene and upregulates immune cytokines (IL-6, IL-22, IL-1&#x3b2;) to inhibit viral replication</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Wei</surname>
<given-names>Jin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1329312"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Ji</surname>
<given-names>Yan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Bai</surname>
<given-names>Yaqian</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Cheng</surname>
<given-names>Rui</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Jiaqi</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1440919"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Hu</surname>
<given-names>Xianqin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Zhang</surname>
<given-names>Chi</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2808982"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Hubei Key Laboratory of Animal Nutrition and Feed Science, School of Animal Science and Nutritional Engineering, Wuhan Polytechnic University</institution>, <addr-line>Wuhan</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Key Laboratory of Ecological Impacts of Hydraulic-Projects and Restoration of Aquatic Ecosystem of Ministry of Water Resources, Institute of Hydroecology, Ministry of Water Resources and Chinese Academy of Sciences</institution>, <addr-line>Wuhan</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Zhendong Qin, Zhongkai University of Agriculture and Engineering, China</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Jianfei Lu, Ningbo University, China</p>
<p>Yuding Fan, Chinese Academy of Fishery Sciences (CAFS), China</p>
<p>Jiagang Tu, Huazhong Agricultural University, China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Chi Zhang, <email xlink:href="mailto:zhch@whpu.edu.cn">zhch@whpu.edu.cn</email>
</p>
</fn>
<fn fn-type="equal" id="fn003">
<p>&#x2020;These authors have contributed equally to this work</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>01</day>
<month>11</month>
<year>2024</year>
</pub-date>
<pub-date pub-type="collection">
<year>2024</year>
</pub-date>
<volume>15</volume>
<elocation-id>1486816</elocation-id>
<history>
<date date-type="received">
<day>27</day>
<month>08</month>
<year>2024</year>
</date>
<date date-type="accepted">
<day>10</day>
<month>10</month>
<year>2024</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2024 Wei, Ji, Bai, Cheng, Zhang, Hu and Zhang</copyright-statement>
<copyright-year>2024</copyright-year>
<copyright-holder>Wei, Ji, Bai, Cheng, Zhang, Hu and Zhang</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>
<italic>Snakehead vesiculovirus</italic> (SHVV) has led to huge economic losses in snakehead aquaculture, and its pathogenic mechanisms is still not fully understood. MicroRNAs (miRNAs), as an important class of non-coding RNAs, play a key regulatory role in the process of viral infection.</p>
</sec>
<sec>
<title>Methods</title>
<p>We examined the effect of SHVV infection on the expression of miR-130c-5p and the effect of overexpression of miR-130c-5p on the proliferation of SHVV. Cotransfection of viral N protein and miR-130c-5p, and the effect of miR-130c-5p on the expression of N protein was detected. Meanwhile, the effect of overexpression of miR-130c-5p on the expression of various immune factors in the case of viral infection were also tested.</p>
</sec>
<sec>
<title>Results</title>
<p>In this study, SHVV infection significantly upregulated the expression of miR-130c-5p in channel catfish ovary (CCO) cells in a time- and dose-dependent manner. The further research revealed that miR-130c-5p mimic significantly inhibited, while its inhibitors promoted SHVV replication. In addition, miR-130c-5p could directly target the viral mRNA of <italic>n</italic> gene, and overexpression of miR-130c-5p could significantly decrease, and conversely, downregulation of miR-130c-5p could increase the mRNA and protein expression of the viral n gene. Meanwhile, overexpression of miR-130c-5p also upregulated the expression of immune-related genes, such as nucleotide-oligomerization domain (NOD)-like receptor subfamily C3 (NLRC3), myeloid differentiation factor 88 (MyD88), nuclear factor kappa-B (NF-&#x3ba;B), interleukin-6 (IL-6), interleukin-22 (IL-22), and interleukin-1beta (IL-1&#x3b2;) in host cells.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>miR-130c-5p was upregulated in the host during SHVV infection, and the upregulated miR-130c-5p directly inhibited viral replication by targeting the <italic>n</italic> gene of SHVV and promoting viral nucleoprotein degradation. The up-regulated miR-130c-5p also activated the expression of immune-related genes such as NLRC3, MyD88, NF-&#x3ba;B, IL-6, IL-22, and IL-1&#x3b2;, which were involved in the regulation of the signaling pathways including NF-&#x3ba;B, MyD88, Toll-like receptor (TLR), NLR, and janus tyrosine kinase-signal converter and activator of transcription (JAK-STAT), to enhance the host's antiviral immune response, and thus indirectly inhibited the viral proliferation.</p>
</sec>
</abstract>
<kwd-group>
<kwd>miR-130c-5p</kwd>
<kwd>
<italic>Snakehead fish Vesiculovirus</italic>
</kwd>
<kwd>targeting</kwd>
<kwd>nucleoprotein</kwd>
<kwd>antiviral immunity</kwd>
</kwd-group>
<counts>
<fig-count count="8"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="56"/>
<page-count count="12"/>
<word-count count="5180"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Comparative Immunology</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>
<italic>Snakehead fish vesiculovirus</italic> (SHVV) is a member of the <italic>Rhabdoviridae</italic>, which are important viral pathogens causing lethal and epidemic diseases in fish and other aquatic animals, and its genome is a single-stranded, unsegmented, negative-stranded RNA of about 11 kb (<xref ref-type="bibr" rid="B1">1</xref>, <xref ref-type="bibr" rid="B2">2</xref>). The virus encodes five main structural proteins: nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), and RNA-dependent RNA polymerase protein (L) (<xref ref-type="bibr" rid="B3">3</xref>). Among them, nucleoprotein not only serves as a template for viral transcription and replication, but also binds to viral genomic RNA, participates in the assembly process of viral particles, and plays an important role in regulating the transcription and replication process (<xref ref-type="bibr" rid="B4">4</xref>, <xref ref-type="bibr" rid="B5">5</xref>). It was demonstrated that the interaction of the N protein of the SHVV virus with its leading RNA produced during infection promotes viral replication (<xref ref-type="bibr" rid="B6">6</xref>). After the virus has invaded the fish, the nucleoprotein will be recognized by the immune system as an antigen, activating T lymphocytes, especially T helper lymphocytes, and promoting the production of specific antibodies against the virus by B lymphocytes (<xref ref-type="bibr" rid="B7">7</xref>). In addition, the lethality of the disease is extremely high, up to 90% or more, but there is a lack of effective control and treatment measures (<xref ref-type="bibr" rid="B8">8</xref>, <xref ref-type="bibr" rid="B9">9</xref>).</p>
<p>During viral infection, a series of changes in the expression profile of cellular miRNAs are triggered, and these differentially expressed miRNAs play an important regulatory role in viral invasion as well as host immune defense mechanisms. MiRNAs, as a class of highly conserved, non-coding small RNA molecules, mainly rely on the 2nd-8th nucleotides at the 5&#x2019; end (seed sequence) to recognize the mRNA of the target gene and bind it by base complementary pairing to degrade or inhibit the translation of the target gene (<xref ref-type="bibr" rid="B10">10</xref>, <xref ref-type="bibr" rid="B11">11</xref>). Numerous studies have demonstrated that miRNAs are involved in regulating viral replication in a direct or indirect manner during viral infection. For example, gallus gallus miRNAs (gga-miR-1603 and gga-miR-1794) directly bind to the <italic>l</italic> gene of <italic>Newcastle disease virus</italic> to facilitate ts degradation and inhibit the replication of multiple genotypes of <italic>Newcastle disease virus</italic> (NDVs) <italic>in vitro</italic> (<xref ref-type="bibr" rid="B12">12</xref>); miR-370 inhibits <italic>Hepatitis B virus</italic> (HBV) gene expression and replication by targeting transcription factor nuclear factor IA (NFIA), whereas NFIA stimulates HBV replication by directly regulating the activity of HBV enhancer I (<xref ref-type="bibr" rid="B13">13</xref>); <italic>Recombinant Snakehead Rhabdovirus</italic> (SHRV) can express artificial microRNAs targeting <italic>Spring Viremia of Carp Virus</italic> (SVCV) p gene to treat SVCV infection (<xref ref-type="bibr" rid="B14">14</xref>). Furthermore, miRNAs can indirectly affect the host&#x2019;s antiviral immune response by regulating intracellular signaling pathways, such as interleukin (IL)-mediated signaling pathways (<xref ref-type="bibr" rid="B15">15</xref>, <xref ref-type="bibr" rid="B16">16</xref>) and interferon (IFN)-mediated signaling pathways (<xref ref-type="bibr" rid="B17">17</xref>, <xref ref-type="bibr" rid="B18">18</xref>).</p>
<p>Recently, SHVV infection has led to hundreds of millions of dollars of annual economic losses in cultured snakeheads, but its pathogenic mechanism and interaction with host cells have not been fully elucidated (<xref ref-type="bibr" rid="B19">19</xref>). Based on the previous study that channel catfish ovary (CCO) cells are experimental materials with high susceptibility to SHVV (<xref ref-type="bibr" rid="B20">20</xref>), we screened the microRNA expression profiles of host cells by sequencing and found that SHVV infection alters the expression of host miR-130c-5p, but its role in SHVV infection is yet to be explored in depth (<xref ref-type="bibr" rid="B21">21</xref>). In this study, we explored the effect of miR-130c-5p on viral proliferation and host immune response after SHVV infection with CCO to deepen our understanding of the molecular mechanism of SHVV infection.</p>
</sec>
<sec id="s2">
<label>2</label>
<title>Methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Cells and viruses</title>
<p>CCO cells were cultured in minimum essential medium (MEM) (Gibco, New Zealand) containing 10% fetal bovine serum (FBS) (Yeasen Biotechnology, Shanghai) and 1% penicillin-streptomycin mixture (PBS) (Life ilab Biotechnology, Shanghai) in medium at 25&#xb0;C in a constant temperature incubator (Gibco, New Zealand) in medium at 25&#xb0;C in a constant temperature incubator. SHVV was isolated from diseased hybrid snakeheads collected from a fishery in Guangdong Province, China, and stored at -80&#xb0;C.</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Reagents and antibodies</title>
<p>The miR-130c-5p mimic (double-stranded RNA oligonucleotides), miR-130c-5p inhibitor (single-stranded chemically modified oligonucleotides), negative control (NC) mimic, and NC inhibitor were purchased from GenePharma (Shanghai, China). Their sequences were as follows: miR-130c-5p mimic, 5&#x2019;- UAGCUUAUCAGACUGAUGUUGA-3&#x2019; (forward) and 5&#x2019;-AACAUCAGUCUGAUAAGCUAUU-3&#x2019; (reverse); miR-130c-5p inhibitor, 5&#x2019;- UCAACAUCAGUCUGAUAAGCUA-3&#x2019;; NC mimic, 5&#x2019;- UUCUCCGAACGUGUCACGUTT-3&#x2019; (forward) and 5&#x2019;-ACGUGACACGUUCGGAGAATT-3&#x2019; (reverse); NC inhibitor, 5&#x2019;-CAGUACUUUUGUGUAGUACAA-3&#x2019;.</p>
<p>Antibodies against SHVV N have been prepared and stored in our laboratory. In the experiment, the following antibodies were used: <italic>&#x3b2;-actin</italic> antibody, primary anti-rabbit GFP and secondary anti-rabbit HRP antibodies), all of which were purchased from Proteintech Group (Wuhan, China).</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Plasmids</title>
<p>The plasmid pCDNA3.1-N expressing SHVV N was constructed by cloning the pcr-amplified cDNA of N into the vector pCDNA3.1(+) using the primers shown in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>. The 130c-5p target sequence (~200 nt) of the coding region of the <italic>n</italic> gene (GenBank: OQ211330.1) was amplified and cloned into the pmirGLO vector using the primers shown in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref> to construct the luciferase reporter plasmid pmirGLO-N. Plasmid pmirGLO-N-MUT was generated by PCR-mediated mutation of plasmid pmirGLO-N using the primers listed in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Primers used in this study.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Primer*</th>
<th valign="middle" align="left">Sequences (5&#x2019;&#x2192;3&#x2019;)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">SHVV-N-FW</td>
<td valign="middle" align="left">CCGCATCGGAAATCAAGCAG</td>
</tr>
<tr>
<td valign="middle" align="left">SHVV-N-BW</td>
<td valign="middle" align="left">GTTGACCGCTTGCCCAATTT</td>
</tr>
<tr>
<td valign="middle" align="left">NLRC3-FW</td>
<td valign="middle" align="left">TGGCTTCCAAAACCACTATCG</td>
</tr>
<tr>
<td valign="middle" align="left">NLRC3-RW</td>
<td valign="middle" align="left">ACCGCCTCGCCTCCTGAT</td>
</tr>
<tr>
<td valign="middle" align="left">MyD88-FW</td>
<td valign="middle" align="left">AAGAGGATGGTGGTCGTCA</td>
</tr>
<tr>
<td valign="middle" align="left">MyD88-BW</td>
<td valign="middle" align="left">AGGAATCAGCCGTTTGGT</td>
</tr>
<tr>
<td valign="middle" align="left">NF-Kb-FW</td>
<td valign="middle" align="left">CCTCATCAATGCCTTCCG</td>
</tr>
<tr>
<td valign="middle" align="left">NF-Kb-BW</td>
<td valign="middle" align="left">CGCTGTTCCCGATACTCTT</td>
</tr>
<tr>
<td valign="middle" align="left">IL-6-FW</td>
<td valign="middle" align="left">CAGCCCGCAAAAATGTCTGC</td>
</tr>
<tr>
<td valign="middle" align="left">IL-6-RW</td>
<td valign="middle" align="left">TCAGGTAAGGAGGTCGGGCG</td>
</tr>
<tr>
<td valign="middle" align="left">IL-22-FW</td>
<td valign="middle" align="left">GCGCTGTACTTGCTGTGCTG</td>
</tr>
<tr>
<td valign="middle" align="left">IL-22-RW</td>
<td valign="middle" align="left">CGCTTGCGCGTGCTTGGCCA</td>
</tr>
<tr>
<td valign="middle" align="left">IL-1&#x3b2;-FW</td>
<td valign="middle" align="left">TGAGAATGTGATTGAAGAGAGC</td>
</tr>
<tr>
<td valign="middle" align="left">IL-1&#x3b2;-BW</td>
<td valign="middle" align="left">TTGTTTCCACCCTTCAGAGT</td>
</tr>
<tr>
<td valign="middle" align="left">&#x3b2;-actin-FW</td>
<td valign="middle" align="left">GCCCATCTCCTGCTCAAAG</td>
</tr>
<tr>
<td valign="middle" align="left">&#x3b2;-actin-BW</td>
<td valign="middle" align="left">CCATCTCCTGCTCGAAGTC</td>
</tr>
<tr>
<td valign="middle" align="left">miR-130c-5p-FW</td>
<td valign="middle" align="left">GCCCTTTTTCTGTTGTACTACT</td>
</tr>
<tr>
<td valign="middle" align="left">U6-FW</td>
<td valign="middle" align="left">CTCGCTTCGGCAGCACA</td>
</tr>
<tr>
<td valign="middle" align="left">U6-BW</td>
<td valign="middle" align="left">AACGCTTCACGAATTTGCGT</td>
</tr>
<tr>
<td valign="middle" align="left">N-FW</td>
<td valign="middle" align="left">CCGCTCGAGATCGTGGTCCGCTATCTGCT</td>
</tr>
<tr>
<td valign="middle" align="left">N-BW</td>
<td valign="middle" align="left">GCGTCGACGCACTCCACTGAGGGTT</td>
</tr>
<tr>
<td valign="middle" align="left">N-MUT-FW</td>
<td valign="middle" align="left">TAGGATCTGCCTCTAGGGGGACGACCTGGATTGCATCCATGAC</td>
</tr>
<tr>
<td valign="middle" align="left">N-MUT-BW</td>
<td valign="middle" align="left">GTCGTCC CCCTAGAGGCAGATCCTA</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>*Primers with names beginning with N- were used to generate luciferase reporter plasmids. Other primers were detected by qRT-PCR.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Transfection</title>
<p>The NC mimic, NC inhibitor, miR-130c-5p mimic, miR-130c-5p inhibitor, and pCDNA3.1-N were incubated with PEI Transfection Reagent (Yeasen Biotechnology, Shanghai) in 50 &#xb5;L Opti-MEM medium (Yeasen Biotechnology, Shanghai) for 30 minutes at room temperature. The incubated samples were then inoculated onto CCO cells. After 4-6 hours of transfection at 25&#xb0;C, replace with new cell culture medium. Cell samples are collected at the required time for subsequent experiments.</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Dual-luciferase reporter assay</title>
<p>CCO cells were co-transfected with 30 pmol of NC mimic, miR-130c-5p mimic, NC inhibitor or miR-130c-5p inhibitor with 500 ng of luciferase reporter plasmids pmirGLO-N and pmirGLO-N mut using TransIntroTM EL transfection reagent (TransGen Biotech, China). co-transfected CCO cells. Twenty-four hours after transfection, luciferase activity was measured using the Dual-Glo luciferase assay system (Promega, USA). Measurements were performed using a GloMax-Multi - Jr single-tube multimode reader (Promega, USA) according to the manufacturer&#x2019;s protocol. Data are expressed as relative firefly luciferase activity normalized to Renilla luciferase activity.</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Virus infection and titration</title>
<p>CCO cells were incubated with SHVV at an MOI of 1. After adsorption for 2&#xa0;h at 25&#xb0;C, the inoculum was removed and the cells were washed twice with PBS, followed by the addition of MEM containing 5% FBS. Supernatants were collected at different time points for titration of virus with TCID50, and cells were harvested for detection of viral proteins by Western blot or for detection of relative viral mRNA expression by quantitative real-time PCR (qRT-PCR).</p>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Quantitative real-time PCR</title>
<p>Total RNA from cell samples was extracted according to the instructions of the Extraction Reagent (Vazyme, Nanjin). RNA was reverse transcribed to obtain cDNA according to the instructions of the HiScript III RT SuperMix for qPCR (+gDNA wiper) Reverse Transcription Kit (Vazyme, Nanjin). <italic>&#x3b2;-actin</italic> was used as an internal reference gene for cellular and viral genes, and expression differences between different samples were calculated by the 2 <sup>-&#x394;&#x394;CT</sup> method, and all data were expressed as relative expression of mRNA.</p>
</sec>
<sec id="s2_8">
<label>2.8</label>
<title>Western blotting</title>
<p>Proteins were extracted from CCO cells with cell lysis buffer, separated by SDS-PAGE gel and then transferred to nitrocellulose membranes (Biosharp, China). Membranes were blocked with 5% skimmed milk in tris-buffered saline (TBST) containing Tween 20 overnight at 4&#xb0;C and then incubated with primary antibodies against <italic>&#x3b2;-actin</italic> (1:10 00) or SHVV protein (1:10 00) for 2&#xa0;h at room temperature. After three washes with TBST, the cells were incubated with HRP-conjugated Affinipure goat anti-rabbit (1:10 000) for 1&#xa0;h at room temperature. The signal intensity was then measured using a BeyoECL Star (Beyotime, Shanghai).</p>
</sec>
<sec id="s2_9">
<label>2.9</label>
<title>Statistical analysis</title>
<p>All statistical analyses were performed using GraphPad Prism 5.0 (GraphPad Software, CA, USA). The statistical significance of the data was determined by Student&#x2019;s t-test, and P&lt;0.05 was considered statistically significant.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Effect of SHVV infection of CCO cells on N and miR-130c-5p expression</title>
<p>A previous study of SHVV-infected miRNAs showed that miR-130c-5p was significantly altered in virus-infected host cells, and therefore, it was selected for the study. In addition, during the study of the SHVV reverse genetic system, CCO cells were found to support efficient SHVV replication. In order to investigate the role of miR-130c-5p in SHVV infection, we chose different infection times (3h, 6h, 12h, 24h) and different infection doses (MOI=0.1, 1, 10, 100) of SHVV to attack the CCO cells, and used qRT-PCR to measure the mRNA expression level of viral N protein. The results showed that the N protein mRNA of SHVV increased significantly at different infection times and doses (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1A, B</bold>
</xref>), indicating that SHVV could indeed replicate effectively in CCO cells. In addition, the level of miR-130c-5p was detected in SHVV infected CCO cells at different infection times and doses. The results showed that miR-130c-5p expression was significantly up-regulated in CCO cells relative to controls from 0&#xa0;h to 24&#xa0;h after viral infection; it was significantly up-regulated with the increase of viral infection dose (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1C, D</bold>
</xref>). These data suggest that SHVV infection caused upregulation of miR-130c-5p expression in CCO cells under certain conditions.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>SHVV infection upregulated miR-130c-5p expression. <bold>(A)</bold> CCO cells were infected with SHVV (MOI=1) and harvested at 3&#xa0;h, 6&#xa0;h, 12&#xa0;h, and 24&#xa0;h. The expression level of viral n gene was detected using qRT-PCR and <italic>&#x3b2;-actin</italic> was used as an internal reference; <bold>(B)</bold> CCO cells were infected with SHVV (MOI=0. 1, 1, 10 and 100), and cells were harvested 24&#xa0;h later using qRT-PCR to detect the expression level of the viral n gene in the cells and the <italic>&#x3b2;-actin</italic> was used as an internal reference. <bold>(C)</bold> CCO cells were infected with SHVV (MOI=1) for 3&#xa0;h, 6&#xa0;h, 12&#xa0;h and 24&#xa0;h later. The expression level of miR-130c-5p in cells was used by qRT-PCR, and the U6 was used as an internal reference; <bold>(D)</bold> CCO cells were infected with SHVV (MOI=0.1, 1, 10, 100) and harvested after 24&#xa0;h. The expression level of miR-130c-5p in cells was measured using qRT-PCR, and the U6 was used as an internal reference. All data represent the results of at least two independent experiments, and each assay was performed in triplicate (mean &#xb1; SD); the same below (*, <italic>p</italic> &lt; 0.05; **, <italic>p</italic> &lt; 0.01; ***, <italic>p</italic> &lt; 0.001).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1486816-g001.tif"/>
</fig>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>MiR-130c-5p inhibits SHVV replication</title>
<p>To determine whether miR-130c-5p is associated with SHVV replication, we transfected CCO cells with synthetic analogs of miR-130c-5p, inhibitors, or the corresponding negative control (NC), respectively, to overexpress or inhibit cytosolic miR-130c-5p, which was subsequently infected by SHVV 24&#xa0;h post-transfection using qRT-PCR to detect the expression level of intracellular miR-130c-5p. Transfection with miR-130c-5p analogs resulted in a highly significant increase in intracellular miR-130c-5p expression levels compared to NC analogs (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>). Transfection of miR-130c-5p inhibitor resulted in a significant down-regulation of intracellular miR-130c-5p expression level compared to NC inhibitor (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>).</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>MiR-130c-5p inhibits SHVV replication. CCO cells were transfected with NC mimic, miR-130c-5p mimic, NC inhibitor, or miR-130c-5p inhibitor for 24&#xa0;h, and the miR-130c-5p expression in CCO cells was measured using qRT-PCR. <bold>(A)</bold> miR-130c-5p analogue and its control; <bold>(B)</bold> miR-130c-5p inhibitor and its control. The U6 was used as an internal control, and all data are the results of at least two independent experiments, and each assay was performed in triplicate (mean &#xb1; SD); the same below (*, <italic>p</italic> &lt; 0.05; ***, <italic>p</italic> &lt; 0.001).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1486816-g002.tif"/>
</fig>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>N of SHVV is a target gene of miR-130c-5p</title>
<p>Based on the &#x201c;seed sequence&#x201d; paired sequence approach to find target genes, we searched for and predicted the miR-130c-5p target gene from the full gene sequence of SHVV (NCBI NO. KP876483) in NCBI (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>). To verify whether the <italic>n</italic> gene was indeed a miR-130c-5p target gene, we performed dual luciferase reporter gene analysis. We transfected CCO cells with the dual-luciferase reporter plasmids pmirGLO-N and pmirGLO-N-MUT and transfected CCO cells with an analogue of miR-130c-5p, an inhibitor of miR-130c-5p, and its control. At 24&#xa0;h post-transfection, the binding of miR-130c-5p to n-gene mRNA target sequences was verified by the dual luciferase reporter system. The results showed that the luciferase activity detected after transfection of miR-130c-5p mimic reduced, whereas miR-130c-5p inhibitor increased the luciferase activity (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3B, C</bold>
</xref>). However, there was no significant change in luciferase activity when miR-130c-5p mimic or inhibitor was cotransfected with plasmids containing mutant sequences in the seed region of miR-130c-5p (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3B, C</bold>
</xref>). These data suggest that the <italic>n</italic> gene of SHVV is indeed a target gene of miR-130c-5p and that the N protein region encodes a target sequence with miR-130c-5p.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>MiR-130c-5p targets the <italic>n</italic> gene of SHVV. <bold>(A)</bold> Base complementary pairing diagram of the predicted targeting sequences in the coding region of <italic>n</italic> mRNA; <bold>(B, C)</bold> CCO cells were co-transfected with miR-130c-5p mimic, miR-130c-5p inhibitor and its control with pmirGLO-N plasmid or PMIRGLO-N-MUT plasmid. The fluorescence intensity of the cells was measured 24 hours after transfection. All the data are representative of at least two independent experiments, with each determination performed in triplicate (mean &#xb1; SD); the same below (*, <italic>p</italic> &lt; 0.05; **, <italic>p</italic> &lt; 0.01; ***, <italic>p</italic>&#xa0;&lt; 0.001).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1486816-g003.tif"/>
</fig>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>MiR-130c-5p reduces mRNA and protein expression levels of SHVV N</title>
<p>To further verify the effect of miR-130c-5p on N protein expression in SHVV, we co-transfected CCO cells with analogs of miR-130c-5p, inhibitors and their controls and the constructed plasmid pCDNA3.1-N, respectively, and 24&#xa0;h after transfection, we detected the mRNA expression of N proteins in the cells by qRT-PCR, and also measured the N protein expression levels by Western blot to determine the expression level of N protein. The results showed that overexpression of miR-130c-5p in CCO cells significantly decreased the N mRNA expression level, and conversely, inhibition of its expression up-regulated N mRNA expression (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>). In addition, overexpression of miR-130c-5p resulted in thinner protein bands of N protein detected by Western blot, and conversely, inhibition of its expression resulted in thicker protein bands (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>). These data suggest that miR-130c-5p can downregulate viral N expression, which will inhibit SHVV replication.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>MiR-130c-5p reduced the mRNA and protein expression of SHVV N. CCO cells were co-transfected with analogues of miR-130c-5p, inhibitors and their controls and the constructed plasmid pCDNA3.1-N for 24&#xa0;h. <bold>(A)</bold> The expression level of <italic>n</italic> mRNA was detected in CCO cells using qRT-PCR, with the <italic>&#x3b2;-actin</italic> as an internal reference. All the data are representative of at least two independent experiments, with each determination performed in triplicate (mean &#xb1; SD); the same below (**, <italic>p</italic> &lt; 0.01; ***, <italic>p</italic> &lt; 0.001); <bold>(B)</bold> The N protein expression level was detected using protein immunoblotting, <italic>&#x3b2;-actin</italic> was used as an internal reference, and the experiment was repeated at least twice.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1486816-g004.tif"/>
</fig>
</sec>
<sec id="s3_5">
<label>3.5</label>
<title>pCDNA3.1-N activates host innate immune responses</title>
<p>Studies have shown that nuclear factor kappa-B (NF-&#x3ba;B) plays an important role in the study of fish immune defense mechanisms as a key regulator targeting a variety of proteins and thus participating in the regulation of host responses (<xref ref-type="bibr" rid="B22">22</xref>, <xref ref-type="bibr" rid="B23">23</xref>). To investigate the role of host immune response regulation in the SHVV infection, we constructed pCDNA3.1-N plasmid to mimic the expression of SHVV nuclear proteins and transfected it into CCO cells. Subsequently, the expression of immune genes related to the NF-&#x3ba;B related signaling pathway, including Nucleotide-oligomerization domain (NOD)-like receptor subfamily C3 (NLRC3), myeloid differentiation factor 88 (MyD88), NF-&#x3ba;B, and a variety of inflammatory cytokines (interleukin-6 (IL-6), interleukin-22 (IL-22), and interleukin-1beta (IL-1&#x3b2;)), was detected using qRT-PCR. The results showed that transfection of the pCDNA3.1-N plasmid significantly promoted the expression of these genes (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A&#x2013;F</bold>
</xref>). This indicated that the simulated expression of SHVV nuclear proteins activated the host&#x2019;s antiviral immune response. The activation of this response is likely to be through the synergistic action of NF-&#x3ba;B mediated related signaling pathways to achieve host cell antiviral defense. In this study, it was known that miR-130c-5p can regulate the expression of nuclear proteins in SHVV, so whether miR-130c-5p is involved in these signaling pathways to affect viral infection and its specific regulatory role would require further investigation.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>pCDNA3.1-N activated the host innate immune response. CCO cells were transfected with pCDNA3.1-N and harvested for 24&#xa0;h after transfection. The mRNA expression levels of NLRC3 <bold>(A)</bold>, MyD88 <bold>(B)</bold>, NF-&#x3ba;B <bold>(C)</bold>, IL-6 <bold>(D)</bold>, IL-22 <bold>(E)</bold> and IL-1&#x3b2; <bold>(F)</bold> were measured using qRT-PCR. The <italic>&#x3b2;-actin</italic> was used as an internal control, and all the data represent the results of at least two independent experiments, and each assay was performed in triplicate (mean &#xb1; SD), the same as below (**, <italic>p</italic> &lt; 0.01; ***, <italic>p</italic> &lt; 0.001).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1486816-g005.tif"/>
</fig>
</sec>
<sec id="s3_6">
<label>3.6</label>
<title>MiR-130c-5p regulates expression of immune factors associated with the NF-&#x3ba;B signaling pathway</title>
<p>Given the established role of miR-130c-5p in regulating SHVV nuclear protein expression, we further investigated whether miR-130c-5p is involved in the NF-&#x3ba;B-mediated related signaling pathway affecting viral infection and its specific regulatory mechanisms. We transfected CCO cells with NC mimic, NC inhibitor, miR-130c-5p mimic or inhibitor and pCDNA3.1-N. Subsequently, the expression levels of NLRC3, MyD88, NF-&#x3ba;B, IL-6, IL-22 and IL-1&#x3b2; were detected. The experimental results showed that transfection of miR-130c-5p mimic significantly up-regulated the expression levels of NLRC3, MyD88, NF-&#x3ba;B, IL-6, IL-22, and IL-1&#x3b2;, which was more pronounced compared to transfection of pCDNA3.1-N alone (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6A&#x2013;L</bold>
</xref>). In contrast, transfection of the miR-130c-5p inhibitor caused the opposite effect. These changes suggest that miR-130c-5p indirectly regulates relevant signaling pathways through these key regulators of immune response, further confirming the specificity of miR-130c-5p&#x2019;s interaction with the <italic>n</italic> gene of SHVV and its role in regulating immune factor expression.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>3.6MiR-130c-5p regulates expression of immune factors associated with the NF-&#x3ba;B signaling pathway. CCO cells were transfected with NC mimic, miR-130c-5p mimic, NC inhibitor, miR-130c-5p inhibitor, and pCDNA3.1-N, respectively. The cells were harvested 24 hours after transfection. The mRNA expression levels of NLRC3 <bold>(A, B)</bold>, MyD88 <bold>(C, D)</bold>, NF-&#x3ba;B <bold>(E, F)</bold>, IL-6 <bold>(G, H)</bold>, IL-22 <bold>(I, J)</bold> and IL-1&#x3b2; <bold>(K, L)</bold> were measured using qRT-PCR. The <italic>&#x3b2;-actin</italic> was used as an internal control, and all the data represent the results of at least two independent experiments, and each assay was performed in triplicate (mean &#xb1; SD), the same as below (*, <italic>p</italic> &lt; 0.05; **, <italic>p</italic> &lt; 0.01; ***, <italic>p</italic> &lt; 0.001).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1486816-g006.tif"/>
</fig>
</sec>
<sec id="s3_7">
<label>3.7</label>
<title>MiR-130c-5p upregulates the expression of immune-related genes in CCO cells</title>
<p>To further investigate the immune regulatory mechanism of miR-130c-5p on SHVV infection after viral infection of CCO cells, we transfected CCO cells with NC mimic, miR-130c-5p mimic, NC inhibitor, and miR-130c-5p inhibitor. Cells were harvested 24&#xa0;h after transfection, and we used qRT-PCR to detect the expression levels of immune-related genes such as NLRC3, MyD88, NF-&#x3ba;B, IL-6, IL-22, and IL-1&#x3b2;. The results showed that overexpression of miR-130c-5p significantly promoted the expression of these immune genes, whereas inhibition of miR-130c-5p resulted in down-regulation of expression (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7A&#x2013;F</bold>
</xref>). This indicated that miR-130c-5p may promote the transcription of NF-&#x3ba;B and various pro-inflammatory mediators through MyD88 and NLRC3 to participate in the relevant signaling pathways to respond to inhibit SHVV replication. In conclusion, overexpression of miR-130c-5p enhances the immune response of the host, which indirectly promotes the clearance of the virus; conversely, inhibition of miR-130c-5p results in a weakening of the host&#x2019;s antiviral immune response.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>The effects of MiR-130c-5p on immune gene expression. CCO cells were transfected with NC mimic, miR-130c-5p mimic, NC inhibitor, and miR-130c-5p inhibitor, respectively, and the cells were harvested 24 hours after transfection. The mRNA expression levels of NLRC3 <bold>(A)</bold>, MyD88 <bold>(B)</bold>, NF-&#x3ba;B <bold>(C)</bold>, IL-6 <bold>(D)</bold>, IL-22 <bold>(E)</bold> and IL-1&#x3b2; <bold>(F)</bold> were measured using qRT-PCR. The <italic>&#x3b2;-actin</italic> was used as an internal control, and all the data represent the results of at least two independent experiments, and each assay was performed in triplicate (mean &#xb1; SD), the same as below (*, <italic>p</italic> &lt; 0.05; ***, <italic>p</italic> &lt; 0.001).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1486816-g007.tif"/>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>A number of studies have confirmed that microRNAs (miRNAs) are not only involved in various biological processes in eukaryotes, such as cell proliferation, development, differentiation and metabolism, and apoptosis, but also play an important regulatory role in the process of viral infection (<xref ref-type="bibr" rid="B24">24</xref>&#x2013;<xref ref-type="bibr" rid="B27">27</xref>). Studies have shown that miRNAs are significantly altered by viral invasion, and this alteration of miRNAs is also closely related to the replication process of the virus and the immune response of the host (<xref ref-type="bibr" rid="B28">28</xref>, <xref ref-type="bibr" rid="B29">29</xref>). For example, <italic>Hepatitis C virus</italic> (HCV) utilizes host cell miRNAs and regulates miRNA expression in infected hepatocytes in order to infect and multiply (<xref ref-type="bibr" rid="B30">30</xref>); <italic>Classical swine fever virus</italic> (CSFV) inhibits the expression of miR-140, which inhibits CSFV replication by binding to the host factor Rab25 (<xref ref-type="bibr" rid="B31">31</xref>); miR-34a and miR-361 inhibit foot-and-mouth disease virus (FMDV) replication by stimulating IFN-&#x3b2; promoter activity and activating the interferon-stimulated response element (ISRE), which in turn activates the PK-15 cellular immune response (<xref ref-type="bibr" rid="B32">32</xref>). In summary, viral infection alters host miRNA expression and, in turn, changes in miRNAs affect viral replication.</p>
<p>Earlier studies show that SHVV infection upregulates the expression of miR-130c-5p (<xref ref-type="bibr" rid="B21">21</xref>). However, the specific mechanism of miR-130c-5p&#x2019;s role in SHVV infection remains poorly understood. In our study, we learned that miR-130c-5p was up-regulated during viral infection and overexpression of miR-130c-5p inhibited viral replication. This suggests that SHVV can replicate efficiently in CCO cells and that the production of miR-130c-5p by CCO may be an antiviral immune response. This result echoes findings in other studies that affect viral replication by regulating miRNA levels (<xref ref-type="bibr" rid="B33">33</xref>&#x2013;<xref ref-type="bibr" rid="B35">35</xref>). Additionally, the results of dual luciferase assay showed that miR-130c-5p, as a novel antiviral factor, could effectively target and regulate the <italic>n</italic> gene to inhibit viral replication, and it could be a potential target for the development of novel therapeutic strategies against SHVV infection. To further verify whether miR-130c-5p plays a role in inhibiting SHVV replication, the experiments were performed by qRT-PCR and Western blot experiments, which concluded that miR-130c-5p indeed exerts an inhibitory effect on viral replication. Similar miRNA-targeted binding to viral genes has been reported. For example, miR-3145 targets the PB1 gene encoding polymerase basic protein 1 to inhibit influenza A virus replication (<xref ref-type="bibr" rid="B36">36</xref>); miR-181a-5p targets the stimulator of interferon genes (STING) to inhibit replication of Fowl adenovirus serotype 4 (FAdV-4) (<xref ref-type="bibr" rid="B37">37</xref>); miR-214 inhibits snakehead vesiculovirus replication by targeting the coding regions of viral N and P (<xref ref-type="bibr" rid="B3">3</xref>). The results that miR-130c-5p affects viral proliferation in host cells by targeting the viral genome are consistent with previous studies, and the ability of miRNAs to inhibit viral replication and infection by down-regulating the expression of key proteins has been demonstrated in several studies (<xref ref-type="bibr" rid="B38">38</xref>). In addition, studies have demonstrated that miRNAs exert their regulatory functions mainly through selective binding to complementary mRNAs, including direct inhibition of protein translation after partial binding of mature miRNAs to transcripts, leading to a decrease in transcription levels; and almost complete binding to transcripts, which affects the stability of viral mRNAs leading to protein degradation (<xref ref-type="bibr" rid="B39">39</xref>). The results of the present experiment are consistent with the latter, that SHVV shows down-regulation of expression at both the gene level and the protein level, and miR-130c-5p is degraded by affecting the stability of SHVV viral mRNA to the viral nucleoprotein. The innate immune response of the host is the first line of defense against microbial infections, and this process is mainly regulated by the NF-&#x3ba;B signaling pathway to activate and promote the expression of relevant immune genes. When viruses invade the host, immune cells rapidly produce key mediators such as interferon (IFN), chemokines, interleukins (IL), and tumor necrosis factor (TNF), thereby initiating antiviral innate immune and inflammatory responses.</p>
<p>Upon viral infection of the host, host immune cells produce mediators of antiviral innate immune and inflammatory responses such as interferon (IFN), chemokines, interleukins (IL) and tumor necrosis factor (TNF) (<xref ref-type="bibr" rid="B40">40</xref>, <xref ref-type="bibr" rid="B41">41</xref>). In turn, the innate immune response, as the first line of host defense against different microorganisms, is mainly regulated by the NF-&#x3ba;B signaling pathway, which promotes the expression of target genes. Meanwhile, NF-&#x3ba;B is a downstream signaling molecule of the Toll-like receptor (TLR) signaling pathway, which plays an important role in the study of immune defense mechanisms in fish (<xref ref-type="bibr" rid="B42">42</xref>, <xref ref-type="bibr" rid="B43">43</xref>). The results of this study revealed that miR-130c-5p and pCDNA3.1-N significantly up-regulated the expression of immune-related genes, such as NLRC3, MyD88, NF-&#x3ba;B, IL-6, IL-22, and IL-1&#x3b2;, in CCO cells. This indicates that miR-130c-5p may promote the expression of immune factors such as IL-6, IL-22, IL-1&#x3b2;, etc., and thus enhance the host immune response by indirectly regulating various signaling pathways such as TLR and NLR associated with these immune genes. Several studies have shown that fish NLRC3, a regulatory NLR, is involved in the regulation of mitogen-activated protein kinase (MAPK), NF-&#x3ba;B, autophagy, and IFN-I signaling pathways, and is involved in the regulation of inflammatory and pro-inflammatory cytokines during immune stimulation (<xref ref-type="bibr" rid="B44">44</xref>, <xref ref-type="bibr" rid="B45">45</xref>). IL-6 and IL-22 are interleukins with a wide range of biological activities, they can promote the proliferation and differentiation of target cells, enhance anti-infective and cell-killing ability, regulate the expression of other cytokines and membrane surface molecules, and mediate immune response, inflammatory response (<xref ref-type="bibr" rid="B46">46</xref>, <xref ref-type="bibr" rid="B47">47</xref>). In addition, miR-130c-5p mimic significantly inhibited SHVV replication infected viruses are recognized by the innate immune system, and TLRs on cells recognize pathogen-associated molecular patterns (PAMPs), which are activated by myeloid differentiation factor 88 (MyD88) to activate NF-&#x3ba;B production of IFN (<xref ref-type="bibr" rid="B48">48</xref>, <xref ref-type="bibr" rid="B49">49</xref>). IFN is secreted extracellularly, binds to other cell surface receptors, and initiates cascade signaling via the Janus tyrosine kinase-signal converter and activator of transcription (JAK-STAT) pathway (<xref ref-type="bibr" rid="B50">50</xref>, <xref ref-type="bibr" rid="B51">51</xref>). IL-6 and IL-22, as inflammatory factors, do not have antiviral activity per se, but can act on target cells through JAK-STAT signaling, which leads to the secretion of interferon-stimulated genes (ISGs) such as antimicrobial peptides (AMPs), serum amyloid A (SAA), beta-defensins (BDs), S100, etc. and contribute to the inflammatory response to defend against viral infections (<xref ref-type="bibr" rid="B52">52</xref>&#x2013;<xref ref-type="bibr" rid="B54">54</xref>). Among them, IL-6 induces the differentiation of B cells and secretion of antibody proteins, and also induces the proliferation and differentiation of cytotoxic T lymphocytes, and together with TNF-&#x3b1; and IL-1&#x3b2; constitutes the first defense barrier of the body&#x2019;s immune response (<xref ref-type="bibr" rid="B55">55</xref>, <xref ref-type="bibr" rid="B56">56</xref>). This demonstrated that miR-130c-5p in this study was not only involved in the increased expression of genes involved in the immune response, but also in the regulation of multiple signaling pathways, such as NF-&#x3ba;B, MyD88, TLR, NLR, and JAK-STAT, to induce enhancement of the viral immune response in the host. Although this study clearly demonstrated that miRNAs can not only influence the strength and effect of immune response by regulating the expression of immune factors, but also inhibit viral replication by directly targeting the genome of viral major structural proteins. However, in order to fully analyze the role of miR-130c-5p in the regulatory network, it is necessary to deeply explore the mechanism of its interactions with immune genes and clarify its direct targets.</p>
<p>In summary, miR-130c-5p directly targets the viral <italic>n</italic> gene to inhibit SHVV replication during SHVV infection of CCO cells. In addition, overexpression of miR-130c-5p would up-regulate the expression of immune-related genes (IL-6, IL-22, and IL-1&#x3b2;) and interfere with viral replication by participating in the regulation of multiple signaling pathways, including NF-&#x3ba;B, MyD88, TLR, NLR, and JAK-STAT (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8</bold>
</xref>). Combining the findings of previous studies with those of the present study, the present study reveals the critical role of miR-130c-5p in virus-host interactions, providing new insights into the mechanism of SHVV infection and searching for potential targets for anti-SHVV drugs.</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Antiviral mechanism of miR-130c-5p for SHVV infection. When SHVV invades cells, miR-130c-5p directly targets the viral n-gene to inhibit its replication; miR-130c-5p can activate TLRs and NLRs signaling pathways, mainly by inducing the expression of MyD88 and NLRC3, activating the NF-&#x3ba;B signaling pathway, up-regulating the key immune factors, such as IL-6, IL-22, and IL-1&#x3b2;, and significantly enhancing the host antiviral immune response; SHVV infection can activate the above signaling pathways to participate in the host antiviral immune response.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1486816-g008.tif"/>
</fig>
</sec>
</body>
<back>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author(s).</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The animal study was approved by School of Animal Science and Nutritional Engineering, Wuhan Polytechnic University. The study was conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>JW: Data curation, Supervision, Writing &#x2013; original draft. YJ: Data curation, Writing &#x2013; original draft. YB: Data curation, Writing &#x2013; original draft. RC: Writing &#x2013; review &amp; editing. JZ: Supervision, Writing &#x2013; review &amp; editing. XH: Supervision, Writing &#x2013; review &amp; editing. CZ: Funding acquisition, Supervision, Writing &#x2013; review &amp; editing.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare financial support was received for the research, authorship, and/or publication of this article. This research was funded by the project of the National Natural Science Foundation of China (NO. 32303068) and the Research Fund for the Doctoral Program of WHPU (NO. 2024RZ033).</p>
</sec>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s11" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hoffmann</surname> <given-names>B</given-names>
</name>
<name>
<surname>Beer</surname> <given-names>M</given-names>
</name>
<name>
<surname>Sch&#xfc;tze</surname> <given-names>H</given-names>
</name>
<name>
<surname>Mettenleiter</surname> <given-names>TC</given-names>
</name>
</person-group>. <article-title>Fish rhabdoviruses: molecular epidemiology and evolution</article-title>. <source>Curr Topics Microbiol Immunol</source>. (<year>2005</year>) <volume>292</volume>:<fpage>81</fpage>&#x2013;<lpage>117</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/3-540-27485-5_5</pub-id>
</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Michael</surname> <given-names>P</given-names>
</name>
<name>
<surname>Panchavarnam</surname> <given-names>S</given-names>
</name>
<name>
<surname>Bagthasingh</surname> <given-names>C</given-names>
</name>
<name>
<surname>Palaniappan</surname> <given-names>S</given-names>
</name>
<name>
<surname>Velu</surname> <given-names>R</given-names>
</name>
<name>
<surname>Mohaideenpitchai</surname> <given-names>MM</given-names>
</name>
<etal/>
</person-group>. <article-title>Innate immune response of snakehead fish to Indian strain of snakehead rhabdovirus (SHRV-In) infection and the infectivity potential of the virus to other freshwater fishes</article-title>. <source>Fish shellfish Immunol</source>. (<year>2024</year>) <volume>149</volume>:<elocation-id>109577</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fsi.2024.109577</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>C</given-names>
</name>
<name>
<surname>Yi</surname> <given-names>L</given-names>
</name>
<name>
<surname>Feng</surname> <given-names>S</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Su</surname> <given-names>J</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>MicroRNA miR-214 inhibits snakehead vesiculovirus replication by targeting the coding regions of viral N and P</article-title>. <source>J Gen virology</source>. (<year>2017</year>) <volume>98</volume>:<page-range>1611&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1099/jgv.0.000854</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bhella</surname> <given-names>D</given-names>
</name>
</person-group>. <article-title>Virus proteins and nucleoproteins: an overview</article-title>. <source>Sub-cellular Biochem</source>. (<year>2018</year>) <volume>88</volume>:<fpage>1</fpage>&#x2013;<lpage>18</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/978-981-10-8456-0_1</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>GF</given-names>
</name>
<name>
<surname>Tien</surname> <given-names>P</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>W</given-names>
</name>
</person-group>. <article-title>Bunyavirales ribonucleoproteins: the viral replication and transcription machinery</article-title>. <source>Crit Rev Microbiol</source>. (<year>2018</year>) <volume>44</volume>:<page-range>522&#x2013;40</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/1040841x.2018.1446901</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname> <given-names>D</given-names>
</name>
<name>
<surname>Cheng</surname> <given-names>R</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>C</given-names>
</name>
</person-group>. <article-title>Leader RNA facilitates snakehead vesiculovirus (SHVV) replication by interacting with CSDE1 and hnRNP A3</article-title>. <source>Fish shellfish Immunol</source>. (<year>2024</year>) <volume>154</volume>:<elocation-id>109930</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fsi.2024.109930</pub-id>
</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>da Cruz</surname> <given-names>FW</given-names>
</name>
<name>
<surname>McBride</surname> <given-names>AJ</given-names>
</name>
<name>
<surname>Concei&#xe7;&#xe3;o</surname> <given-names>FR</given-names>
</name>
<name>
<surname>Dale</surname> <given-names>JW</given-names>
</name>
<name>
<surname>McFadden</surname> <given-names>J</given-names>
</name>
<name>
<surname>Dellagostin</surname> <given-names>OA</given-names>
</name>
</person-group>. <article-title>Expression of the B-cell and T-cell epitopes of the rabies virus nucleoprotein in Mycobacterium bovis BCG and induction of an humoral response in mice</article-title>. <source>Vaccine</source>. (<year>2001</year>) <volume>20</volume>:<page-range>731&#x2013;6</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/s0264-410x(01)00414-5</pub-id>
</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Scher</surname> <given-names>G</given-names>
</name>
<name>
<surname>Schnell</surname> <given-names>MJ</given-names>
</name>
</person-group>. <article-title>Rhabdoviruses as vectors for vaccines and therapeutics</article-title>. <source>Curr Opin virology</source>. (<year>2020</year>) <volume>44</volume>:<page-range>169&#x2013;82</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.coviro.2020.09.003</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Purcell</surname> <given-names>MK</given-names>
</name>
<name>
<surname>Laing</surname> <given-names>KJ</given-names>
</name>
<name>
<surname>Winton</surname> <given-names>JR</given-names>
</name>
</person-group>. <article-title>Immunity to fish rhabdoviruses</article-title>. <source>Viruses</source>. (<year>2012</year>) <volume>4</volume>:<page-range>140&#x2013;66</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/v4010140</pub-id>
</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lucas</surname> <given-names>K</given-names>
</name>
<name>
<surname>Raikhel</surname> <given-names>AS</given-names>
</name>
</person-group>. <article-title>Insect microRNAs: biogenesis, expression profiling and biological functions</article-title>. <source>Insect Biochem Mol Biol</source>. (<year>2013</year>) <volume>43</volume>:<fpage>24</fpage>&#x2013;<lpage>38</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ibmb.2012.10.009</pub-id>
</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gong</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Ju</surname> <given-names>C</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X</given-names>
</name>
</person-group>. <article-title>Shrimp miR-1000 Functions in Antiviral Immunity by Simultaneously Triggering the Degradation of Two Viral mRNAs</article-title>. <source>Front Immunol</source>. (<year>2018</year>) <volume>9</volume>:<elocation-id>2999</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2018.02999</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X</given-names>
</name>
<etal/>
</person-group>. <article-title>gga-miR-1603 and gga-miR-1794 directly target viral L gene and function as a broad-spectrum antiviral factor against NDV replication</article-title>. <source>Virulence</source>. (<year>2021</year>) <volume>12</volume>:<fpage>45</fpage>&#x2013;<lpage>56</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/21505594.2020.1864136</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fan</surname> <given-names>H</given-names>
</name>
<name>
<surname>Lv</surname> <given-names>P</given-names>
</name>
<name>
<surname>Lv</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>X</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>M</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>G</given-names>
</name>
<etal/>
</person-group>. <article-title>miR-370 suppresses HBV gene expression and replication by targeting nuclear factor IA</article-title>. <source>J Med Virol</source>. (<year>2017</year>) <volume>89</volume>:<page-range>834&#x2013;44</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/jmv.24695</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bessaid</surname> <given-names>M</given-names>
</name>
<name>
<surname>Kwak</surname> <given-names>JS</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>KH</given-names>
</name>
</person-group>. <article-title>Generation of recombinant snakehead rhabdovirus (SHRV) expressing artificial microRNA targeting spring viremia of carp virus (SVCV) P gene and <italic>in vivo</italic> therapeutic use against SVCV infection</article-title>. <source>Mar Biotechnol (New York N.Y.)</source>. (<year>2023</year>) <volume>25</volume>:<page-range>1076&#x2013;84</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10126-023-10260-1</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Quinn</surname> <given-names>SR</given-names>
</name>
<name>
<surname>O'Neill</surname> <given-names>LA</given-names>
</name>
</person-group>. <article-title>The role of microRNAs in the control and mechanism of action of IL-10</article-title>. <source>Curr topics Microbiol Immunol</source>. (<year>2014</year>) <volume>380</volume>:<page-range>145&#x2013;55</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/978-3-662-43492-5_7</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lou</surname> <given-names>W</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>L</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Oncolytic adenovirus co-expressing miRNA-34a and IL-24 induces superior antitumor activity in experimental tumor model</article-title>. <source>J Mol Med (Berlin Germany)</source>. (<year>2013</year>) <volume>91</volume>:<page-range>715&#x2013;25</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00109-012-0985-x</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo</surname> <given-names>W</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>J</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>S</given-names>
</name>
<name>
<surname>You</surname> <given-names>W</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Nanoparticle delivery of miR-21-3p sensitizes melanoma to anti-PD-1 immunotherapy by promoting ferroptosis</article-title>. <source>J immunotherapy Cancer</source>. (<year>2022</year>) <volume>10</volume>:<elocation-id>e004381</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1136/jitc-2021-004381</pub-id>
</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>N</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>W</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Li</surname> <given-names>K</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>RNA-seq revealed a circular RNA-microRNA-mRNA regulatory network in hantaan virus infection</article-title>. <source>Front Cell infection Microbiol</source>. (<year>2020</year>) <volume>10</volume>:<elocation-id>97</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fcimb.2020.00097</pub-id>
</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname> <given-names>L</given-names>
</name>
<name>
<surname>Sarath Babu</surname> <given-names>V</given-names>
</name>
<name>
<surname>Qin</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Su</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>C</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>F</given-names>
</name>
<etal/>
</person-group>. <article-title>Snakehead vesiculovirus (SHVV) infection alters striped snakehead (Ophicephalus striatus) cells (SSN-1) glutamine metabolism and apoptosis pathways</article-title>. <source>Fish shellfish Immunol</source>. (<year>2020</year>) <volume>102</volume>:<fpage>36</fpage>&#x2013;<lpage>46</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fsi.2020.04.018</pub-id>
</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Feng</surname> <given-names>S</given-names>
</name>
<name>
<surname>Su</surname> <given-names>J</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>L</given-names>
</name>
<name>
<surname>Tu</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Development of a reverse genetics system for snakehead vesiculovirus (SHVV)</article-title>. <source>Virology</source>. (<year>2019</year>) <volume>526</volume>:<page-range>32&#x2013;7</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.virol.2018.10.002</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Tu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>J</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>L</given-names>
</name>
<name>
<surname>Dawar</surname> <given-names>FU</given-names>
</name>
<etal/>
</person-group>. <article-title>Identification and characterization of microRNAs in snakehead fish cell line upon snakehead fish vesiculovirus infection</article-title>. <source>Int J Mol Sci</source>. (<year>2016</year>) <volume>17</volume>:<fpage>154</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms17020154</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>B</given-names>
</name>
<name>
<surname>Li</surname> <given-names>X</given-names>
</name>
<name>
<surname>Li</surname> <given-names>G</given-names>
</name>
<name>
<surname>Wen</surname> <given-names>H</given-names>
</name>
<name>
<surname>Qi</surname> <given-names>X</given-names>
</name>
<etal/>
</person-group>. <article-title>Immune correlates of NF-&#x3ba;B and TNF&#x3b1; promoter DNA methylation in Japanese flounder (Paralichthys olivaceus) muscle and immune parameters change response to vibrio Anguillarum infection</article-title>. <source>Fish Shellfish Immunol</source>. (<year>2021</year>) <volume>119</volume>:<page-range>578&#x2013;86</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fsi.2021.10.007</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wei</surname> <given-names>X</given-names>
</name>
<name>
<surname>Li</surname> <given-names>C</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Li</surname> <given-names>K</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J</given-names>
</name>
<name>
<surname>Ai</surname> <given-names>K</given-names>
</name>
<etal/>
</person-group>. <article-title>Fish NF-&#x3ba;B couples TCR and IL-17 signals to regulate ancestral T-cell immune response against bacterial infection</article-title>. <source>FASEB journal: Off Publ Fed Am Societies Exp Biol</source>. (<year>2021</year>) <volume>35</volume>:<fpage>e21457</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1096/fj.202002393RR</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Su</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>T</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>C</given-names>
</name>
<name>
<surname>Cheng</surname> <given-names>C</given-names>
</name>
<name>
<surname>Han</surname> <given-names>X</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>X</given-names>
</name>
</person-group>. <article-title>microRNAs, the link between dengue virus and the host genome</article-title>. <source>Front Microbiol</source>. (<year>2021</year>) <volume>12</volume>:<elocation-id>714409</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmicb.2021.714409</pub-id>
</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bernier</surname> <given-names>A</given-names>
</name>
<name>
<surname>Sagan</surname> <given-names>SM</given-names>
</name>
</person-group>. <article-title>The Diverse Roles of microRNAs at the Host-Virus Interface</article-title>. <source>Viruses</source>. (<year>2018</year>) <volume>10</volume>:<fpage>440</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/v10080440</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Umbach</surname> <given-names>JL</given-names>
</name>
<name>
<surname>Cullen</surname> <given-names>BR</given-names>
</name>
</person-group>. <article-title>The role of RNAi and microRNAs in animal virus replication and antiviral immunity</article-title>. <source>Genes Dev</source>. (<year>2009</year>) <volume>23</volume>:<page-range>1151&#x2013;64</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1101/gad.1793309</pub-id>
</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nair</surname> <given-names>V</given-names>
</name>
<name>
<surname>Zavolan</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Virus-encoded microRNAs: novel regulators of gene expression</article-title>. <source>Trends Microbiol</source>. (<year>2006</year>) <volume>14</volume>:<page-range>169&#x2013;75</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.tim.2006.02.007</pub-id>
</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yao</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>G</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>X</given-names>
</name>
<name>
<surname>Shang</surname> <given-names>H</given-names>
</name>
<name>
<surname>Li</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>Action mechanisms and characteristics of miRNAs to regulate virus replication</article-title>. <source>Virology</source>. (<year>2024</year>) <volume>590</volume>:<elocation-id>109966</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.virol.2023.109966</pub-id>
</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kenney</surname> <given-names>AD</given-names>
</name>
<name>
<surname>Aron</surname> <given-names>SL</given-names>
</name>
<name>
<surname>Gilbert</surname> <given-names>C</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>N</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>P</given-names>
</name>
<name>
<surname>Eddy</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>Influenza virus replication in cardiomyocytes drives heart dysfunction and fibrosis</article-title>. <source>Sci Adv</source>. (<year>2022</year>) <volume>8</volume>:<elocation-id>eabm5371</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/sciadv.abm5371</pub-id>
</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname> <given-names>CH</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>JH</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>SW</given-names>
</name>
</person-group>. <article-title>The role of microRNAs in hepatitis C virus replication and related liver diseases</article-title>. <source>J Microbiol (Seoul Korea)</source>. (<year>2014</year>) <volume>52</volume>:<page-range>445&#x2013;51</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s12275-014-4267-x</pub-id>
</citation>
</ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname> <given-names>P</given-names>
</name>
<name>
<surname>Jia</surname> <given-names>S</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>K</given-names>
</name>
<name>
<surname>Fan</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Zheng</surname> <given-names>H</given-names>
</name>
<name>
<surname>Lv</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>MiR-140 inhibits classical swine fever virus replication by targeting Rab25 in swine umbilical vein endothelial cells</article-title>. <source>Virulence</source>. (<year>2020</year>) <volume>11</volume>:<page-range>260&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/21505594.2020.1735051</pub-id>
</citation>
</ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gao</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Yong</surname> <given-names>F</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>M</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>X</given-names>
</name>
</person-group>. <article-title>MiR-361 and miR-34a suppress foot-and-mouth disease virus proliferation by activating immune response signaling in PK-15 cells</article-title>. <source>Veterinary Microbiol</source>. (<year>2023</year>) <volume>280</volume>:<elocation-id>109725</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.vetmic.2023.109725</pub-id>
</citation>
</ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mirzaei</surname> <given-names>R</given-names>
</name>
<name>
<surname>Karampoor</surname> <given-names>S</given-names>
</name>
<name>
<surname>Korotkova</surname> <given-names>NL</given-names>
</name>
</person-group>. <article-title>The emerging role of miRNA-122 in infectious diseases: Mechanisms and potential biomarkers</article-title>. <source>Pathology Res practice</source>. (<year>2023</year>) <volume>249</volume>:<elocation-id>154725</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.prp.2023.154725</pub-id>
</citation>
</ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>You</surname> <given-names>X</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>M</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Li</surname> <given-names>H</given-names>
</name>
<name>
<surname>Qu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>X</given-names>
</name>
<etal/>
</person-group>. <article-title>miRNA let-7 family regulated by NEAT1 and ARID3A/NF-&#x3ba;B inhibits PRRSV-2 replication in <italic>vitro</italic> and in vivo</article-title>. <source>PloS Pathog</source>. (<year>2022</year>) <volume>18</volume>:<elocation-id>e1010820</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.ppat.1010820</pub-id>
</citation>
</ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Trobaugh</surname> <given-names>DW</given-names>
</name>
<name>
<surname>Klimstra</surname> <given-names>WB</given-names>
</name>
</person-group>. <article-title>MicroRNA regulation of RNA virus replication and pathogenesis</article-title>. <source>Trends Mol Med</source>. (<year>2017</year>) <volume>23</volume>:<fpage>80</fpage>&#x2013;<lpage>93</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.molmed.2016.11.003</pub-id>
</citation>
</ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khongnomnan</surname> <given-names>K</given-names>
</name>
<name>
<surname>Makkoch</surname> <given-names>J</given-names>
</name>
<name>
<surname>Poomipak</surname> <given-names>W</given-names>
</name>
<name>
<surname>Poovorawan</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Payungporn</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Human miR-3145 inhibits influenza A viruses replication by targeting and silencing viral PB1 gene</article-title>. <source>Exp Biol Med (Maywood N.J.)</source>. (<year>2015</year>) <volume>240</volume>:<page-range>1630&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1177/1535370215589051</pub-id>
</citation>
</ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yin</surname> <given-names>D</given-names>
</name>
<name>
<surname>Shao</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>K</given-names>
</name>
<name>
<surname>Tu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Song</surname> <given-names>X</given-names>
</name>
<name>
<surname>Qi</surname> <given-names>K</given-names>
</name>
<etal/>
</person-group>. <article-title>Fowl adenovirus serotype 4 uses gga-miR-181a-5p expression to facilitate viral replication via targeting of STING</article-title>. <source>Veterinary Microbiol</source>. (<year>2021</year>) <volume>263</volume>:<elocation-id>109276</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.vetmic.2021.109276</pub-id>
</citation>
</ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>C</given-names>
</name>
<name>
<surname>Li</surname> <given-names>N</given-names>
</name>
<name>
<surname>Fu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>L</given-names>
</name>
<name>
<surname>Tu</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>MiR-214 inhibits snakehead vesiculovirus (SHVV) replication by targeting host GS</article-title>. <source>Fish shellfish Immunol</source>. (<year>2019</year>) <volume>84</volume>:<fpage>299</fpage>&#x2013;<lpage>303</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fsi.2018.10.028</pub-id>
</citation>
</ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bushati</surname> <given-names>N</given-names>
</name>
<name>
<surname>Cohen</surname> <given-names>SM</given-names>
</name>
</person-group>. <article-title>microRNA functions</article-title>. <source>Annu Rev Cell Dev Biol</source>. (<year>2007</year>) <volume>23</volume>:<fpage>175</fpage>&#x2013;<lpage>205</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1146/annurev.cellbio.23.090506.123406</pub-id>
</citation>
</ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ramasamy</surname> <given-names>S</given-names>
</name>
<name>
<surname>Subbian</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Critical determinants of cytokine storm and type I interferon response in COVID-19 pathogenesis</article-title>. <source>Clin Microbiol Rev</source>. (<year>2021</year>) <volume>34</volume>:<elocation-id>e00299-20</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/cmr.00299-20</pub-id>
</citation>
</ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tripathy</surname> <given-names>AS</given-names>
</name>
<name>
<surname>Vishwakarma</surname> <given-names>S</given-names>
</name>
<name>
<surname>Trimbake</surname> <given-names>D</given-names>
</name>
<name>
<surname>Gurav</surname> <given-names>YK</given-names>
</name>
<name>
<surname>Potdar</surname> <given-names>VA</given-names>
</name>
<name>
<surname>Mokashi</surname> <given-names>ND</given-names>
</name>
<etal/>
</person-group>. <article-title>Pro-inflammatory CXCL-10, TNF-&#x3b1;, IL-1&#x3b2;, and IL-6: biomarkers of SARS-CoV-2 infection</article-title>. <source>Arch virology</source>. (<year>2021</year>) <volume>166</volume>:<page-range>3301&#x2013;10</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00705-021-05247-z</pub-id>
</citation>
</ref>
<ref id="B42">
<label>42</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kawai</surname> <given-names>T</given-names>
</name>
<name>
<surname>Akira</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Toll-like receptor and RIG-I-like receptor signaling</article-title>. <source>Ann New York Acad Sci</source>. (<year>2008</year>) <volume>1143</volume>:<fpage>1</fpage>&#x2013;<lpage>20</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1196/annals.1443.020</pub-id>
</citation>
</ref>
<ref id="B43">
<label>43</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kawai</surname> <given-names>T</given-names>
</name>
<name>
<surname>Akira</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Signaling to NF-kappaB by toll-like receptors</article-title>. <source>Trends Mol Med</source>. (<year>2007</year>) <volume>13</volume>:<page-range>460&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.molmed.2007.09.002</pub-id>
</citation>
</ref>
<ref id="B44">
<label>44</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chang</surname> <given-names>MX</given-names>
</name>
<name>
<surname>Xiong</surname> <given-names>F</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>XM</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>YW</given-names>
</name>
</person-group>. <article-title>The expanding and function of NLRC3 or NLRC3-like in teleost fish: Recent advances and novel insights</article-title>. <source>Dev Comp Immunol</source>. (<year>2021</year>) <volume>114</volume>:<elocation-id>103859</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.dci.2020.103859</pub-id>
</citation>
</ref>
<ref id="B45">
<label>45</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Krishnan</surname> <given-names>R</given-names>
</name>
<name>
<surname>Rajendran</surname> <given-names>R</given-names>
</name>
<name>
<surname>Jang</surname> <given-names>YS</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>JO</given-names>
</name>
<name>
<surname>Yoon</surname> <given-names>SY</given-names>
</name>
<name>
<surname>Oh</surname> <given-names>MJ</given-names>
</name>
</person-group>. <article-title>NLRC3 attenuates antiviral immunity and activates inflammasome responses in primary grouper brain cells following nervous necrosis virus infection</article-title>. <source>Fish Shellfish Immunol</source>. (<year>2022</year>) <volume>127</volume>:<page-range>219&#x2013;27</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fsi.2022.06.026</pub-id>
</citation>
</ref>
<ref id="B46">
<label>46</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Chu</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L</given-names>
</name>
</person-group>. <article-title>The novel fish miRNA, Soc-miR-118, functions as a negative regulator in NF-&#x3ba;B-mediated inflammation by targeting IL-6 in teleost fish</article-title>. <source>Int J Biol macromolecules</source>. (<year>2024</year>) <volume>269</volume>:<elocation-id>132100</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ijbiomac.2024.132100</pub-id>
</citation>
</ref>
<ref id="B47">
<label>47</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jin</surname> <given-names>RM</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>HZ</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>YY</given-names>
</name>
<name>
<surname>Fu</surname> <given-names>HC</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Z</given-names>
</name>
<etal/>
</person-group>. <article-title>Characterization of mandarin fish (Siniperca chuatsi) IL-6 and IL-6 signal transducer and the association between their SNPs and resistance to ISKNV disease</article-title>. <source>Fish shellfish Immunol</source>. (<year>2021</year>) <volume>113</volume>:<page-range>139&#x2013;47</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fsi.2021.04.003</pub-id>
</citation>
</ref>
<ref id="B48">
<label>48</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tuladhar</surname> <given-names>S</given-names>
</name>
<name>
<surname>Kanneganti</surname> <given-names>TD</given-names>
</name>
</person-group>. <article-title>NLRP12 in innate immunity and inflammation</article-title>. <source>Mol aspects Med</source>. (<year>2020</year>) <volume>76</volume>:<elocation-id>100887</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.mam.2020.100887</pub-id>
</citation>
</ref>
<ref id="B49">
<label>49</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yamamoto</surname> <given-names>M</given-names>
</name>
<name>
<surname>Sato</surname> <given-names>S</given-names>
</name>
<name>
<surname>Hemmi</surname> <given-names>H</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Malcolm</surname> <given-names>KC</given-names>
</name>
<name>
<surname>Yamamoto</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Role of adaptor TRIF in the MyD88-independent toll-like receptor signaling pathway</article-title>. <source>Sci (New York N.Y.)</source>. (<year>2003</year>) <volume>301</volume>:<page-range>640&#x2013;3</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/science.1087262</pub-id>
</citation>
</ref>
<ref id="B50">
<label>50</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Darnell</surname> <given-names>JE</given-names>
<suffix>Jr.</suffix>
</name>
<name>
<surname>Kerr</surname> <given-names>IM</given-names>
</name>
<name>
<surname>Stark</surname> <given-names>GR</given-names>
</name>
</person-group>. <article-title>Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins</article-title>. <source>Sci (New York N.Y.)</source>. (<year>1994</year>) <volume>264</volume>:<page-range>1415&#x2013;21</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/science.8197455</pub-id>
</citation>
</ref>
<ref id="B51">
<label>51</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Raftery</surname> <given-names>N</given-names>
</name>
<name>
<surname>Stevenson</surname> <given-names>NJ</given-names>
</name>
</person-group>. <article-title>Advances in anti-viral immune defence: revealing the importance of the IFN JAK/STAT pathway</article-title>. <source>Cell Mol Life sciences: CMLS</source>. (<year>2017</year>) <volume>74</volume>:<page-range>2525&#x2013;35</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00018-017-2520-2</pub-id>
</citation>
</ref>
<ref id="B52">
<label>52</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Philip</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Vijayan</surname> <given-names>MM</given-names>
</name>
</person-group>. <article-title>Stress-immune-growth interactions: cortisol modulates suppressors of cytokine signaling and JAK/STAT pathway in rainbow trout liver</article-title>. <source>PloS One</source>. (<year>2015</year>) <volume>10</volume>:<elocation-id>e0129299</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0129299</pub-id>
</citation>
</ref>
<ref id="B53">
<label>53</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Li</surname> <given-names>L</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>G</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>L</given-names>
</name>
<name>
<surname>Pei</surname> <given-names>C</given-names>
</name>
<name>
<surname>Hou</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>Interleukin (IL)-22 in common carp (Cyprinus carpio L.): Immune modulation, antibacterial defense, and activation of the JAK-STAT signaling pathway</article-title>. <source>Fish shellfish Immunol</source>. (<year>2022</year>) <volume>131</volume>:<fpage>796</fpage>&#x2013;<lpage>808</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fsi.2022.10.051</pub-id>
</citation>
</ref>
<ref id="B54">
<label>54</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Costa</surname> <given-names>MM</given-names>
</name>
<name>
<surname>Saraceni</surname> <given-names>PR</given-names>
</name>
<name>
<surname>Forn-Cun&#xed;</surname> <given-names>G</given-names>
</name>
<name>
<surname>Dios</surname> <given-names>S</given-names>
</name>
<name>
<surname>Romero</surname> <given-names>A</given-names>
</name>
<name>
<surname>Figueras</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>IL-22 is a key player in the regulation of inflammation in fish and involves innate immune cells and PI3K signaling</article-title>. <source>Dev Comp Immunol</source>. (<year>2013</year>) <volume>41</volume>:<page-range>746&#x2013;55</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.dci.2013.08.021</pub-id>
</citation>
</ref>
<ref id="B55">
<label>55</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Varela</surname> <given-names>M</given-names>
</name>
<name>
<surname>Dios</surname> <given-names>S</given-names>
</name>
<name>
<surname>Novoa</surname> <given-names>B</given-names>
</name>
<name>
<surname>Figueras</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>Characterisation, expression and ontogeny of interleukin-6 and its receptors in zebrafish (Danio rerio)</article-title>. <source>Dev Comp Immunol</source>. (<year>2012</year>) <volume>37</volume>:<fpage>97</fpage>&#x2013;<lpage>106</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.dci.2011.11.004</pub-id>
</citation>
</ref>
<ref id="B56">
<label>56</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname> <given-names>C</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>R</given-names>
</name>
<name>
<surname>Qian</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>J</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>H</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X</given-names>
</name>
</person-group>. <article-title>Triclosan induced zebrafish immunotoxicity by targeting miR-19a and its gene socs3b to activate IL-6/STAT3 signaling pathway</article-title>. <source>Sci Total Environ</source>. (<year>2022</year>) <volume>815</volume>:<elocation-id>152916</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.scitotenv.2022.152916</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>