In this study, all procedures were approved by the Institutional Review Committee of Juntendo University (approval numbers 2023130, 2022100, 2021189, and 2020129). C57BL/6 and BALB/c mice were purchased from Sankyo Labo Service Corporation (Tokyo, Japan). MRGPRX2-KI mice and Mrgprb2-KO mice were generated on a C57BL/6 background were generated (TransGenic Inc., Kobe, Japan). Both mice were backcrossed to a BALB/c background for eight generations. The mice (age: 6-10 weeks) were used for subsequent experiments.

Ciprofloxacin and icatibant were purchased from Sigma-Aldrich (St. Louis, MO). Phenol-soluble modulin α3 (PSMα3; MEFVAKLFKFFKDLLGKFLGNN) was synthesized from GL Biochem (Shanghai, China). Dermatophagoides pteronyssinus (Der p) extract was purchased from Greer Laboratories (Lenoir, NC, USA). Enzyme-linked immuno-sorbent assay (ELISA) kits to measure leukotriene B4 (LTB4) (R&D Systems, Minneapolis, MN), cysteinyl LTs (Cayman Chemical Company, MI), histamine (MBL, Tokyo, Japan), serotonin (immuSmol, Bordeaux, France), mouse tryptase beta 2 [mouse mast cell protease 6 (mMCPT6)] (CusaBio, Houston, TX), mMCPT4 (AVIVA System Biology, Sandiego, CA), and human chymase (R&D Systems). Mouse interleukin-3 (IL-3), mouse stem cell factor (SCF), human SCF, mMCPT1, and mMCPT6 were purchased from R&D Systems. mMCPT4 was from CusaBio. 2,4-dinitrophenyl (DNP)-human serum albumin (HSA) and 2,4,6-trinitrophenyl (TNP)-bovine serum albumin (BSA) was from Sigma-Aldrich (St. Louis, MO) and Biosearch Technologies (Lystrup, Denmark), respectively. Compound 48/80 and capsaicin (Sigma-Aldrich, St Louis, MO), SP (Peptide Institute, Inc., Osaka, Japan), Cetirizine (TCI AMERICA, Portland, OR), TY-51469 (MedChemExpress, Monmouth Junction, NJ), RWJ-56110 (Tocris Bioscience, Ellisville, MO), AZ3451, I-191, AMG-517 (Selleck Chemicals LLC), AMG-9810 (Cayman Chemical, Ann Arbor, MI), DAPI (4’,6-diamidino-2-phenylindole) (FujifilmWako, Osaka, Japan), and Piperine (TCI, Tokyo, Japan) were used. Anti-SP and normal rabbit serum were purchased from Sigma-Aldrich. Anti-DNP IgE (H1-ε-26) and anti-TNP IgE (BD Biosciences, San Jose, CA) were used. All the following antibodies (Abs) were purchased from BioLegend (San Diego, CA): fluorescein isothiocyanate (FITC)-conjugated anti-mouse FcεRIα, anti-mouse CD3, anti-mouse CD4, anti-mouse CD8, anti-mouse CD11b, anti-mouse CD11c, anti-mouse CD19, anti-mouse/human B220, anti-mouse Gr-1, anti-Ly-6G, anti-mouse epithelial cell adhesion molecule (EpCAM), anti-mouse NK1.1, and anti-mouse Ter119, allophycocyanin (APC)-conjugated anti-mouse CD63, anti-human CD63, anti-human MRGPRX2, and mouse IgG2b, phycoerythrin (PE)-conjugated anti-human MRGPRX2 and mouse IgG2b, APC-cyanine 7 (Cy7)-conjugated anti-mouse CD45, PE-Cy7-conjugated anti-mouse FcεRIα, peridinin chlorophyll protein (PerCP)-Cy5.5-conjugated anti-mouse CD11b, and Brilliant Violet 421 (BV421)-conjugated-anti-mouse c-Kit.

BMMCs and PMCs were generated as previously described (24, 28). Briefly, BM cells from mice were cultured in the Roswell Park Memorial Institute (RPMI)-1640 medium containing 10% fetal calf serum (FCS) and 10 ng/mL recombinant mouse IL-3 for five weeks to generate BMMCs. To collect the peritoneal cells, mice were intraperitoneally injected with phosphate-buffered saline (PBS) supplemented with 2% FCS. Peritoneal cells were cultured for 10 days in Iscove’s modified Dulbecco’s medium (IMDM) containing 10% FCS, 10 ng/mL recombinant mouse IL-3, and 10 ng/mL recombinant mouse SCF to collect floating cells as PMCs. DRG cells were prepared as previously described (26, 27, 29). Briefly, DRG neurons were isolated from all spinal levels in mice, and incubated with Hanks’ balanced salt solution (HBSS) (Thermo Fisher Scientific, Waltham, MA) supplemented with 5 ng/mL dispase II (FujifilmWako), and 1 mg/mL collagenase Type I (Worthington, Lakewood, NJ) at 37°C for 20 min. After mechanically agitation, the DRG cells were filtered through cell strainers. The dissociated cells were spun at 300g for 5 min, resuspended with Dulbeccos Modification of Eagles Medium (DMEM)/Ham’s F-12 (FujifilmWako), plus 10% fetal bovine serum (FBS), and cultured on 96-well plates coated with poly-D-lysine and laminin at 37°C for 2 h. After discarding the supernatant, DRG cells were cultured in Neurobasal Plus medium (Thermo Fisher Scientific) supplemented with GlutaMAX-I (100x) (Gibco), CultureOne Supplement (100x) (Gibco), B-27 Plus Supplement (50x) (Gibco),50 ng/mL glial cell-line derived neurotrophic factor (GDNF) (BioLegend), and 50 ng/mL nerve growth factor (NGF) (BioLegend) at 37°C for 7 days before experiments. The human mast cell line LAD2 was maintained in StemPro-34 serum-free media (SFM) (Life Technologies) in the presence of 100 ng/mL recombinant human SCF (24).

Mice were intradermally injected with the indicated amounts of 20 or 100 ng of compound 48/80, 5 or 40 μg ciprofloxacin, 1.75 μg icatibant, 3, 8, or 25 pmol SP, 1 or 10 μg Der p extract, 0.2 or 2 μg PSMα3, 200 ng MCPT4, and 100 μg histamine or PBS in each ear just before intravenous injection with 0.5% Evans blue dye (Sigma, St Louis, MO). Alternatively, mice were intradermally injected with 50 ng anti-DNP IgE (H1-ϵ-26) in each ear 24 h before intravenously injection with 0.5% Evans blue dye containing 250 μg DNP-HSA. In any case, 30 min after an intravenous injection of dye, the removed and finely cut ear tissues were incubated in 0.5 mL of 1N KOH overnight at 37°C with shaking. Then, 0.25 mL of 1N phosphoric acid and 0.65 mL of acetone were added to the collected supernatant. After centrifugation at 700 g for 15 min, 0.3 mL of the supernatant was added to a 96-well microplate. To evaluate the extravasated dye amount, the absorbance was measured at 620 nm using a 96-well microplate luminometer, as previously described (24, 28, 30). In some experiments, 15 μl of anti-SP serum or control serum together with 40 μg ciprofloxacin, 10 μg Der p extract, 2 μg PSMα3, 200 ng mMCPT4, 100 μg histamine, or 50 ng anti-DNP IgE was injected intradermally into each ear of the mice. Six hundred μg cetirizine or 50 μg TY-51469 was intraperitoneally injected 0.5 or 2 h before an intradermal injection of 25 pmol SP, 40 μg ciprofloxacin, 2 μg PSMα3, 250 μg TNP-HSA, or vehicle in each ear of the mice. Alternatively, WT, Mrgprb2-KO, and MRGPRX2-KI mice were orally administered with 20 μg of AMG517 or vehicle. After 7 min, these mice were intradermally injected with 2 μg PSMα3 in each ear immediately before intravenous injection of 0.5% Evans blue dye. After 10 min, the amount of extravasated dye was measured as described above.

BMMC, PMC, or LAD2 cells were stimulated with the indicated concentrations of compound 48/80, SP, Der p extract, or PSMα3, 10 μg/mL ciprofloxacin, or 10 μM icatibant, for 30 min in Tyrode’s buffer (112 mM NaCl, 2.7 mM KCl, 0.4 mM NaH₂PO₄, 1.6 mM CaCl₂, 1.0 mM MgCl₂, 5.6 mM glucose, 10 mM HEPES, and 0.1% Gelatin). Alternatively, PMC or LAD2 cells were sensitized with 0.5 μg/mL or 1 μg/mL anti-TNP IgE overnight, respectively, and then stimulated with indicated concentrations of TNP-BSA or SP for 30 min in Tyrode’s buffer. The magnitude of degranulation was assessed by measuring percentages of β-hexosaminidase release or surface CD63-positice mast cells (24, 28). β-hexosaminidase release was calculated by dividing fluorescence in supernatant by fluorescence in cell lysate. After stimulation, cell supernatants or lysates were incubated in citrate buffer (25 mM citric acid, 25 mM Trisodium citrate, pH 4.5) with 0.3 mg/mL p-nitrophenyl N-acetyl-β-d-glucosaminide (Sigma-Aldrich) for 60 min at 37°C. Cell lysates were prepared by lysing cell pellets with 1% Triton X-100. The reactions were terminated by adding 50 mM sodium carbonate buffer. OD at 405 nm was determined using an ELISA plate reader. Alternatively, the percentage of surface CD63-positive mast cells, corresponding to degranulated mast cells, within the total number of mast cells was measured using flow cytometry.

DRG cells were incubated in the Neurobasal Plus medium with the indicated concentrations of capsaicin, Der p extract, and PSMα3, 5 μg/mL of mMCPT1, mMCPT4, or mMCPT6, 1 μM histamine, or vehicle for 1 h after pre-incubation in the presence of 10 μM TY-51469, 10 μM RWJ-56110, 10 μM AZ3451, 1 μM AMG517, and vehicle for 1 h. Levels of SP in the supernatant of DRG cells were measured via enzyme-linked immuno-sorbent assay (ELISA). Levels of histamine or human chymase in the culture supernatants of LAD2 cells and levels of histamine, serotonin, mouse tryptase beta 2 (mMCPT6), and mMCPT4 in the culture supernatants of MRGPRX2-KI PMCs were measured using ELISA. LAD2 cells and MRGPRX2-KI PMCs were sensitized with 1 or 0.5 μg/mL anti-TNP IgE overnight, respectively, and stimulated with the indicated concentrations of TNP-BSA and SP for 30 min in Tyrode’s buffer. Levels of LTB₄ and cysteinyl LTs in the culture supernatants of WT, Mrgprb2-KO, and MRGPRX2-KI PMCs stimulated with the indicated concentrations of SP for 1 h were measured using ELISA.

Total RNA was extracted from the PMCs and DRG cells using the RNeasy Mini Kit (Qiagen), according to the manufacturer’s instructions. cDNA was synthesized from the total RNA using the ReverTra Ace qPCR RT kit (Toyobo). Real-time PCR was performed using the Step One Plus Real-Time PCR System (Thermo Fisher Scientific) with the SYBR Green PCR Master Mix (Applied Biosystems, Life Technologies) (31). The following primers were used: 5′-GGAACCAAGCCATGATTTTGC-3′ (forward) and 5′- GTGAAGGCATTCGTGTGCATA-3′ (reverse) for mrgprb2; 5′- CACAGACCAGTTTAACACTTCC-3′ (forward) and 5′- CTCTTTGATGACCTCCTCGC-3′ (reverse) for tdTomato; 5′- CACAGACCAGTTTAACACTTCC-3′ (forward) and 5′- GATCAGGGTCTCCTTGCCAC-3′ (reverse) for knock-in MRGPRX2; and 5′- GCAGAAGAAGGGCTTGGTCA -3′ (forward) and 5′-CCGGAATCGAACCCTGATT-3′ (reverse) for mouse 18S rRNA. The mRNA expression levels were quantified using the comparative method with the StepOne Software, and housekeeping gene 18S rRNA levels were used for normalization.

Flow cytometric analysis was performed using FACSVerse (BD Biosciences) equipped with FlowJo software (Tree Star). BMMCs, PMCs, peritoneal lavage cells, and skin cells were used in this study. To isolate the ear skin cells (31), skin samples were minced with scissors and incubated with the RPMI-1640 medium with 2 mg/mL collagenase type I (FUJIFILM) and 0.1 mg/mL DNase I (Roche) for 1 h at 37°C. Then, the cell suspension was incubated with 10 mM ethylene diamine tetra acetic acid (EDTA) for 5 min at 37°C. After washing, the cells were resuspended in a buffer for flow cytometry. Mast cells in the small intestine and skin were identified as CD3^-CD4^-CD8^-CD11b^-CD11c^-CD19^-Gr-1^-EpCAM^-NK1.1^-Ter119^-CD45⁺c-Kit⁺FcεRIα⁺ cells. Mast cells in the peritoneal cavity were identified as CD45⁺c-Kit⁺FcεRIα⁺ cells. BMMCs and PMCs were identified as c-Kit⁺FcεRIα⁺ cells. Skin neutrophils were identified as CD45⁺Ly-6G⁺CD11b⁺ cells. Degranulated mast cells were identified as CD63⁺ cells within mast cells.

Histological analyses were performed as previously described (30–32). Sections of the ear and back skin were stained with toluidine blue (pH 4.1) to calculate the total mast cell number and percentage of degranulated mast cells among the total mast cells in the ear and back skin.

Statistical analysis was performed using Prism 8 software (GraphPad). Data are expressed as the means ± standard deviation (SD). Ordinary one-way analysis of variance (ANOVA) with Tukey’s multiple comparisons was used in Figures 1 – 5 , 6A, B, F, G , 7 ; Supplementary Figures S2 , S4 – S6 , S8 . Unpaired two-tailed Student’s t test with Welch’s correction was used in Figures 6C-E, H-J ; Supplementary Figure S7 . The differences were compared between two groups or among multiple groups. *p < 0.05 and **p < 0.01 were considered to be statistically significant.

To clarify the physiological roles of MRGPRX2 in mast cells, we established MRGPRX2-KI mice with a C57BL/6 background ( Supplementary Figure S1A ). Consistent with previous studies (5–8), flow cytometric analysis using an anti-MRGPRX2 antibody (Ab) revealed that surface MRGPRX2 was expressed in FcεRIα⁺c-Kit⁺ mast cells in the peritoneal cavity of MRGPRX2-KI mice ( Figure 1A ). In the process of generating MRGPRX2-KI mice, we also established Mrgprb2-KO mice, expressing the fluorescent protein tdTomato under the control of the Mrgprb2 promoter. Mast cells in the peritoneal cavity of Mrgprb2-KO mice did not express surface MRGPRX2 but expressed tdTomato ( Figure 1A ). Neither Mrgprb2-KO nor MRGPRX2-KI influenced the mast cell numbers in the peritoneal cavity ( Figure 1B ). Skin mast cells form MRGPRX2-KI and Mrgprb2-KO mice expressed surface MRGPRX2 and tdTomato, respectively ( Figure 1C ). Staining of skin tissue sections showed that WT, Mrgprb2-KO, and MRGPRX2-KI mice had equivalent numbers of mast cells in the ear and back skin ( Figure 1D ). In contrast, mast cells in the small intestine had no detectable levels of tdTomato or surface MRGPRX2 in all mice groups ( Figure 1E ). MRGPRX2-KI and Mrgprb2-KO mice exhibited surface MRGPRX2 and tdTomato expression, respectively, in CTMCs.

Next, we generated PMCs and bone marrow-derived mast cells (BMMCs) from WT, Mrgprb2-KO, and MRGPRX2-KI mice, exhibiting similar levels of FcεRIα and c-Kit for each mast cell type. MRGPRX2 was consistently expressed on the surfaces of MRGPRX2-KI PMCs. High levels of tdTomato were detected in MRGPRX2-KO PMCs. Expression of tdTomato was also observed in Mrgprb2-KO BMMCs, but its levels were lower than those in Mrgprb2-KO PMCs. However, surface expression of MRGPRX2 was undetectable in MRGPRX2-KI BMMCs ( Figure 2A ). Real-time polymerase chain reaction (PCR) analysis confirmed that Mrgprb2, tdTomoato, and MRGPRX2 were highly expressed at the mRNA level in WT, Mrgprb2-KO, and MRGPRX2-KI PMCs, respectively. Additionally, Mrgprb2 mRNA was not detected in WT DRG cells ( Supplementary Figure S1B ). Then, we measured the degranulation rate in PMCs and BMMCs stimulated with compound 48/80, a known Mrgprb2/MRGPRX2 ligand. Stimulation with compound 48/80 dose-dependently increased the percentages of degranulation in WT and MRGPRX2-KI PMCs; however, MRGPRX2-KI PMCs were more strongly degranulated than WT PMCs ( Figure 2B ). Mrgprb2-KO PMCs and WT, Mrgprb2-KO, and MRGPRX2-KI BMMCs did not significantly degranulate in response to compound 48/80 ( Figure 2B ; Supplementary Figure S2 ). Next, WT, Mrgprb2-KO, and MRGPRX2-KI mice were intradermally injected in ears with compound 48/80 or PBS (24). Measuring the amount of the extravasated dye showed that in response to 100 ng compound 48/80, all mice exhibited significant levels of dye extravasation in the following order: MRGPRX2-KI > WT > Mrgprb2-KO mice ( Figure 2C ). However, dye extravasation was only evident in MRGPRX2-KI mice in response to 20 ng of compound 48/80 ( Figure 2C ). When PMCs were stimulated with the fluoroquinolone antibiotic ciprofloxacin, a different Mrgprb2/MRGPRX2 ligand, remarkable degranulation was observed only in MRGPRX2-KI PMCs under the conditions tested ( Figure 2D ). Consistently, intradermal injection of a low amount (5 μg) of ciprofloxacin increased vascular permeability only in MRGPRX2-KI mice ( Figure 2E ). However, stimulation with the bradykinin B2 receptor antagonist icatibant, another Mrgprb2/MRGPRX2 ligand, caused comparable levels of degranulation in WT and MRGPRX2-KI PMCs under the conditions tested ( Figure 2F ). Icatibant-induced vascular permeability was slightly higher in the MRGPRX2-KI mice than in the WT mice ( Figure 2G ). Neither ciprofloxacin nor icatibant stimulation elevated the degranulation rate of Mrgprb2-KO PMCs or vascular permeability in Mrgprb2-KO mice.

We generated PMCs from WT, Mrgprb2-KO, or MRGPRX2-KI mice with a BALB/c background, and confirmed that surface MRGPRX2 or tdTomato was expressed in MRGPRX2-KI or Mrgprb2-KO PMCs, respectively ( Supplementary Figure S3 ). We then measured the degranulation rate and the amounts of the degranulation products histamine, serotonin, tryptase MCPT6, and chymase MCPT4 in PMCs stimulated by FcεRI engagement or SP (5–8). Mrgprb2-KO or MRGPRX2-KI did not significantly influence FcεRI-activated PMC degranulation and its products ( Figures 3A-E ). However, stimulation with SP resulted in stronger degranulation of MRGPRX2-KI PMCs than WT PMCs ( Figure 3A ). Consistently, stimulation with SP induced the release of higher amounts of all amines and proteases tested, from MRGPRX2-KI PMCs than from WT PMCs. In contrast to a recent report on Mrgprb2 versus FcεRI (26), SP-stimulated MRGPRX2-dependent degranulation evoked robust histamine and serotonin secretion in PMCs. Nonetheless, SP-stimulated MRGPRX2 activation, but not FcεRI activation, induced high levels of MCPT6 and MCPT4 release from PMCs ( Figures 3B-E ). When IgE-sensitized human mast cell line LAD2 cells were stimulated with a specific Ag or SP, we found that stimulation with SP induced degranulation to release higher levels of histamine and chymase in LAD2 cells than stimulation with FcεRI engagement ( Supplementary Figure S4 ). Additionally, SP induced the release of higher amounts of LTB4 and cysteinyl LT in MRGPRX2-KI PMCs than in WT PMCs ( Supplementary Figure S5 ). We found that pretreatment with Piperine, a known MRGPRX2 antagonist, suppressed SP- or compound 48/80-induced degranulation in MRGPRX2-KI PMCs (33) ( Supplementary Figure S6 ), confirming that SP activated MRGPRX2-KI PMCs via MRGPRX2. Therefore, SP-stimulated MRGPRX2 activation induces the release of robust amounts of amines and proteases in mast cells.

To further examine the in vivo effect of SP on vascular permeability, WT, Mrgprb2-KO, and MRGPRX2-KI mice were intradermally injected with different amounts of SP. Significantly increased vascular permeability was observed in WT and MRGPRX2-KI mice in response to high amounts of SP (25 pmol/ear), although the latter exhibited higher vascular permeability than the former ( Figure 4A ). Consistent with this, we observed marked ear thickness in MRGPRX2-KI mice compared to Mrgprb2-KO mice 6 h after treatment with SP ( Figure 4B ). Staining of ear tissue sections revealed that the percentage of degranulated mast cells was higher in MRGPRX2-KI mice than in WT mice. No significant differences in mast cell numbers in the ear skin were observed among the three types of mice ( Figures 4C, D ). Additionally, neutrophil infiltration in the ear skin was evident in MRGPRX2-KI mice 6h after injection of SP ( Figure 4E ), Notably, a significant increase in the vascular permeability was observed only in MRGPRX2-KI mice in response to low amounts of SP (3 or 8 pmol/ear) ( Figure 4A ). In contrast, Mrgprb2-KO or MRGPRX2-KI did not affect vascular permeability induced by FcεRI engagement ( Figure 4F ). Therefore, intradermal injection of SP strongly induced vascular hyperpermeability via enhanced degranulation of skin mast cells in MRGPRX2-KI mice.

As HDM allergens and Staphylococcus aureus toxins regulate skin inflammation in various conditions, including atopic dermatitis (27, 34–37), we tested whether MRGPRX2 regulates vascular permeability induced by HDM Dermatophagoides pteronyssinus (Der p) extract or S. aureus-secreting toxin phenol-soluble modulin α3 (PSMα3). Intradermal injection of the Der p extract significantly increased the amount of extravasated dye in both WT and MRGPRX2-KI mice; however, the latter exhibited extravasation of higher dye amounts than the former ( Figure 5A ). Additionally, we observed more degranulated skin mast cells in MRGPRX2-KI mice than in WT mice ( Figure 5B ). However, stimulation with Der p extract failed to induce PMC degranulation, irrespective of Mrgprb2-KO or MRGPRX2-KI ( Figure 5C ). No significant increase in vascular permeability or degranulation of skin mast cells was observed in Mrgprb2-KO mice ( Figures 5A, B ). Similarly, intradermal injection of PSMα3 caused extravasation of higher amounts of dye and higher percentages of degranulated skin mast cells in MRGPRX2-KI mice than in WT mice ( Figures 5D, E ). Stimulation with PSMα3 caused no significant PMC degranulation ( Figure 5F ). Interestingly, treatment with anti-SP serum decreased Der p extract- or PSMα3-induced vascular hyperpermeability in MRGPRX2-KI mice to levels comparable to those in control serum-treated WT counterparts ( Figures 5G, H ). These results indicated that intradermal injection of Der p extract or PSMα3 increases vascular permeability via SP-driven MRGPRX2-dependent mast cell degranulation.

Because MRGPRX2-dependent PMC degranulation strongly induced the release of histamine and chymase, we investigated whether histamine and/or chymase contributed to vascular hyperpermeability in MRGPRX2-KI mice. The results showed that the amount of extravasated dye in SP-injected MRGPRX2-KI mice was reduced by treatment with the antihistamine cetirizine or the chymase inhibitor TY-51469, to the levels of SP-injected, vehicle-treated WT mice, indicating that SP-induced vascular hyperpermeability in MRGPRX2-KI mice depended on histamine and chymase ( Figures 6A, B ). Additionally, ciprofloxacin-induced vascular hyperpermeability in MRGPRX2-KI mice was inhibited by cetirizine, TY-51469, and anti-SP serum ( Figures 6C-E ). Moreover, PSMα3-induced vascular hyperpermeability in MRGPRX2-KI mice was lowered by treatment with cetirizine or TY-51469, to the levels observed in PSMα3-induced, vehicle-treated WT mice ( Figures 6F, G ). However, IgE/Ag-induced vascular hyperpermeability in WT mice was abrogated by treatment with cetirizine, but not with TY-51469 or anti-SP serum ( Figures 6H, J ). We confirmed that Mrgprb2-KO or MRGPRX2-KI did not affect histamine-induced vascular hyperpermeability in mice ( Figure 6K ) and that histamine-stimulated vascular hyperpermeability in WT mice was not affected by treatment with anti-SP serum ( Supplementary Figure S7 ). Therefore, MRGPRX2-dependent mast cell degranulation products, histamine and chymase, strongly promote vascular permeability.

To examine the involvement of neuronal SP in MRGPRX2-dependent vascular hyperpermeability, murine DRG cells were stimulated with Der p extract, PSMα3, or capsaicin as controls. As previously reported (27, 29), all stimuli induced the release of SP from DRG cells ( Figure 7A ). Notably, the release of SP was abrogated by treatment with the TRPV1 antagonist AMG517 ( Figure 7B ), whereas it was not inhibited by treatment with the protease-activated receptor 1 (PAR1) antagonist RWJ-56110 or the PAR2 antagonist AZ3451 ( Supplementary Figure S8A ). Additionally, stimulation with mMCPT1, mMCPT4, and mMCPT6, but not with histamine, induced the release of SP from DRG cells ( Figure 7C ). We confirmed that treatment with TY-51469 inhibited the release of SP induced by mMCPT1 or mMCPT4, although it weakly inhibited that by mMCPT6 ( Figure 7D ). mMCPT4-stimulated SP release from DRG cells was not suppressed by treatment with RWJ-56110 or AZ3451 ( Supplementary Figure S8B ). Notably, intradermal injection of mMCPT4 resulted in the highest amount of extravasated dye in the ear skin of MRGPRX2-KI mice, which was lowered by treatment with anti-SP serum ( Figures 7E, F ). Moreover, PSMα3-induced MRGPRX2-dependent vascular hyper permeability was suppressed by AMG517 ( Figure 7G ). Collectively, these results indicated that PSMα3 stimulates the release of SP from TRPV1⁺ DRG cells via unknown mechanisms, subsequently inducing the degranulation of histamine and chymase via MRGPRX2, leading to vascular hyperpermeability in MRGPRX2-KI mice.