C57BL/6 mice and Lyz ^Cre mice (B6.129P2-Lyz2^tm1(cre)lfo /J, JAX stock #018956) were purchased from The Jackson Laboratory (Bar Harbor, ME). The generation and characterization of Lyz ^Cre mice (express Cre in myeloid cells due to targeted insertion of the cre cDNA into their endogenous M lysozyme locus) were reported by Förster and colleagues (64). PKD1 ^fl/fl mice generated as previously described (65) were kindly provided by Dr. E. Olson (University of Texas Southwestern Medical Center, Dallas, TX). PKD1 ^fl/fl mice and Lyz ^Cre mice were backcrossed onto the C57BL/6 more than seven generations at the University of Tennessee Health Science Center (UTHSC). Subsequent cross-breeding of these PKD1 ^fl/fl and Lyz ^Cre mice resulted in PKD1 ^fl/fl -Lyz ^Cre (myeloid lineage cell-specific PKD1-deficient, PKD1mKO) mice. PKD1 ^fl/fl mice were used as wild-type (WT) control and PKD1 ^fl/fl -Lyz ^Cre+/- mice were used as PKD1mKO. Mice were bred and maintained in a pathogen-free facility at UTHSC. All animal care and housing requirements set forth by the National Institutes of Health Committee on Care and Use of Laboratory Animals of the Institute of Laboratory Animal Resources were followed. Animal protocols were reviewed and approved by the UTHSC Institutional Animal Care and Use Committee.

S. rectivirgula (ATCC^®15347™) was prepared as previously described (57). Age- and gender-matched mice were exposed intranasally to S. rectivirgula (80 μg/mouse or 100 μg/mouse) or endotoxin-free saline (AdipoGen Life Sciences, San Diego, CA) for one time or three times per week for 3 weeks. Mice were euthanized at designated time points (2, 6, 24, 48, or 72 h after the last S. rectivirgula challenge). Unless otherwise indicated, control and S. rectivirgula-exposed mice were analyzed individually. To perform BAL, mice tracheas were cannulated, and the lungs were washed with 1 mL of 2 mM EDTA/PBS. The typical amount of fluid recovered was approximately 70% of the input. The recovered BALF was centrifuged, and the resulting supernatants were kept at −80°C until used for detection of cytokines and chemokines. The cells recovered from the BALF were used to determine the degree of alveolitis by counting the number of live cells using a hemocytometer or Countess II (Invitrogen) following trypan blue staining. The cellular composition of the alveolitis was determined by flow cytometric analysis. To isolate lung interstitial cells (LICs), the lungs were perfused through the right ventricle with PBS and digested with collagenase (20 U/mL, type 4, LS004186, Worthington Biochemical Co, Lakewood, NJ) and deoxyribonuclease I (40 μg/mL, LS002004, Worthington Biochemical Co) for 45 min at 37°C. Cells were freed by mechanical disruption and filtered through 40 μM nylon mesh. Discontinuous Percoll (P4937, Sigma-Aldrich, St. Louis, MO) gradient centrifugation was used to separate extraneous fibroblasts or epithelial cells. The mononuclear cells were isolated at the 40/80% interface. The number of live cells were counted using a hemocytometer or Countess II (Invitrogen) following trypan blue staining and used for flow cytometric analysis.

Spleen cells were obtained as previously described (54). To isolate peritoneal macrophages, a peritoneal lavage was performed by injecting 8 mL of cold sterile PBS (Corning, Manassas, VA) into the peritoneal cavity of mice followed by a gentle massage on the peritoneal cavity and subsequent aspiration of the peritoneal fluid. Peritoneal cells were obtained from the recovered peritoneal fluid by centrifugation. After removing RBC using RBC lysis buffer, peritoneal cells were washed three times with PBS, suspended in complete medium (RPMI 1640 supplemented with 100 IU/mL penicillin, 100 μg/mL streptomycin, and 10% heat-inactivated FBS), placed in plastic petri dishes, and then incubated for 1 h at 37°C. Suspended cells were removed. Plastic adherent cells were washed three times with prewarmed PBS and then collected by scraping. The resulting plastic adherent cells were used as peritoneal macrophages for confirming PKD1 gene deletion in myeloid lineage cells in PKD1mKO. To isolate thymocytes, thymus lobes from mice were harvested as described previously (66). Thymus cells were obtained by cutting thymus lobes into small pieces with fine scissors, crushed with a syringe plunger in cold PBS, and then filtered through a 100-μm sterile cell strainer (Fisher Scientific). Thymic cells in suspensions were washed three times with PBS and then used as thymocytes. To isolate neutrophils from bone marrow, bone marrow cells from mice were prepared as previously described (55). After removing RBC, the bone marrow cells were washed three times with PBS and then resuspended in PBS. The bone marrow cell suspension was overlaid on top of the Ficoll-Paque Plus (GE Healthcare, Uppsala, Sweden) and then centrifuged for 30 min at room temperature without break. After discarding upper layers, granulocytes pelleted in the bottom were washed three times with PBS and then used as neutrophils. Purity of isolated neutrophils were analyzed by Diff-Quick staining (Diff Quick Stain kit, IMEB Inc., San Marcos, CA) according to the manufacturer’s instructions and approximately 85% to 90% of the isolated cells were morphologically neutrophils/granulocytes. RPMI 1640 was purchased from Corning, Pen Strep was purchased from Gibco, and FBS was purchased from R&D Systems (Flowery Branch, GA).

To evaluate the migration abilities of neutrophils, 1 mL of RPMI-1640 media or murine recombinant CXCL2 (50 ng/mL, PeproTech, cat# 250-15) was placed into the bottom chamber of each designated well in a 24-well plate and 5 × 10⁵ bone marrow neutrophils (isolated from WT or PKD1mKO) in 200 µL of RPMI-1640 media were placed into the top chamber (Greiner Bio-One, ThinCert 3.0 μm pore, 24-well. ref#662-631). The trans-well plate was incubated at 37°C with 5% CO₂ for 2 h and then neutrophils that migrated into the bottom chamber and the bottom chamber side of the membrane were collected and counted using Countess II (Invitrogen).

Genomic DNA was isolated from mouse tail clips using a Phire Tissue Direct PCR Master Mix (ThermoFisher Scientific Inc., Vilnius, Lithuania) following the manufacturer’s protocol. To distinguish PKD1 alleles and lysozyme 2 (Lyz2) alleles, genomic DNA was analyzed by PCR performed in a thermocycler (T100 Thermal Cycler, Bio-Rad). The sequences of PCR primers used for PKD1-WT/loxP and KO were described previously (57). The sequences of PCR primers used for Lyz ^Cre are as follows: Mutant F: 5′CCCAGAAATGCCAGATTACG3′, WT F: 5′TTACAGTCGGCCAGGCTGAC3′, and Common R: 5′CTTGGGCTGCCAGAATTTCTC3′. All primers for genotyping were purchased from Integrated DNA Technologies, Inc. (IDT, Coralville, IA). DNA-free total RNA was isolated using Direct-Zol RNA Microprep kits (Zymo Research, Irvine, CA) following the manufacturer’s protocol. The relative amounts of the indicated gene transcripts were analyzed by RT-PCR as described previously (56). Sequences of RT-PCR primers used were described previously (54, 57, 67). All primers for RT-PCR were purchased from IDT. For RT real-time qPCR (SYBR Green Assay), total RNA (250 ng) was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Real-time qPCR was performed on a QuantStudio 5 (Applied Biosystems) using the PowerUp SYBR Green Master Mix (Applied Biosystems). Primers were designed and supplied by IDT. The product size was initially monitored by agarose gel electrophoresis. Melting curves were analyzed to control for specificity of PCR reactions. The data on genes that were differentially expressed were normalized to the expression of the housekeeping gene, GAPDH. The relative units were calculated from a standard curve, plotting three different concentrations against the PCR cycle number at which the measured intensity reaches a fixed value (with a 10-fold increment equivalent to ~3.1 cycles). Fold changes comparing S. rectivirgula-treated WT mice and S. rectivirgula-treated PKD1mKO to control mice exposed to saline were calculated by comparative quantification algorithm-delta delta Ct method (fold difference = 2^−ΔΔCt). Primer sequence information for qPCR is either described previously (57) or listed in Supplementary Table 1 .

Levels of specific proteins in whole cell extracts were analyzed by Western blot assay as described previously (54, 68). Blots developed in enhanced chemiluminescence reagents (GE Healthcare, UK) were either exposed onto x-ray film followed by processing through X-OMAT 2000A processor (Kodak). Blots developed with fluorochrome-conjugated secondary Abs were scanned using ODYSSEY CLx (LI-COR, Lincoln, NE). Actin was used as a loading control for all Western blot assays. Antibodies specific for actin was purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX). Antibodies specific for PKD1 were purchased from Origene (Rockville, MD). Concentrations of IFNγ, TNFα, IL-6, and IL-17A in BALF were analyzed by enzyme-linked immunosorbent assay (ELISA) as previously described (54, 68). All ELISA kits were purchased from Invitrogen. Concentrations of IL-1α, IL-1β, CCL2, CXCL1, and CXCL2 in BALF were analyzed using the multiplex sandwich assay kit (MCYTOMAG-70K, EMD Millipore, Billerica, MA) following the manufacturer’s protocol. The fluorescence was measured with Bio-Plex MAGPIX Multiplex Reader (Bio-Rad, Hercules, CA).

The relative levels of 40 cytokines and chemokines in BALF obtained from WT and PKD1mKO exposed to S. rectivirgula repeatedly for 3 weeks were evaluated using Proteome Profiler Mouse Cytokine Array Kit (ARY006, R&D Systems) following the manufacturer’s instructions. The ChemiDoc™ Touch Imaging system (Bio-Rad) was used to detect the chemiluminescent signal of the bound cytokine/chemokine, and the Image Lab (Bio-Rad) software was utilized to measure the cytokine/chemokine signal intensity of the digital image. Each spot was adjusted for adjacent background intensity and normalized to a positive control on the membrane.

LICs (4 × 10⁶ cells/mL) were stimulated with phorbol 12-myristat 13-acetate (PMA, 5 ng/mL) and ionomycin (500 ng/mL) for 2 h. Two hours later, 1 μL of BD GolgiPlug (BD Biosciences, San Diego, CA) was added to the culture and then incubated for four additional hours. Cells were harvested, washed with 5% FBS in PBS, stained with DAPI for 2 min on ice, washed, and then incubated with anti-CD16/32 (2.4G2) in PBS containing 5% FBS for 15 min on ice to block Fc receptors. Cells were stained with anti-βTCR (H57-597) and anti-CD4 (RM4-5) for 30 min on ice. Cells were fixed in 250 μL of BD cytofix/cytoperm solution (BD Biosciences) for 20 min on ice. Cells were washed with BD perm/wash solution (BD Biosciences) and intracellularly stained with anti-IL-17A-APC (TC11-18H10.1) and anti-IFNγ-PE (XMG1.2) for 30 min on ice. Cells were washed again with the 1× BD perm/wash solution and then subjected to flow cytometric analysis. All antibodies were purchased from BioLegend (San Diego, CA). Phorbol 12-myristate 13-acetate (PMA) and ionomycin were purchased from Sigma-Aldrich (St. Louis, MO).

For splenic immune cell profiling, spleen cells were incubated with anti-CD16/CD32 Abs and subsequently stained with fluorochrome-conjugated Abs to CD45 (30-F11), CD19 (1D3), βTCR (H57-597), CD4 (GK1.5), CD8 (53-6.7), CD11b (M1/70), Ly6G (1A8), and CD11c (N418). Cells were analyzed using a Cytek Aurora Cytometer (N7-00003, Cytek Biosciences Inc., Fermont, CA) and FlowJo flow cytometry data analysis software (FlowJo LLC, Ashland, OR). Gating strategies for splenic and bone marrow immune cell profiling are shown in Supplementary Figures 1A, B , respectively. Briefly, debris and doublets were gated out. In the single-cell gate, CD45⁺ population was gaited and identified as CD45⁺ cells. In the CD45⁺ cell gate, the CD19⁺ population (B cells), βTCR⁺ population (T cells), βTCR⁺CD4⁺ population (CD4⁺ T cells), βTCR⁺CD8⁺ population (CD8⁺ T cells), CD11b⁺ population (monocytic cells), CD11b⁺LyG6⁺ population (neutrophils), and CD11c⁺ population (dendritic cells) were identified. The frequency of each cell population was expressed as the percentage of CD45⁺ cells.

To detect neutrophils in the airway and lung interstitium after one-time S. rectivirgula exposure, BAL cells were incubated with anti-CD16/CD32 Abs, subsequently stained with fluorochrome-conjugated Abs to CD11b (M1/70), F4/80 (BM8), and Gr-1 (RB6-8C5), and then analyzed using a BD Biosciences LSR II flow cytometer (BD Biosciences, San Diego, CA) and FlowJo flow cytometry data analysis software. The gating strategy for flow cytometric analysis of neutrophils in BAL cells obtained from mice 24 h after the single S. rectivirgula exposure is shown in Supplementary Figure 2 . Debris and doublets were gated out. In the single-cell gate, the CD11b⁺Gr1⁺ population was gated, and then the Gr1⁺F4/80^- population in the CD11b⁺Gr1⁺ gate was identified as neutrophils (CD11b⁺Gr1⁺F4/80^-). The frequency of CD11b⁺Gr1⁺F4/80^- cells was expressed as % of BAL cells.

To determine the cellular composition and levels of certain surface markers of cells recovered from BALF and lung interstitium from mice exposed to S. rectivirgula repeatedly for 3 weeks, cells were incubated with anti-CD16/CD32 Abs; subsequently stained with fluorochrome-conjugated Abs to CD45 (I3/2.3), CD11b (M1/70), CD11c (N418), F4/80 (BM8), Gr-1 (RB6-8C5), MHCII (I-A/I-E) (M5/114.15.2), βTCR (H57-597), CD4 (RM4-5), CD8 (53-6.7), CD86 (GL-1), CD206 (C068C2), CD40 (3/23), CCR6 (29-2L17), CXCR3 (CXCR3-173), and/or CD69 (H1.2F3); and then analyzed using a BD Biosciences LSR II flow cytometer or Cytek Aurora (Cytek Biosciences) and FlowJo flow cytometry data analysis software. Gating strategies for flow cytometric analysis of BAL cells and LICs are shown in Supplementary Figures 3 , 4 , respectively. Debris and doublets were gated out. In the single-cell gate, the CD45⁺ population was identified. For myeloid lineage cells, the CD11b^-CD11c^- population was gated out in the CD45⁺ population. In the rest of CD45⁺ cells, the CD11c⁺F4/80⁺ population was identified as alveolar macrophages (AM), and the remaining cells were identified as the non-AM population. The non-AM population was divided into the CD11b⁺Gr1⁺ population and the non-polymorphonuclear neutrophils (PMN) population. In the CD11b⁺Gr1⁺ population, the CD11b⁺Gr1⁺F4/80^- population was identified as neutrophils. In the non-PMN population, the CD11b⁺F4/80⁺ population was identified as macrophages (MAC), and the F4/80^- population was identified as the non-MAC population. In the non-MAC population, the CD11c⁺CD11b^-F4/80^- population and CD11c⁺CD11b⁺F4/80^- population were identified. In the non-MAC population, the CD11c⁺CD11b^-F4/80^-MHC-II⁺ population was identified as conventional dendritic cell type 1 (cDC1) and the CD11c⁺CD11b⁺F4/80^-MHC-II⁺ population was identified as conventional dendritic cell type 2 (cDC2). For T cells, βTCR⁺ cells were identified in the CD45⁺ population and then the CD4⁺βTCR⁺ population was identified as CD4⁺ T cells, and the CD8⁺βTCR⁺ population was identified as CD8⁺ T cells. The frequency of each cell population was expressed as % of CD45⁺ cells. The surface expression levels of various markers (CD86, MHC-II, CD40, CD206, CD69, CXCR3, and CCR6) on cells were determined by their geometric mean fluorescent intensity (gMFI). The gMFI of each marker was calculated for each indicated cell population using the FlowJo flow cytometry data analysis software. All Abs were purchased from BioLegend (San Diego, CA), eBioscience, TONBO, or BD Pharmingen.

The left lung lobes removed from the mice were fixed in 10% neutral buffered formalin, dehydrated, and embedded in paraffin. The paraffin-embedded lungs were sectioned longitudinally at 5 μm and stained with hematoxylin and eosin (H&E). To determine inflammatory cell influx into the interstitial lung tissue, digital images of whole H&E-stained slides were captured using the Aperio ScanScope^®XT Slide Scanner (Aperio Technologies, Inc. Vista CA).

Data were expressed as mean values ± SD. The differences between two groups were evaluated using two-tailed Student’s t-test. The differences between multiple groups were evaluated using one-way ANOVA with Tukey’s post-hoc test. GraphPad Prism statistical software (GraphPad Software, San Diego, CA) was used. Statistical differences with p < 0.05, p < 0.01, p < 0.001, and p < 0.0001 are indicated in the figures as *, **, ***, and ****, respectively, and considered significant.

To delete PKD1 gene in myeloid lineage cells, PKD1 ^fl/fl mice (mice with inserted lox-p sites in PKD1 gene to flanking exons 12 through 14 that encode the kinase function) (65) were cross-bred with Lyz ^Cre mice that express Cre recombinase in myeloid lineage cells, including monocytes, mature macrophages, and granulocytes (64). Resulting myeloid lineage cell PKD1-deficient mice (PKD1 ^fl/fl -Lyz ^Cre ) were identified by genotyping ( Figure 1A ). The PKD1 ^fl/fl -Lyz ^Cre mice (both PKD1 ^fl/fl -Lyz ^Cre+/- and PKD1 ^fl/fl -Lyz ^Cre+/+ strains) are viable and fertile and do not display any gross physical abnormalities. PKD1 gene deletion and lack of PKD1 mRNA expression in peritoneal macrophages, but not in thymocytes, of PKD1 ^fl/fl -Lyz ^Cre was also detected ( Supplementary Figure 5 ). To further confirm PKD1 deletion in myeloid lineage cells, neutrophils were purified from bone marrow cells and then protein levels of PKD1 were analyzed by Western blot assay. As shown in Figure 1B , levels of PKD1 protein were substantially reduced in neutrophils isolated from PKD1 ^fl/fl -Lyz ^Cre mice. To evaluate whether PKD1 deletion in myeloid lineage cells affected the general immune cell profile, spleen cells and bone marrow cells were analyzed by flow cytometry. Proportions of CD19⁺ B cells, CD4⁺ T cells, CD8⁺ T cells, CD11b⁺ cells, CD11b⁺Ly6G⁺ cells, and CD11c⁺ cells in the spleens and bone marrow of PKD1mKO (PKD1 ^fl/fl -Lyz ^Cre+/- or PKD1 ^fl/fl -Lyz ^Cre+/+ ) mice were comparable to those of PKD1 ^fl/fl mice ( Figures 1C, D ). A previous study has demonstrated that PKD3, one of PKD family members, is required for the neutrophil migration (69). Thus, to evaluate whether deletion of PKD1 affects chemotaxis of neutrophils, the migratory ability of neutrophils was analyzed using trans-well migration assay. As shown in Figure 1E , the migratory capability of PKD1-deficient (PKD1^-/-) neutrophils toward chemokine CXCL2 was comparable to that of PKD1-intact neutrophils, indicating that PKD1^-/- neutrophils do not have an intrinsic mobility defect. Taken together, these data demonstrate that PKD1 is deleted in myeloid lineage cells in PKD1 ^fl/fl -Lyz ^Cre mice and that PKD1 deletion in myeloid lineage cells in mice did not significantly alter the general splenic and bone marrow immune cell profiles in mouse and neutrophil’s chemotaxis capacity. These results also indicate that the PKD1 ^fl/fl -Lyz ^Cre mouse can be a suitable tool for investigating the contribution of PKD1 activation in myeloid lineage cells, including neutrophils and macrophages, to the development of acute pulmonary inflammation and HP caused by inhalation of S. rectivirgula.

PKD1 is activated in the lung and plays a pivotal role in acute pulmonary inflammation and HP following inhalation of SR (43, 57). Using cell lines and PKD1-specific siRNA, we found that S. rectivirgula activates PKD1 in alveolar type II epithelial cells, neutrophils, and alveolar macrophages, and that PKD1 is indispensable for S. rectivirgula-induced expression of cytokines and chemokines in these cells (43). Neutrophils are the predominant cells infiltrated into the lung within several hours following inhalation of S. rectivirgula and play an indispensable role in both the acute lung injury and the development of HP (43, 44, 63, 70). To investigate whether lack of PKD1 activation in myeloid lineage cells, such as neutrophils and macrophages, influences inflammatory responses in the lung following exposure to S. rectivirgula, PKD1-sufficient mice (WT: PKD1 ^fl/fl ) and myeloid lineage cell PKD1-deficient mice (PKD1mKO: PKD1 ^fl/fl -Lyz ^Cre ) were exposed to S. rectivirgula by intranasal instillation. Two, six, or twenty-four hours later, BALF and lung tissues were obtained and inflammatory responses to S. rectivirgula were assessed by analyzing mRNA levels and protein levels of selected cytokines and chemokines in lungs and BALF, respectively.

At 2 h after the S. rectivirgula inhalation, lung mRNA expression levels of TNFα, CCL2, CCL4, CXCL1, and CXCL2 in WT mice and PKD1mKO were significantly increased compared to those in control saline-inhaled mice ( Figure 2A ). Expression levels of those cytokines and chemokines were not significantly different between WT mice and PKD1mKO. These results indicate that PKD1 activation in myeloid lineage cells is dispensable for the initial expression of TNFα, CCL2, CCL4, CXCL1, and CXCL2 in the lungs following S. rectivirgula inhalation. These results also suggest that the initial lung cellular sources of these cytokines and chemokines in response to S. rectivirgula inhalation may not be the lung-resident myeloid lineage cells. However, we cannot rule out the possibility that other signaling pathways independent of PKD1 may be involved in the expression of those proinflammatory genes in the lung myeloid lineage cells immediately following the S. rectivirgula inhalation. Lung mRNA expression levels of CCL3 in both WT mice and PKD1mKO mice 2 h after the S. rectivirgula inhalation were also significantly increased compared to those in control saline-inhaled mice. However, lung mRNA expression levels of CCL3 in PKD1mKO mice at 2 h post-S. rectivirgula inhalation were significantly lower than those in WT mice, indicating that PKD1 in myeloid lineage cells contributes to the initial expression of CCL3 in the lungs following S. rectivirgula inhalation. Lung mRNA expression levels of IL-6, CXCL5, and CXCL10 were slightly but not significantly increased in WT mice compared to those in control mice. However, mRNA expression levels of IL-6, CXCL5, and CXCL10 in PKD1mKO mice at 2 h post-S. rectivirgula inhalation were significantly increased compared to those in saline-inhaled control mice. When compared to WT mice, lung mRNA expression levels of IL-6 and CXCL10 in PKD1mKO mice at 2 h post-S. rectivirgula inhalation were slightly, but not significantly, increased (p = 0.2888 for IL-6; p = 0.2147). Lung mRNA expression levels of CXCL5 in PKD1mKO mice at 2 h post-S. rectivirgula inhalation were significantly increased compared to CXCL5 levels in WT mice. These indicate that PKD1 activation in myeloid lineage cells is dispensable for the initial expression of IL-6, CXCL5, and CXCL10 in the lungs following S. rectivirgula inhalation. These results also suggest a possibility for the presence of PKD1-dependent regulatory mechanism in myeloid lineage cells that negatively affect the initial expression of IL-6, CXCL5, and CXCL10 in the lungs following S. rectivirgula inhalation.

At 6 h after the S. rectivirgula inhalation, lung mRNA expression levels of IL-6, TNFα, CCL2, CCL3, CCL4, CXCL1, CXCL2, CXCL5, and CXCL10 in both WT mice and PKD1mKO were significantly increased compared to those in control saline-inhaled mice ( Figure 2B ). Expression levels of those cytokines and chemokines in lungs were not significantly different between WT mice and PKD1mKO at 6 h post-S. rectivirgula inhalation. IFNγ mRNA expression was not detected at this time point. Protein levels of IL-1β and CXCL2 in BALF were significantly increased in WT and PKD1mKO at 6 h post-exposure to S. rectivirgula compared to those in mice exposed to saline ( Figure 2C ). Protein levels of IL-1α, CCL2, and CXCL1 in BALF were also increased in both WT and PKD1mKO exposed to S. rectivirgula compared to those in saline-exposed mice but differences were statistically insignificant. Protein levels of these cytokines and chemokines in BALF obtained 6 h after the S. rectivirgula inhalation were not statistically different between WT and PKD1mKO. Collectively, these early time point (2 h and 6 h post-challenge) results indicate that PKD1 activation in myeloid lineage cells is dispensable for the initial proinflammatory responses in the lungs following S. rectivirgula inhalation.

At 24 h after the S. rectivirgula inhalation, the expression levels of proinflammatory cytokines IL-6, TNFα, and IFNγ and chemokines CCL2, CCL3, CCL4, CXCL1, CXCL2, and CXCL10 in the lungs of WT mice were significantly increased ( Figure 3A ). We were not able to detect increased expression of CXCL5, CXCL9, and CXCL11 in the lungs of WT mice at 24 h after the S. rectivirgula exposure. When compared to WT, PKD1mKO mice showed significantly reduced mRNA expression levels of TNFα, IL-6, IFNγ, CCL2, CCL3, CCL4, CXCL1, CXCL2, and CXCL10 in the lungs in response to S. rectivirgula exposure. The mRNA expression levels of those cytokines and chemokines in the lungs of PKD1mKO exposed to S. rectivirgula for 24 h were not significantly different from those in lungs of control mice exposed to saline. Protein levels of IL-1α, IL-1β, IL-6, TNFα, IFNγ, CCL2, CXCL1, and CXCL2 in BALF were significantly increased in WT mice at 24 h after the exposure to S. rectivirgula compared to those in mice exposed to saline ( Figure 3B ). Compared to those in WT mice, protein levels of IL-1β, IL-6, TNFα, IFNγ, CCL2, and CXCL2 in BALF from S. rectivirgula-exposed PKD1mKO mice were significantly decreased. Although it showed substantial reduction in S. rectivirgula-exposed PKD1mKO, the protein levels of CXCL1 in BALF were not significantly different between WT and PKD1mKO exposed to S. rectivirgula one time for 24 h (p = 0.1017). When compared to those in saline-treated control mice, the protein levels of IL-6, TNFα, IFNγ, CCL2, and CXCL1 in BALF from SR-exposed PKD1mKO were not significantly different. However, the protein levels of IL-1β in PKD1mKO exposed to S. rectivirgula were significantly higher than those in saline-treated control mice. Increasing trends for the protein levels of IL-1α (p = 0.0878) and CXCL2 (p = 0.1091) in PKD1mKO following S. rectivirgula exposure, compared to those in saline-treated control, were also observed. These results indicate that PKD1 in myeloid lineage cells is involved in cytokine and chemokine production in the lungs during the later phase of acute lung insult by S. rectivirgula exposure. Taken together, our results demonstrate that although multiple signaling pathways and multiple types of lung cells are involved in acute pulmonary inflammation caused by exposure to S. rectivirgula, PKD1 in myeloid lineage cells plays a significant role for the acute pulmonary proinflammatory responses following one-time exposure to S. rectivirgula.

Significantly reduced expression of CCL2, CCL3, CCL4, CXCL1, and CXCL2 in the lungs of PKD1mKO 24 h after the single exposure to S. rectivirgula predict that PKD1 in myeloid lineage cells may contribute to the leukocyte influx into the lung by upregulating these chemokines following exposure to S. rectivirgula. Therefore, we investigated whether deletion of PKD1 in myeloid lineage cells affects leukocyte infiltration into the lung following S. rectivirgula exposure. As shown in Figure 4A (left panel), at 24 h post-exposure to S. rectivirgula, WT mice exhibited significantly increased total BAL cell numbers (alveolitis) compared to those in control mice exposed to saline. Histological sections of lungs from S. rectivirgula-exposed WT mice also showed the presence of extensive leukocyte infiltration in the lungs compared to those from saline-exposed mice ( Figure 4B ). As previously reported (43, 44, 57, 63, 70), neutrophils were the predominant cell type recovered from the airways in WT mice exposed to S. rectivirgula ( Figure 4A , middle panel). Approximately 78% of cells recovered from BALF were neutrophils determined by flow cytometric analysis. In contrast, significantly less BAL cells were recovered from the PKD1mKO mice at 24 h after the S. rectivirgula exposure compared to the S. rectivirgula-exposed WT mice ( Figure 4A , left panel). The number of total cells recovered from the BALF from S. rectivirgula-exposed PKD1mKO mice were approximately 35% of those in S. rectivirgula-exposed WT mice. Histological sections of lungs from S. rectivirgula-exposed PKD1mKO mice also showed substantially less leukocyte infiltration in the lungs compared to those from S. rectivirgula-exposed WT mice ( Figure 4B ). Like the S. rectivirgula-exposed WT mice, the major cell type recovered from the airways of PKD1mKO mice was neutrophils (approximately 67%) ( Figure 4A , middle panel). Although frequencies of neutrophils in BAL cells from S. rectivirgula-exposed PKD1-mKO mice were slightly lower compared to those of S. rectivirgula-exposed WT mice, the difference was not significant (p = 0.0704). The number of neutrophils recovered from the BALF from PKD1mKO mice were approximately 31% of those in S. rectivirgula-exposed WT mice ( Figure 4A , right panel). Although they are not statistically significant, the numbers of total cells (p = 0.1849) and neutrophils (p = 0.1055) recovered from BALF of S. rectivirgula-exposed PKD1mKO were substantially higher than those in saline-exposed mice. Taken together, our results demonstrate that PKD1 in myeloid lineage cells plays a significant role in S. rectivirgula-induced acute neutrophilic alveolitis.

Repeated exposures to HP-inciting antigens cause recurring leukocyte infiltrations into the airways and interstitial lung space and lead to the formation of granulomas in both HP patients and animal models of HP (2, 3, 70, 71). To determine whether PKD1 in myeloid lineage cells contributes to the immune cell influx into the bronchial space and lungs following repeated exposures to S. rectivirgula, WT mice and PKD1mKO mice were exposed to S. rectivirgula three times (once a day)/week for 3 weeks as previously described (57). As shown in Figure 5A , leukocyte infiltration in bronchial space was significantly increased in both WT and PKD1mKO compared to the control saline-exposed mice. However, S. rectivirgula-induced leukocyte infiltration in bronchial space was significantly suppressed in PKD1mKO compared to WT (approximately 62% of WT-SR). Cellular composition of alveolitis following 3-week exposures to S. rectivirgula was not significantly different between WT mice and PKD1mKO mice ( Table 1 ). To determine whether PKD1 in myeloid lineage cells contributes to leukocyte infiltration and accumulation, and the development of granulomas in the lungs, we examined lung tissue sections from WT mice and PKD1mKO mice that had been repeatedly exposed to S. rectivirgula for 3 weeks. As shown in Figure 5B and Supplementary Figure 6 , while mice exposed to saline showed normal lung architecture, both WT mice and PKD1mKO mice repeatedly exposed to S. rectivirgula for 3 weeks exhibited alveolitis and granuloma formation. However, compared to WT mice, deletion of PKD1 in myeloid lineage cells resulted in substantially less leukocyte accumulation and reduced granuloma formation following repeated exposures to S. rectivirgula ( Figure 5B ; Supplementary Figure 6 ). Of note, the frequencies of CD45⁺ cells in isolated LICs were significantly lower in PKD1mKO mice compared to WT mice ( Supplementary Table 2 ). Cellular composition of LICs following 3-week exposures to S. rectivirgula was not significantly different between WT mice and PKD1mKO mice ( Supplementary Table 2 ). Collectively, these results demonstrate that PKD1 in myeloid lineage cells contributes significantly to leukocyte infiltration and accumulation in the lungs, and subsequent granuloma formation following repeated exposures to S. rectivirgula.

In the previous studies, we found that PKD1 contributes significantly to the increased surface expression of major histocompatibility complex class II (MHC-II) on polymorphonuclear cells (PMNs) and alveolar macrophages (AMs) isolated from bronchoalveaolar spaces and lung interstitium of mice repeatedly exposed to S. rectivirgula (57). To investigate whether deletion of PKD1 in myeloid lineage cells affects the surface expression of MHC-II on cells in bronchoalveaolar spaces and lung interstitium of the mice repeatedly exposed to S. rectivirgula, BAL cells and LICs isolated from WT and PKD1mKO mice repeatedly exposed to S. rectivirgula for 3 weeks were analyzed by flow cytometry and the levels of surface expression of MHC-II were measured based on the gMFI in each cell population. As shown in Figure 6A , the levels of the surface expression of MHC-II on neutrophils, CD11c⁺CD11b^-F4/80^- cells (contains MHC-II^low population and cDC1 population), and CD11c⁺CD11b⁺F4/80^- cells (contains MHC-II^low population and cDC2 population) isolated from the bronchoalveaolar spaces of PKD1mKO mice were significantly lower than those from WT mice. MHC-II surface expression on AMs, cDC1s, and cDC2s isolated from the bronchoalveaolar spaces of PKD1mKO was substantially, but not significantly (p = 0.2236 for AMs, p = 0.0926 for cDC1s, and p = 0.0612 for cDC2s), lower than that in WT mice. The levels of the surface expression of MHC-II on MACs in the bronchoalveaolar spaces were comparable between WT and PKD1mKO. The levels of the surface expression of CD86 on AMs and MACs were slightly lower in PKD1mKO mice compared to those in WT mice (p = 0.0616 for AMs and p = 0.0981 for MACs) ( Supplementary Figure 7 ). In contrast, the levels of the surface expression of CD86 on neutrophils isolated from the bronchoalveaolar spaces of PKD1mKO mice were slightly, but significantly, higher than those from WT mice ( Supplementary Figure 7 ). The surface expression levels of CD86 on CD11c⁺CD11b^-F4/80^- cells and CD11c⁺CD11b⁺F4/80^- cells, and the surface expression levels of CD40 and CD206 on AMs, MACs, neutrophils, CD11c⁺CD11b^-F4/80^- cells, and CD11c⁺CD11b⁺F4/80^- cells isolated from the bronchoalveaolar spaces were comparable between WT mice and PKD1mKO mice exposed to S. rectivirgula for 3 weeks ( Supplementary Figure 7 ).

Surface expression levels of MHC-II on AMs, neutrophils, and cDC2s isolated from lung interstitium of PKD1mKO mice repeatedly exposed to S. rectivirgula were significantly lower than those from WT mice ( Figure 6B ). MHC-II surface expression on MACs, CD11c⁺CD11b^-F4/80^- cells, and CD11c⁺CD11b⁺F4/80^- cells isolated from lung interstitium of PKD1mKO was substantially, but not significantly (p = 0.1337 for MACs, p = 0.0696 for CD11c⁺CD11b^-F4/80^- cells, and p = 0.1014 for CD11c⁺CD11b⁺F4/80^- cells), lower than that in WT mice. The surface expression levels of MHC-II on cCD1s, and CD86, CD40, and CD206 on AMs, MACs, neutrophils, CD11c⁺CD11b^-F4/80^- cells, and CD11c⁺CD11b⁺F4/80^- cells isolated from lung interstitium of PKD1mKO mice repeatedly exposed to S. rectivirgula were comparable to those of WT mice ( Supplementary Figure 8 ). Taken together, our results indicate that PKD1 in myeloid lineage cells may affect the level of the surface expression of MHC-II in myeloid lineage cells in the lungs during the development of HP caused by repeated exposures to S. rectivirgula.

Previous studies have shown that Th1- and Th17-associated cytokines and chemokines are critical to the development and severity of HP (33, 72, 73). Using inducible systemic PKD1-knockout mice, we previously found that PKD1 contributes substantially to the expression of IL-17A and Th1/Th17-associated chemokine CXCL9 following repeated exposures to S. rectivirgula (57). A pilot screening of 40 cytokines/chemokines in BALFs obtained from WT mouse and PKD1mKO mouse exposed repeatedly to S. rectivirgula for 3 weeks using a membrane-based mouse cytokine array showed that levels of triggering receptor expressed on myeloid cells-1 (TREM-1), IFNγ, IL-1α, IL-1β, IL-16, and IL-17A are lower in the S. rectivirgula-exposed PKD1mKO mouse compared to those in the S. rectivirgula-exposed WT mouse ( Supplementary Figure 9 ). In contrast, levels of tissue inhibitor of metalloproteinase-1 (TIMP-1), macrophage colony stimulating factor (M-CSF), CCL1, and IL-7 are higher in the S. rectivirgula-exposed PKD1mKO mouse than in the S. rectivirgula-exposed WT mouse. This result indicates a possibility that PKD1 in myeloid lineage cells may contribute to promoting the inflammatory Th1 and Th17 environment in the lung in HP. To further investigate whether deletion of PKD1 in myeloid lineage cells affects the expression of Th1- and Th17-related cytokines and chemokines in the lungs following repeated exposures to S. rectivirgula, we analyzed protein and mRNA expression levels of Th1- and Th17-related cytokines and chemokines in the BALF and lung tissues of WT mice and PKD1mKO mice repeatedly exposed to S. rectivirgula for 3 weeks. As shown in Figures 7A, B , the levels of both protein (in BALF) and mRNA (in lung tissue) of IFNγ and IL-17A in WT mice following repeated exposures to S. rectivirgula were significantly increased compared to those in saline-exposed control mice. In contrast, the levels of IFNγ in BALF and lungs of PKD1mKO mice exposed to S. rectivirgula repeatedly for 3 weeks were not significantly different from those from saline-exposed control mice. The levels of IL-17A (both protein and mRNA) were significantly higher in S. rectivirgula-exposed PKD1mKO than in saline-exposed control. When compared to those in S. rectivirgula-exposed WT mice, the levels of IFNγ and IL-17A in BALF and lung tissue obtained from PKD1mKO mice repeatedly exposed to S. rectivirgula were significantly reduced ( Figures 7A, B ). The mRNA levels of Th1/Th17-related cytokine IL-12p40 and IL-23p19 in the lung tissues of PKD1mKO mice repeatedly exposed to S. rectivirgula for 3 weeks were significantly reduced compared to those in S. rectivirgula-exposed WT mice, but comparable to those in saline-exposed control ( Figure 7B ). The mRNA levels of proinflammatory cytokine TNFα in lungs of PKD1mKO mice repeatedly exposed to S. rectivirgula for 3 weeks were significantly reduced compared to those in S. rectivirgula-exposed WT mice, but significantly higher than those in saline-exposed control ( Supplementary Figure 10A ). IL-6 mRNA levels in the lungs were not significantly different between saline-exposed control mice, S. rectivirgula-exposed WT mice, and S. rectivirgula-exposed PKD1mKO under our experimental condition ( Supplementary Figure 10A ). Taken together, these results indicate that although it is not indispensable, PKD1 in myeloid lineage cells plays a significant role in the expression of Th1- and Th17-related cytokines in mouse lungs following repeated exposures to S. rectivirgula.

Chemokines regulate leukocyte migration, differentiation, and activation by interacting with specific receptors expressed on surface of leukocytes. Chemokines CXCL9, CXCL10, and CXCL11 interact with cell surface chemokine receptor CXCR3 and contribute to Th1 polarization (74). Chemokine CCL20 binds to chemokine receptor CCR6 and contribute to the Th17 polarization (75). We further investigate whether PKD1 in myeloid linage cells contributes to the S. rectivirgula-mediated expression of these chemokines involved in Th1/Th17 polarization. As demonstrated in Figure 7C , levels of mRNA expression of CXCL9, CXCL10, CXCL11, and CCL20 in the lungs of WT mice repeatedly exposed to S. rectivirgula for 3 weeks were significantly increased compared to those of control mice exposed to saline for 3 weeks. Compared to the expression level in WT mice, expression levels of CXCL9, CXCL10, and CXCL11 in lungs of PKD1mKO mice following repeated exposure to S. rectivirgula were significantly suppressed. Expression levels of CXCL9, CXCL10, and CXCL11 in lungs of PKD1mKO mice exposed to S. rectivirgula repeatedly for 3 weeks were not significantly different from those from saline-exposed control mice. The mRNA levels of CCL20 in lungs of PKD1mKO mice repeatedly exposed to S. rectivirgula for 3 weeks were significantly reduced compared to those in S. rectivirgula-exposed WT mice, but significantly higher than those in saline-exposed control. The mRNA expression levels of CCL5, CXCL12, and CXCL16 in the lungs were not different between saline-exposed control mice, S. rectivirgula-exposed WT mice, and S. rectivirgula-exposed PKD1mKO mice under our experimental condition ( Supplementary Figure 10B ). Taken together, these results demonstrate that PKD1 in myeloid lineage cells contributes significantly to the expression of Th1- and Th17-related cytokines IFNγ, IL-12, IL-17A, and IL-23 and Th1- and Th17-polarizing chemokines CXCL9, CXCL10, CXCL11, and CCL20 following repeated exposures to S. rectivirgula. Our results indicate that PKD1 in myeloid lineage cells might play a pivotal role in the influx and development of pathogenic Th1 and Th17 cells in the lungs in HP caused by repeated exposures to S. rectivirgula.

Because of the reduced MHC-II surface expression on myeloid linage cells and reduced expression of cytokines and chemokines that are known to be critical for Th cell lineage development and chemotaxis in lungs of PKD1mKO repeatedly exposed to S. rectivirgula, we investigated whether PKD1 deletion in myeloid lineage cells affect the CD4⁺ T-cell accumulation and activation in the lungs following exposures to S. rectivirgula. Figure 8B shows that the number of CD4⁺ T cells recovered from BAL of PKD1mKO repeatedly exposed to S. rectivirgula for 3 weeks was substantially lower compared to that of WT. In addition, surface expression levels of an activation marker CD69 on CD4⁺ T cells were significantly reduced in PKD1mKO compared to those in WT. These results indicate that PKD1 in myeloid lineage cells contributes to influx and activation of CD4⁺ T cell in the lungs.

Chemokine receptors expressed on Th cells generally reflect the lineage of Th cells (76, 77). Th1 cells that produce IFNγ express CXCR3 but not CCR4 and CCR6. Th2 cells that produce IL-4 express CCR4 but not CXCR3 and CCR6. Th17 cells that produce IL-17 express CCR6 but not CXCR3 and CCR4. Under certain pathologic conditions, Th17 cells acquire the ability to express CXCR3 and produce both IFNγ and IL-17. These CXCR3⁺CCR6⁺ CD4⁺ T cells are called nonconventional Th1 cells or pathogenic Th1/Th17 cells (76, 77). The observed reduction in the expression of chemokines CXCL9, CXCL10, CXCL11, and CCL20 in PKD1mKO mice (compared to WT mice) in response to repeated exposures to S. rectivirgula predicts reduced recruitment of CXCR3⁺ Th1 cells and CCR6⁺ Th17 cells into the lungs in PKD1mKO following repeated exposures to S. rectivirgula. Thus, we investigated whether deletion of PKD1 in myeloid lineage cells influences accumulation of Th1 and/or Th17 cells into lungs of mice following repeated exposures to S. rectivirgula.

We analyzed CD4⁺ T cells expressing CXCR3 and/or CCR6 in the bronchoalveaolar spaces ( Figure 8A ) and CD4⁺ T cells expressing IFNγ and/or IL-17A in the lung interstitium ( Figure 9A ). As shown in Figure 8C , compared to WT mice repeatedly exposed to S. rectivirgula for 3 weeks, the frequency of CXCR3⁺CCR6^- cells (Th1 cells) among CD4⁺ T cells was significantly increased in the bronchoalveaolar spaces of PKD1mKO mice repeatedly exposed to S. rectivirgula for 3 weeks. However, the number of CXCR3⁺CCR6^-CD4⁺ T cells recovered from BAL was not significantly different between WT and PKD1mKO. Surface expression levels of CD69 on CXCR3⁺CCR6^-CD4⁺ T cells were significantly lower in PKD1mKO than in WT. Intracellular staining of LICs for IFNγ and IL-17A showed that frequencies of IFNγ⁺IL-17A^- cells (Th1 cells) among CD4⁺ T cells isolated from lung interstitium were comparable between WT and PKD1mKO exposed to S. rectivirgula for 3 weeks ( Figure 9B ). Judged by the lower levels of lung-infiltrated leukocytes and the lower frequency of CD45⁺ cells isolated from lung interstitium ( Figure 5B ; Supplementary Figure 6 ; Supplementary Table 2 ), the actual number of IFNγ⁺IL-17A^-CD4⁺ T cells in lung interstitium of PKD1mKO exposed to S. rectivirgula for 3 weeks may be lower compared to that in WT exposed to S. rectivirgula for 3 weeks. These results indicate that PKD1 deletion in myeloid lineage cells may not significantly affect the CXCR3⁺CCR6^- classical Th1 cell infiltration into the bronchial airway and lung interstitium in the lung following repeated exposures to S. rectivirgula.

Frequency and number of CXCR3^-CCR6⁺ cells (Th17 cells) among CD4⁺ T cells in the bronchoalveaolar spaces of PKD1mKO repeatedly exposed to S. rectivirgula for 3 weeks was significantly lower than those in WT ( Figure 8D ). Surface expression levels of CD69 on CXCR3^-CCR6⁺CD4⁺ T cells were comparable between WT and PKD1mKO exposed to S. rectivirgula for 3 weeks. Frequencies of IFNγ^-IL-17A⁺ cells (Th17 cells) among CD4⁺ T cells isolated from lung interstitium were also comparable between WT and PKD1mKO exposed to S. rectivirgula for 3 weeks ( Figure 9B ). Judged by the lower levels of lung-infiltrated leukocytes and the lower frequency of CD45⁺ cells isolated from lung interstitium ( Figure 5B ; Supplementary Figure 6 ; Supplementary Table 2 ), the actual number of IFNγ^-IL-17A⁺CD4⁺ T cells in lung interstitium of PKD1mKO exposed to S. rectivirgula for 3 weeks may be considerably lower compared to that in WT exposed to S. rectivirgula for 3 weeks. These results indicate that CXCR3^-CCR6⁺ classical Th17 cells are a minor Th cell subpopulation in both bronchoalveaolar spaces and lung interstitium after 3-week exposures to S. rectivirgula and that PKD1 deletion in myeloid lineage cells may significantly affect the CXCR3^-CCR6⁺ classical Th17 cell accumulation in the bronchoalveaolar spaces and lung interstitium following repeated exposures to S. rectivirgula.

As shown in Figure 8E , both the frequency and number of CXCR3⁺CCR6⁺CD4⁺ T cells (which is known as nonconventional Th1 cell or pathogenic Th1/Th17 cells) in the bronchoalveaolar spaces were significantly reduced in PKD1mKO mice repeatedly exposed to SR for 3 weeks compared to those in WT. In addition, surface expression levels of CD69 on CXCR3⁺CCR6⁺CD4⁺ T cells in the bronchoalveaolar spaces of PKD1mKO exposed to S. rectivirgula for 3 weeks were significantly lower than CD69 levels on CXCR3⁺CCR6⁺CD4⁺ T cells from WT mice exposed to S. rectivirgula for 3 weeks. Frequencies of IFNγ⁺IL-17A⁺ cells (nonconventional Th1 cells) among CD4⁺ T cells isolated from the lung interstitium of PKD1mKO exposed to S. rectivirgula for 3 weeks were substantially, but not significantly (p = 0.845), lower than those of WT exposed to S. rectivirgula for 3 weeks ( Figure 9B ). Judged by the lower levels of lung-infiltrated leukocytes and the lower frequency of CD45⁺ cells isolated from lung interstitium ( Figure 5B ; Supplementary Figure 6 ; Supplementary Table 2 ), the actual number of IFNγ⁺IL-17A⁺CD4⁺ T cells in the lung interstitium of PKD1mKO exposed to S. rectivirgula for 3 weeks may be significantly lower compared to that in WT exposed to S. rectivirgula for 3 weeks. These results demonstrate that CXCR3⁺CCR6⁺ nonconventional Th1 cells are the major Th cell subpopulation in the bronchoalveaolar spaces, while it is the minor Th cell subpopulation in lung interstitium, following 3-week exposures to S. rectivirgula and that PKD1 in myeloid lineage cells contribute significantly to accumulation and activation of CXCR3⁺CCR6⁺ nonconventional Th1 cells in the lung following repeated exposures to S. rectivirgula. Taken together, our results indicate that PKD1 in myeloid lineage cells contributes to the accumulation of pathogenic Th1/Th17 cells in the lungs in HP caused by repeated exposures to S. rectivirgula.