Wild-type C57BL/6J female mice, 8 weeks old, were used in the experiments. They were obtained at the Multidisciplinary Center for Biological Research in the Area of Science in Laboratory Animals (CEMIB – UNICAMP), and they were housed in a specific pathogen-free facility of the Institute of Biology (UNICAMP). The temperature was kept between 21-23°C, and a standard light-dark cycle of 12 h was applied. The animals received sterile drinking water and food (Nuvilab - Quimtia) ad libitum. No animal was excluded during experiments. Mice were littermates and were randomly allocated into cohorts. Mice health was monitored daily. The study followed the updated recommendations of the National Council for the Control of Animal Experimentation (CONCEA), and it was approved by the UNICAMP Animal Ethics Committee (CEUA/UNICAMP), with registration number 4884-1/2018.

We used the neuroantigen myelin oligodendrocyte glycoprotein 35-55 peptide (MOG35-55) (N-MEVGWYRSPFSRVVHLYRNGK-C) (Genemed Synthesis, Tx, USA) for immunization. The mice were immunized blindly with 100 µg MOG35-55 diluted in 50 µL of phosphate-buffered saline (PBS) emulsified in equal volume with Complete Freund’s Adjuvant (CFA) (Sigma-Aldrich, F5881, MO, USA), which was supplemented with 4 mg/mL of inactivated Mycobacterium tuberculosis (MT, H37RA) (BD Difco, DF3114-33-8, USA). The emulsion was administered to the axillary region of each mouse subcutaneously. Immediately after immunization, and two days later, 200 ng of Pertussis toxin (Sigma-Aldrich, P7208, MO, USA) were injected intraperitoneally per animal. We monitored the clinical signs of EAE daily after the seventh day of immunization. The evolution of the disease was graded blindly as follows: score 0 = not sick; score 1 = loss of tail tone; score 2 = loss of movement of both hind legs, paraplegia; score 3 = paraplegia, loss of abdominal muscles, abdominal weight loss; score 4 = quadriplegia; score 5 = death. Mice at score 4 were closely monitored and a humane endpoint was applied before score 5 was reached. EAE onset was the first day a mouse showed clinical symptoms. Cumulative score corresponded to the sum of scores starting from onset until the last day of observation divided by the number of mice in the group.

We grounded DMF crystals (Sigma-Aldrich, 242926, MO, USA) and mixed them in PBS prepared with sterile tap water to obtain a dose of 7.5 mg/kg. We considered the standard mass of the mice as 20 g. We prepared fresh doses every day and mixed them vigorously before each administration. Mice with EAE were divided into groups receiving 100 µL of the vehicle (PBS) or DMF every 12 h, by gavage, starting from the third day post immunization (d.p.i.). For EAE monitoring, mice were treated daily until the 20^th d.p.i. In other experiments, mice were treated daily for either 5, 10, or 15 days, corresponding to the days 7, 12, and 17 d.p.i., respectively. Tissues were collected in the morning after the final gavage for each time point.

For spinal cord histology on the 21^st d.p.i., animals were anesthetized and euthanized, and the spinal cord was removed and immersed in 4% PFA for 48h. The tissues were transferred to a solution of 70% ethanol, and then they were sent to paraffin embedding, and hematoxylin and eosin (HE) staining at Histocell, SP, BR. Additionally, the longitudinal sections of the spinal cord (4 µm thick) were stained with Luxol fast blue-Cresyl violet to visualize myelin. Cellular infiltrates in the HE-stained samples were quantified using ImageJ 2.14.0. The white matter area was delineated, and infiltrates within were identified. Five sections were analyzed for each mouse.

We removed aseptically all mesenteric lymph nodes (mLN), small intestine and colonic mLN, and grounded them against a 70-µm cell strainer to obtain a cell suspension rich in leukocytes.

To obtain the total RNA from mLN cells, we used the Trizol (Invitrogen, 15596018, USA) extraction method, according to the manufacturer’s instructions. The purity and concentration of the nucleic acids were analyzed using nanodrop equipment (Thermo Scientific 2000). We converted the extracted mRNA to cDNA using the High-Capacity cDNA conversion kit (Applied Biosystems, 4368814, USA), also according to the manufacturer’s instructions. For each reaction, an amount of 1 µg of total RNA was added. The cDNA conversion was performed in a thermocycler (Eppendorf AG 6321 BK016651) with the following incubation steps: 25°C for 10 min, 37°C for 2 h, 85°C for 5 min, ending at 4°C.

For analyzing most cytokines and transcription factor expression, we applied the Taqman technique with the LuminoCt^® qPCR ReadyMix™ (Sigma-Aldrich, L6669, USA). Briefly, we mixed the diluted (1:20) cDNA with the manufacturer’s master mix in duplicate. We added the following primers for the transcript’s amplification (all from Applied Biosystems, USA): Foxp3 Mm00475162_m1, Tgfb1 Mm01178820_m1, Tnf Mm00443258_m1, Il10 Mm01288386_m1, Ifng Mm01168134_m1, Il-12a Mm01208555_m1, Il17a Mm00439618_m1, and Il27 Mm00461164_m1. As a reference, we used Beta-2-Microglobulin (B2m) Mm00437762_m1. For the expression of IL-6, we used the SyBR Green chemistry with the LuminoCt^® SYBR^® Green qPCR ReadyMix™ (Sigma-Aldrich, L6544, USA). Primer sequences were Il6 (Forward CACGGCCTTCCCTACTTCAC; Reverse TGCAAGTGCATCATCGTTGT) and B2m (Forward ACAGTTCCACCCGCCTCACATT; Reverse TAGAAAGACCAGTCCTTG CTGAAG), (Exxtend, BR). The expression level was calculated as 2-ΔCt and the data were normalized by the mean expression of the control group.

To analyze cytokine production, the mLN cells were incubated with 25 ng/mL Phorbol 12-myristate 13-acetate (PMA), 1 µg/mL Ionomycin, and 5 µg/mL Brefeldin A in RPMI 1640 medium supplemented with 5% of Fetal Bovine Serum (FBS) during 4 h, at 37°C. Then, the cells were stained with extracellular markers, for 30 min, in PBS. For intracellular staining, a permeabilization and fixation buffer (Invitrogen, 00-5523-00, USA) was used. We incubated the cells with the intracellular markers in the permeabilization buffer overnight. The samples were washed, and the data were acquired and analyzed in a BD FACSymphony A5 flow cytometer (BD Bioscience, USA). We analyzed the cytometry data in the FlowJo software. Extracellular antibodies: CD3 PE (555275, BD), CD4 PerCP Cy 5.5 (116012, Biolegend), CD8a PE Cy 7 (100722, Biolegend), CD11c APC Cy 7 (561241, BD), CD11b BV421 (560625, BD), XCR1 APC (148206, Biolegend), CD103 PerCP Cy 5.5 (563637BD). Intracellular antibodies: Foxp3 APC (17577382, eBioscience), IL-10 BV650 (564083, BD), TGFbeta 1,2,3 Alexa 700 (IC1835N, R&D Systems).

The mLN cells (1 x 10⁶ cells/mL) were cultured in RPMI 1640 medium supplemented with 10% FBS and stimulated with lipopolysaccharide (LPS), 0.1 µg/mL, for 24h. The levels of PGE2 in the cell culture supernatant were quantified by ELISA assay (R&D Systems, SKGE004B, USA) according to manufacturer instructions. We quantified the T cells’ cytokines of the undiluted cell culture supernatants using the BD™ CBA Mouse Th1/Th2/Th17 Cytokine Kit (BD, 560485, USA). The acquisition was performed in a BD FACSCalibur flow cytometer (BD Bioscience, USA).

Statistical analyses were performed using non-parametric tests in the GraphPad Prism 9 software. Outliers detected by the Grubbs method (alfa = 0.05) were excluded. The Kruskal-Wallis test was applied to compare three or more groups, and the Mann-Whitney test was used to compare pairs. Differences were considered significant with a P-value < 0.05. The n was determined according to the formula n= 1 + [2C*(s/d)2], for which we considered P < 0.05 (90% power and significance level 0.05 – C value is 10.51). Considering the maximum deviation of 20% and the difference between groups of 50%.

Dimethyl fumarate was administrated orally every 12h at 7.5 mg/kg, and PBS was used as a vehicle, following the literature (1, 13–15). Figure 1A shows the evolution of clinical signs of EAE for 20 days. The mean onsets of EAE were similar in both the Control (11 ± 1.5) and DMF (11 ± 1.7) groups. The control group had 100% incidence of symptoms, with a maximum score of 3.3 ± 1.2 and a cumulative score of 20.1 per mouse, whereas the DMF group showed a 62.5% of EAE incidence, with a maximum score of 1.1 ± 1.2 and a cumulative score of 8.4 per mouse. These results demonstrate a significant reduction in the severity of EAE in mice receiving 7.5 mg/kg DMF. Additionally, we compared cellular infiltration in the spinal cords of DMF-treated mice with EAE symptoms to those in the EAE control group, observing a trend towards decreased inflammatory infiltration in DMF-treated mice ( Figure 1B ). It should be noted, however, that only the most severely affected mice were selected for HE staining, which could introduce bias to our results by potentially masking a significant reduction in CNS inflammation. A previous study has reported decreased inflammatory infiltration and reduced demyelination with DMF treatment (14). After confirming the protective effects in EAE, we subsequently treated EAE mice with 7.5 mg/kg DMF or the vehicle for 5, 10, or 15 days and analyzed the immune response in the mesenteric lymph nodes (mLN) ( Figure 1C ).

Flushing and intestinal discomfort are important side effects of DMF treatment. Previous studies demonstrated that the binding of MMF to HCAR2/GPR109A on Langerhans cells promotes the production of Prostaglandin E2 (PGE2), which may explain, at least in part, the flushing effects in the skin (16). The production of PGE2 by macrophages/dendritic cells plays an important role in the pathogenesis of EAE, mainly in the regulation of CD4 Th17 cells (17, 18).

Here, we show an increase in the CD11c+ cells from the mLN ( Figure 2A ) and in the release of PGE2 by mLN cells on the 10^th day of treatment with DMF ( Figure 2B ). As the treatment and the disease progress (15^th), the production of PGE2 in treated mice keeps steady, while there is a significant increase in PGE2 production by mLN cells of EAE mice without treatment. It should be noted that the 17^th day of post-immunization (here the 15^th day of treatment) usually corresponds to the peak of EAE, when autoreactive T lymphocytes are circulating throughout the body of mice, leading to systemic inflammation (19).

EAE had long been considered the prototypic of both Th1 and Th17-mediated autoimmune disease (20). Here, we demonstrate that the initial treatment with DMF stimulates a pro-inflammatory environment in the gut. We analyzed the conventional DCs type 2 from the mLN, which are CD11c+ XCR1- (21), by flow cytometry. We observed an increase in the CD103- CD11b+ DC population ( Figure 2C ) after 5 days of treatment. Intestinal CD103- DCs might migrate to mLN and promote the production of pro-inflammatory cytokines by effector cells (22).

The treatment with DMF initially favored the expression of innate immune response pro-inflammatory cytokines in the mLN, such as TNF ( Figure 2D ) and IL-12a ( Figure 2E ) mRNA. In addition, we saw an expressive increase in the production of IFN-γ ( Figure 2F ) and IL-17A ( Figure 2G ) mRNA within 5 days of treatment. The expression of IL-6 mRNA was similar to the control group during the analysis period ( Supplementary Figure 4A ).

The mLN cells were also stimulated ex-vivo with LPS for 24h to evaluate cytokine production. The levels of TNF and IL-6 ( Figure 2H ) were higher in cells from DMF-treated animals after 5 days of treatment. There were no changes in other Th1, Th2, and Th17 cytokines levels after the LPS stimulus ( Supplementary Figure 4B–F ).

Interestingly, this initial pro-inflammatory profile is accompanied by regulation in DMF-treated mice. The oral administration of DMF increases the Foxp3 expression on CD4 T lymphocytes in mLN by the 5^th day ( Figure 3A ). In addition, higher transcription of Foxp3 ( Figure 3B ), IL-10 ( Figure 3C ), and TGF-β ( Figure 3D ) by mLN cells are observed. A small population of Foxp3 CD4 T cells producing TGF-β increased during 5 days of DMF treatment (data not shown). We attribute this result to the characteristics of DMF. Within the intestine, DMF is transformed into its active metabolite MMF, which binds to the HCAR2 receptor on dendritic cells. It is well described in the literature that small-chain fatty acids, such as butyrate, utilize this same HCAR2 receptor to reduce the inflammatory response in the intestine and promote the activation of the CD4+Foxp3+ Treg population (23, 24). Moreover, Round and Mazmanian have demonstrated that oral administration of a fraction of Bacteroides fragilis leads to an increase in CD4+Foxp3+ T reg in mesenteric lymph nodes in mice, and either CD4+Foxp3+ or CD25+Foxp3+ had a regulatory function (25).

After a few days, the expression of pro- and anti-inflammatory molecules was similar in DMF and control groups. In fact, by the 10^th day, TNF transcription even decreased in DMF-treated mice ( Figure 2D ), and IFN-γ expression was also reduced ( Figure 2F ).

Further during treatment, the DMF stimulated an anti-inflammatory environment in the mLN of C57BL/6J mice. We observed an increase in the expression of IL-27 (after 15 days). IL-27 is a pleiotropic cytokine released by antigen-presenting cells (APC), which modulates several immune cells, including myeloid cells and T cells. A significantly higher IL-27 expression was observed in the group that received DMF for 15 days ( Figure 4A ).

Our findings demonstrate that oral administration of DMF induces an increase of regulatory T cells of gut-draining lymph nodes of C57BL/6J mice with EAE. A significant increase in IL-10-producing CD4 T lymphocytes was observed after 15 days of treatment ( Figure 4B ). There is no expression of Foxp3 in this cell population, suggesting that it belongs to the Tr1 subset of regulatory T cells (26). We also showed a significant increase in IL-10 production by Foxp3^- CD8 T lymphocytes after 15 days of treatment ( Figure 4C ). The proportion of Foxp3 T reg cells was the same in treated and control mice during the observed period (data not shown).