<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2024.1383464</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Immunology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>
<italic>Acanthopanax senticosus</italic> improves cognitive impairment in Alzheimer&#x2019;s disease by promoting the phosphorylation of the MAPK signaling pathway</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Zhang</surname>
<given-names>Zhichun</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2649921"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Wu</surname>
<given-names>Yonghui</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Shi</surname>
<given-names>Dan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Jiang</surname>
<given-names>Chanyu</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Cao</surname>
<given-names>Hengyan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Jiang</surname>
<given-names>Fengyi</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Bao</surname>
<given-names>Xiaomin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Shen</surname>
<given-names>Yan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2196949"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Shi</surname>
<given-names>Xiao</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Department of Gerontology, Yueyang Hospital of Integrated Traditional Chinese and Western Medicine</institution>, <addr-line>Shanghai</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Graduate School of Shanghai University of Traditional Chinese Medicine</institution>, <addr-line>Shanghai</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Ping Yuan, Tongji University, China</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Kim Cuong Cap, Houston Methodist Research Institute, United States</p>
<p>Wengong Wang, Peking University, China</p>
<p>Rong Jiang, Tongji University, China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Xiao Shi, <email xlink:href="mailto:mdshixiao@163.com">mdshixiao@163.com</email>; Yan Shen, <email xlink:href="mailto:sheny26@126.com">sheny26@126.com</email>
</p>
</fn>
<fn fn-type="equal" id="fn003">
<p>&#x2020;These authors have contributed equally to this work</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>13</day>
<month>03</month>
<year>2024</year>
</pub-date>
<pub-date pub-type="collection">
<year>2024</year>
</pub-date>
<volume>15</volume>
<elocation-id>1383464</elocation-id>
<history>
<date date-type="received">
<day>07</day>
<month>02</month>
<year>2024</year>
</date>
<date date-type="accepted">
<day>26</day>
<month>02</month>
<year>2024</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2024 Zhang, Wu, Shi, Jiang, Cao, Jiang, Bao, Shen and Shi</copyright-statement>
<copyright-year>2024</copyright-year>
<copyright-holder>Zhang, Wu, Shi, Jiang, Cao, Jiang, Bao, Shen and Shi</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>
<italic>Acanthopanax senticosus</italic> (AS) can improve sleep, enhance memory, and reduce fatigue and is considered as an effective drug for Alzheimer&#x2019;s disease (AD). The therapeutic effect and mechanism need to be further investigated.</p>
</sec>
<sec>
<title>Methods</title>
<p>To confirm the AS play efficacy in alleviating memory impairment in mice, 5&#xd7;FAD transgenic mice were subjected to an open-field experiment and a novelty recognition experiment. Network pharmacology technique was used to analyze the information of key compounds and potential key targets of AS for the treatment of AD, molecular docking technique was applied to predict the binding ability of targets and compounds, and Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were also performed on the targets to derive the possible metabolic processes and pathway mechanisms of AS in treating AD. Quantitative real-time PCR (qRT-PCR) and western blot technique were carried out to validate the candidate genes and pathways.</p>
</sec>
<sec>
<title>Results</title>
<p>In the open-field experiment, compared with the wild-type (WT) group, the number of times the mice in the AD group crossed the central zone was significantly reduced (<italic>P</italic>&lt; 0.01). Compared with the AD group, the number of times the mice in the AS group crossed the central zone was significantly increased (<italic>P</italic>&lt; 0.001). In the new object recognition experiment, compared with the WT group, the percentage of times the AD group explored new objects was significantly reduced (<italic>P</italic>&lt; 0.05). Compared with the AD group, the AS group had an increase in the percentage of time spent exploring new things and the number of times it was explored (<italic>P</italic>&lt; 0.05). At the same time, the donepezil group had a significantly higher percentage of times exploring new things (<italic>P</italic>&lt; 0.01). By using network pharmacology technology, 395 common targets of AS and AD were retrieved. The Cytoscape software was used to construct the protein&#x2013;protein interaction (PPI) network of common targets. Using the algorithm, nine key targets were retrieved: APP, NTRK1, ESR1, CFTR, CSNK2A1, EGFR, ESR2, GSK3B, and PAK1. The results of molecular docking indicate that 11 pairs of compounds and their corresponding targets have a significant binding ability, as the molecular binding energies were less than -7.0. In comparison to the AD group, the mRNA expression of the key target genes was significantly decreased in the AS treatment group (<italic>P</italic>&lt; 0.001). The KEGG analysis showed that the MAPK signaling pathway was significantly enriched, and Western blot confirmed that the TRAF6 protein decreased significantly (<italic>P</italic>&lt; 0.0001). Meanwhile, the levels of MAP3K7 and P38 phosphorylation increased, and there was also an increase in the expression of HSP27 proteins.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>Our study indicates that the multi-component and multi-target properties of AS play an important role in the alleviation of anxiety and memory impairment caused by AD, and the mechanism is involved in the phosphorylation and activation of the MAPK signaling pathway. The results of this study could provide a novel perspective for the clinical treatment of AD.</p>
</sec>
</abstract>
<kwd-group>
<kwd>
<italic>Acanthopanax senticosus</italic>
</kwd>
<kwd>Alzheimer&#x2019;s disease</kwd>
<kwd>network pharmacology</kwd>
<kwd>MAPK signaling pathway</kwd>
<kwd>neuroinflammation</kwd>
</kwd-group>
<counts>
<fig-count count="4"/>
<table-count count="3"/>
<equation-count count="0"/>
<ref-count count="44"/>
<page-count count="11"/>
<word-count count="5123"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Inflammation</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Alzheimer&#x2019;s disease (AD) is the most common neurodegenerative disease which is a common cause of dementia, and the incidence of AD gradually increases with age (<xref ref-type="bibr" rid="B1">1</xref>). The clinical manifestations include memory loss, disorientation, and language impairment. The patient&#x2019;s ability to handle social affairs and self-care will decline as the condition worsens (<xref ref-type="bibr" rid="B2">2</xref>). Current hypothesis for the pathogenesis of AD include A&#x3b2; plaque-related neurodegeneration, neurofibrillary tangles, synaptic dysfunction and neurotransmitter imbalance, and neuroinflammation (<xref ref-type="bibr" rid="B3">3</xref>). FDA-approved drugs including donepezil, rivastigmine, and galantamine are mainly used to treat &#x3b2;-amyloid deposition and tau fiber tangles, but the effect is not significant (<xref ref-type="bibr" rid="B3">3</xref>, <xref ref-type="bibr" rid="B4">4</xref>). More and more studies showed that neuroinflammation played a key role in AD neurodegeneration, and how to control the inflammatory response caused by A&#x3b2; protein provides a new research direction for the treatment of AD (<xref ref-type="bibr" rid="B5">5</xref>&#x2013;<xref ref-type="bibr" rid="B7">7</xref>).</p>
<p>Related research showed (<xref ref-type="bibr" rid="B8">8</xref>&#x2013;<xref ref-type="bibr" rid="B10">10</xref>) that traditional Chinese medicine with multiple components, targets, and pathways can treat AD by improving neurocholine function, reducing inflammatory response, and resisting oxidative stress. <italic>Acanthopanax senticosus</italic> (AS) is a Wujiaceae plant that can improve sleep, enhance memory, and reduce fatigue (<xref ref-type="bibr" rid="B11">11</xref>). Relevant experimental studies have shown that AS extract can significantly enhance mice&#x2019;s object recognition memory (<xref ref-type="bibr" rid="B12">12</xref>); EEAK (ethanol extract of AS) can improve cognitive dysfunction caused by cholinergic blockade and improve the performance of mice in Y-maze and novel object recognition experiments (<xref ref-type="bibr" rid="B13">13</xref>). ML Jinc et&#xa0;al. found that (<xref ref-type="bibr" rid="B14">14</xref>) AS can induce the expression of HO-1 through the p38-CREB and Nrf2 pathways, thereby reducing the expression of pro-inflammatory mediators such as iNOS, COX-2, and NO in LPS-stimulated BV2 cells, and has a neuroprotective effect. Therefore, AS is considered to have a certain therapeutic effect on AD, but its possible mechanism is still unclear.</p>
<p>This study intends to verify the therapeutic effect of the traditional Chinese medicine AS on AD through system network pharmacology, molecular docking technology, and animal experiments, explore the relevant molecular mechanisms, and provide more scientific basis for the clinical treatment of AD.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Preparation and feeding of experimental animal models</title>
<p>Specific-pathogen-free (SPF)-grade 5&#xd7;FAD transgenic mice were obtained from the Model Animal Research Institute of Nanjing University (Animal Qualification Certificate No. 201400975) and kept under SPF conditions. The animal experiments were approved by the Animal Care and Use Committee of Shanghai University of Traditional Chinese Medicine (ethics number: PZSHUTCM210702001).</p>
<p>5&#xd7;FAD transgenic mice were cross-bred with C57BL/6J mice. The mice were raised in separate cages according to their gender after 20 days of life. Their tails were docked at 30 days for genetic identification of mouse breeds, and 5&#xd7;FAD mice were selected as the <italic>Acanthopanax senticosus</italic> treatment group (AS group), the donepezil hydrochloride treatment group (donepezil group), and the model group (AD group), while the C57BL/6J mice in the same litter were the blank group (WT group), with 12 mice in each group. After 2 months of regular feeding of the mice, the AS group was changed to a diet supplemented with 1.69 mg/kg of <italic>Acanthopanax senticosus</italic> (Heilongjiang Ussuri River Harbin Branch, batch no. 20210501), and the donepezil group was changed to a diet containing 3.8 g/kg of the drug, donepezil hydrochloride tablets (Sibohai, Phyllanthus Bio-Technology Co. Ltd, batch no. 21030004). All the drug-containing diets were manufactured by Jiangsu Synergy Pharmaceutical and Biological Engineering Co. Ltd., and animal tissues were acquired after 3 months of continuous feeding.</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Animal experiment</title>
<sec id="s2_2_1">
<label>2.2.1</label>
<title>Open-field experiment</title>
<p>The test box for the open-field experiment consisted of four square opaque boxes with a length, width, and height dimension of 50 &#xd7; 50 &#xd7; 40&#xa0;cm, and a square area of 20&#xd7;20 cm in the center of the test box was designated as the analysis area. Each mouse was allowed to move freely in the test box for 5&#xa0;min, and the total distance traveled, the average speed of movement, and the number of times the mice crossed the central area of the experimental site were recorded by using Ethovision XT 11.5 image acquisition and analysis software for the different groups. The experimental environment was kept quiet, and the test chamber was wiped with 75% alcohol after each round of experiments.</p>
</sec>
<sec id="s2_2_2">
<label>2.2.2</label>
<title>Novelty recognition experiment</title>
<p>The test chambers for the novelty recognition experiment consisted of four square opaque whiteboards measuring 50 &#xd7; 50 &#xd7; 40&#xa0;cm in length, width, and height, with two identical X-objects and Y-objects placed in the center of each chamber and secured with a transparent tape. The detection behavior of each mouse was recorded for 5&#xa0;min using Ethovision XT 11.5 image acquisition and analysis software. Approximately 1&#xa0;h after the abovementioned behavioral experiments, object Y was replaced by object Z, which was different in size, shape, and color from object Y, and then the mice were placed in the experimental field in the order of the sequence and moved randomly around the experimental field for 5&#xa0;min. The residence time and number of times the mice explored each object were recorded. The location preference index of the first trial was calculated as RI = Tx/(Ty + Tx) &#xd7; 100%, which was used to observe whether the experimental mice had a preference for toys X and Y, and whether there was a difference in curiosity between the toys, to determine whether the curious nature of the mice&#x2019;s exploration was normal. The formula for the experimental position preference index for the next 1&#xa0;h is RI = Tz/(Tz + Tx) &#xd7; 100%, which was used to determine the curiosity index of the experimental mice toward the novel object Z.</p>
</sec>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Network pharmacology analysis</title>
<sec id="s2_3_1">
<label>2.3.1</label>
<title>Component collection and target prediction</title>
<p>The TCMIP (<ext-link ext-link-type="uri" xlink:href="http://www.tcmip.cn/TCMIP/index.php/Home/Login/login.html">http://www.tcmip.cn/TCMIP/index.php/Home/Login/login.html</ext-link>) and HERB (<ext-link ext-link-type="uri" xlink:href="http://herb.ac.cn/">http://herb.ac.cn/</ext-link>) databases were searched using the keyword &#x201c;ciwujia&#x201d; (<italic>Acanthopanax senticosus</italic>, AS). The screening conditions were oral bioavailability (OB) &#x2265;0.3, drug likeness (DL) &#x2265;0.18, Lipinsk&#x2019;s five principles, and high gastrointestinal absorption, and we supplemented the literature with active ingredients that have clear utility in AS (<xref ref-type="bibr" rid="B15">15</xref>). The Swiss Target Prediction database (<ext-link ext-link-type="uri" xlink:href="http://www.swisstargetprediction.ch/">http://www.swisstargetprediction.ch/</ext-link>) was used to predict the targets of the relevant compounds. Using &#x201c;Alzheimer&#x2019;s disease&#x201d; as a keyword, the OMIM database (<ext-link ext-link-type="uri" xlink:href="https://www.omim.org/">https://www.omim.org/</ext-link>), TTD database (<ext-link ext-link-type="uri" xlink:href="http://db.idrblab.net/ttd/">http://db.idrblab.net/ttd/</ext-link>), and GeneCards database (<ext-link ext-link-type="uri" xlink:href="https://www.genecards.org/">https://www.genecards.org/</ext-link>) (score &#x2265;5) were searched, screened, and intersected to obtain AD-related disease targets.</p>
</sec>
<sec id="s2_3_2">
<label>2.3.2</label>
<title>Component&#x2013;target network construction of AS treatment for AD</title>
<p>The targets of AS and AD were imported into the Venny 2.1 online software mapping tool platform (<ext-link ext-link-type="uri" xlink:href="https://bioinfogp.cnb.csic.es/tools/venny/">https://bioinfogp.cnb.csic.es/tools/venny/</ext-link>) to draw a Venn diagram, and the common targets obtained were the potential targets of AS for AD. These potential targets and their corresponding compound data were processed with Cytoscape 3.7.2 software to construct a compound&#x2013;target network (CTN) of AS for AD.</p>
</sec>
<sec id="s2_3_3">
<label>2.3.3</label>
<title>Construct protein&#x2013;protein interaction network</title>
<p>Taking the target in the abovementioned CTN as the objective, IntAct, BioGrid, and STRING databases are used to construct the protein&#x2013;protein (PPI) network. The MCODE algorithm was used to filter the key clusters in the PPI network, construct the PPI network, and calculate the parameters of degree, degree centrality (DC), closeness centrality (CC), and betweenness centrality (BC) of the network and then select the core clusters according to the mean value.</p>
</sec>
<sec id="s2_3_4">
<label>2.3.4</label>
<title>GO enrichment analysis and KEGG pathway analysis</title>
<p>The DAVID database (<ext-link ext-link-type="uri" xlink:href="https://david.ncifcrf.gov/">https://david.ncifcrf.gov/</ext-link>) was used to perform Gene Ontology (GO) functional annotation of core targets, including Biological Process (BP), Cellular Component (CC), and Molecular Function (MF), and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis was performed to predict the possible pathway mechanisms of AS for AD.</p>
</sec>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Molecular docking</title>
<p>The core targets obtained from the PPI network were mapped to the CTN network to find the key compounds corresponding to the core targets. The 3D protein structure of the core target was retrieved from the PDB database (<ext-link ext-link-type="uri" xlink:href="https://www.rcsb.org/">https://www.rcsb.org/</ext-link>) as a receptor, and the receptor protein was subjected to pre-docking preparation operations such as dehydrogenation and hydrogenation by UCSF Chimera 1.16 software. Using the abovementioned key compounds as ligands, molecular docking was performed using Auto Dock Vina 1.1.2 software, and the pairs with binding energies &#x2264;-7.5 were visualized by Pymol 2.4.0 software.</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>qRT-PCR detection of key protein mRNA content</title>
<p>mRNA was extracted from the cerebral cortex of each group of mice using the TRIzol method. cDNA reverse transcription was performed at 25&#xb0;C for 5&#xa0;min, 55&#xb0;C for 10&#xa0;min, and 85&#xb0;C for 5 s. The PCR primers were purchased from Sangong Bioengineering (Shanghai) Co., Ltd., and the sequence of the primers (5&#x2032; to 3&#x2032;) is shown in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>. The reaction program was set at 95&#xb0;C for 30 s, 95&#xb0;C for 15 s, and 60&#xb0;C for 30 s in the quantitative PCR instrument (C1000 Touc, BIO-RAD). The results were expressed as 2<sup>-&#x394;&#x394;CT</sup> values and analyzed for statistical differences.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>qRT-PCR primer sequences.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Gene</th>
<th valign="top" align="left">Forward (o&#x2032;&#x2013; 3&#x2032;)</th>
<th valign="top" align="left">Reverse (e&#x2032;&#x2013; 3&#x2032;)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">GAPDH</td>
<td valign="top" align="left">AGGTCGGTGTGAACGGATTTG</td>
<td valign="top" align="left">TGTAGACCATGTAGTTGAGGTCA</td>
</tr>
<tr>
<td valign="top" align="left">APP</td>
<td valign="top" align="left">ACCCCAGATCGCCATGTTC</td>
<td valign="top" align="left">CCCACTTTCCATTCTGCACATTC</td>
</tr>
<tr>
<td valign="top" align="left">NTRK1</td>
<td valign="top" align="left">CAGTCTGATGACTTCGTTGATGC</td>
<td valign="top" align="left">CTCTTCACGATGGTTAGGCTTC</td>
</tr>
<tr>
<td valign="top" align="left">ESR1</td>
<td valign="top" align="left">CCCGCCTTCTACAGGTCTAAT</td>
<td valign="top" align="left">CTTTCTCGTTACTGCTGGACAG</td>
</tr>
<tr>
<td valign="top" align="left">CFTR</td>
<td valign="top" align="left">CTGGACCACACCAATTTTGAGG</td>
<td valign="top" align="left">GCGTGGATAAGCTGGGGAT</td>
</tr>
<tr>
<td valign="top" align="left">CSNK2A1</td>
<td valign="top" align="left">ATGTGGTGGAATGGGGGAATC</td>
<td valign="top" align="left">GCAAGTGTGATGATGTTGGGC</td>
</tr>
<tr>
<td valign="top" align="left">EGFR</td>
<td valign="top" align="left">GCATCATGGGAGAGAACAACA</td>
<td valign="top" align="left">TCAGGAACCATTACTCCATAGGT</td>
</tr>
<tr>
<td valign="top" align="left">ESR2</td>
<td valign="top" align="left">CTGTGCCTCTTCTCACAAGGA</td>
<td valign="top" align="left">TGCTCCAAGGGTAGGATGGAC</td>
</tr>
<tr>
<td valign="top" align="left">GSK3B</td>
<td valign="top" align="left">AAGCGATTTAAGAACCGAGAGC</td>
<td valign="top" align="left">AGAAATACCGCAGTCGGACTAT</td>
</tr>
<tr>
<td valign="top" align="left">PAK1</td>
<td valign="top" align="left">GAAACACCAGCACTATGATTGGA</td>
<td valign="top" align="left">ATTCCCGTAAACTCCCCTGTG</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>GAPDH, glyceraldehyde-3-phosphate dehydrogenase; APP, amyloid precursor protein; NTRK1, neurotrophic receptor tyrosine kinase 1; ESR1, estrogen receptor 1; CFTR, CF transmembrane conductance regulator; CSNK2A1, casein kinase 2 alpha 1; EGFR, epidermal growth factor receptor; ESR2, estrogen receptor 2; GSK3B, glycogen synthase kinase 3 beta; PAK1, P21 (RAC1) activated kinase 1.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Western blot to validate the pathway of action</title>
<p>An appropriate amount of mouse hippocampal tissue stored at -80&#xb0;C in the refrigerator was taken out, RIPA lysis buffer was added, and the tissue was disrupted with an ultrasonic crusher and centrifuged at 12,000 rpm for 15&#xa0;min. The supernatant was aspirated and 5&#xd7; Protein Loading Buffer (Beyotime, P0015) was added. The protein samples were heated in a water bath at 100&#xb0;C for 10&#xa0;min. Electrophoresis was performed at 120&#xa0;V for 80&#xa0;min, and the membranes were transferred to a new membrane. After blocking with 5% BSA solution for 2&#xa0;h, the primary antibody was incubated. The antibodies used for each sample were TRAF6 (#8028, CST, 1:1,000), anti-MAP3K7 (K008561P, Solarbio, 1:1,000), anti-p-MAP3K7 (K006194P, Solarbio, 1:1,000), P38 (#8690, CST, 1: 1,000), p-P38 (#4511, CST, 1:1,000), and HSP27 (#95357, CST, 1:1,000), overnight at 4&#xb0;C in the refrigerator. After three washes in TBST solution, secondary antibodies were used: anti-rabbit IgG, HRP-conjugated antibody (#7074, CST, 1:2,000) was incubated for 1&#xa0;h. The protein band signals were captured using the FL1000 Intelligent Imaging Scanning System (Thermo Fisher Scientific, USA). The protein band intensities were quantified using Image J (v1.45f) software.</p>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Statistical method</title>
<p>The experimental data obtained from all behavioral experiments were expressed as mean &#xb1; SD <inline-formula>
<mml:math display="inline" id="im1">
<mml:mrow>
<mml:mrow>
<mml:mo stretchy="false">(</mml:mo>
<mml:mrow>
<mml:mover accent="true">
<mml:mi>x</mml:mi>
<mml:mo>&#xaf;</mml:mo>
</mml:mover>
<mml:mo>&#xb1;</mml:mo>
<mml:mi>s</mml:mi>
</mml:mrow>
<mml:mo stretchy="false">)</mml:mo>
</mml:mrow>
</mml:mrow>
</mml:math>
</inline-formula>, and SPSS 26.0 software was used for statistical analysis. One-way ANOVA was used for two-way comparisons between multiple groups and when <italic>P&lt;</italic>0.05 is a statistically significant difference criterion.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Behavioral experiment results</title>
<p>The effects of AS on anxiety, nervousness, and other emotions of mice were analyzed by recording the distance traveled, average speed of movement, and number of times crossing the central zone of different groups of freely moving mice in the open-field experiment, and the results show that there was no significant difference between the distance traveled and the average speed of movement of mice in the WT, AD, donepezil, and AS groups in the behavioral experiments (<italic>P</italic>&lt; 0.05) (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1A, B</bold>
</xref>). The number of times the mice in the AD group crossed the central zone was significantly lower than that of the WT group (5.38 &#xb1; 1.19 vs. 10.12 &#xb1; 3.31; <italic>P&lt;</italic> 0.01), while the number of times the mice in the AS group traversed the central zone was significantly higher than that of the AD group (11.38 &#xb1; 3.11 vs. 5.38 &#xb1; 1.19; <italic>P</italic>&lt; 0.001), whereas there was no significant difference in the donepezil group (6.25 &#xb1; 1.75 vs. 5.38 &#xb1; 1.19) (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1C</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Behavioral experimental results on the open-field test and the new-object recognition experiment. <bold>(A)</bold> Moving distance in each group of the open-field test. <bold>(B)</bold> Average moving speed in each group of the open-field test. <bold>(C)</bold> Times of crossing the central area in each group of the open-field test. <bold>(D)</bold> 0&#xa0;h percentage of new things explored and 0&#xa0;h percentage of time exploring new things. <bold>(E)</bold> 1&#xa0;h percentage of new things explored and 1&#xa0;h percentage of time exploring new things (<italic>n</italic> = 8). <sup>*</sup>
<italic>P</italic> &lt; 0.05, <sup>**</sup>
<italic>P</italic> &lt; 0.01, <sup>***</sup>
<italic>P</italic> &lt; 0.001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1383464-g001.tif"/>
</fig>
<p>Mice are naturally curious and exploratory of new things, and the effect of spikenard on learning and memory impairment in demented mice could be determined by conducting new object recognition experiments. The experimental results showed that in the training phase (0&#xa0;h) (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1D</bold>
</xref>), there was no significant difference in the percentage of time spent exploring unfamiliar toys (0.60 &#xb1; 0.05 vs. 0.53 &#xb1; 0.11 vs. 0.55 &#xb1; 0.06 vs. 0.57 &#xb1; 0.04; <italic>P</italic> &gt; 0.05) and the percentage of number of explorations (0.57 &#xb1; 0.07 vs. 0.54 &#xb1; 0.11 vs. 0.56 &#xb1; 0.07 vs. 0.60 &#xb1; 0.04; <italic>P</italic> &gt; 0.05) among the mice in the WT, AD, donepezil, and AS groups, indicating that there was no difference in the inherent curiosity for novelty among the mice in each group.</p>
<p>During the test phase (1&#xa0;h) (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1E</bold>
</xref>), compared with the WT group, the AD group showed a decrease in the percentage of number of times of curious exploration of object Z (0.45 &#xb1; 0.07 vs. 0.55 &#xb1; 0.07; <italic>P</italic>&lt; 0.05) and a decrease in the percentage of time spent exploring (0.46 &#xb1; 0.09 vs. 0.56 &#xb1; 0.05), but there was no significant difference; compared with AD group, the percentage of time spent exploring and the percentage of number of times of curious exploration of object Z are increased in the AS group (0. 56 &#xb1; 0.08 vs. 0.45 &#xb1; 0.07; 0.60 &#xb1; 0.07 vs. 0.46 &#xb1; 0.09; <italic>P</italic>&lt; 0.05); compared with the AD group, the donepezil group had a significantly higher percentage of times exploring object Z (0.58 &#xb1; 0.05 vs. 0.45 &#xb1; 0.07; <italic>P</italic>&lt; 0.01) and an increased percentage of time exploring object Z, but there was no statistically significant difference and it was lower than the AS group.</p>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Active ingredients&#x2013;target network of AS in treating AD</title>
<p>By searching the TCMIP database, the HERB database, and the Chinese Pharmacopoeia (2020 edition), 25 active ingredients (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>) and 395 targets for AS were obtained. GeneCards database (score &#x2265;5), OMIM database, and TTD database were used to retrieve 3563 AD-related targets. The intersection of the two databases yielded 245 targets common to AS and AD (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>), which belonged to a total of 25 chemical components in AS, and a compound&#x2013;target network (CTN) was constructed using Cytoscape-v3.7.2 software (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>).</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Potentially active compounds in <italic>Acanthopanax senticosus</italic>.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">PubChem CID</th>
<th valign="middle" align="left">Compound</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">72</td>
<td valign="middle" align="left">3,4-Dihydroxybenzoic acid</td>
</tr>
<tr>
<td valign="middle" align="left">338</td>
<td valign="top" align="left">Salicylic acid</td>
</tr>
<tr>
<td valign="middle" align="left">1183</td>
<td valign="middle" align="left">Vanillin</td>
</tr>
<tr>
<td valign="middle" align="left">10742</td>
<td valign="middle" align="left">Syringic acid</td>
</tr>
<tr>
<td valign="middle" align="left">13250</td>
<td valign="middle" align="left">Ethyl gallate</td>
</tr>
<tr>
<td valign="middle" align="left">73117</td>
<td valign="middle" align="left">(+)-Eudesmin</td>
</tr>
<tr>
<td valign="middle" align="left">15699109</td>
<td valign="middle" align="left">Coniferaldehyde glucoside</td>
</tr>
<tr>
<td valign="middle" align="left">21636080</td>
<td valign="middle" align="left">Chiisanogenin</td>
</tr>
<tr>
<td valign="middle" align="left">428040</td>
<td valign="middle" align="left">Ethyl glucoside</td>
</tr>
<tr>
<td valign="middle" align="left">443023</td>
<td valign="middle" align="left">(+)-Syringaresinol</td>
</tr>
<tr>
<td valign="middle" align="left">445858</td>
<td valign="middle" align="left">Ferulic acid</td>
</tr>
<tr>
<td valign="middle" align="left">5280343</td>
<td valign="middle" align="left">Quercetin</td>
</tr>
<tr>
<td valign="middle" align="left">5280372</td>
<td valign="middle" align="left">Coniferin</td>
</tr>
<tr>
<td valign="middle" align="left">5280536</td>
<td valign="middle" align="left">4-Hydroxy-3-methoxycinnamaldehyde</td>
</tr>
<tr>
<td valign="middle" align="left">5282316</td>
<td valign="middle" align="left">(9Z,12E)-12-Nitrooctadeca-9,12-dienoic acid</td>
</tr>
<tr>
<td valign="middle" align="left">5315944</td>
<td valign="middle" align="left">Ciwujiatone</td>
</tr>
<tr>
<td valign="middle" align="left">5315945</td>
<td valign="middle" align="left">Clausarin</td>
</tr>
<tr>
<td valign="middle" align="left">5316860</td>
<td valign="middle" align="left">Syringin</td>
</tr>
<tr>
<td valign="middle" align="left">5318565</td>
<td valign="middle" align="left">Isofraxidin</td>
</tr>
<tr>
<td valign="middle" align="left">637542</td>
<td valign="middle" align="left">4-Hydroxycinnamic acid</td>
</tr>
<tr>
<td valign="middle" align="left">68289</td>
<td valign="middle" align="left">Sesamo</td>
</tr>
<tr>
<td valign="middle" align="left">689043</td>
<td valign="middle" align="left">Caffeic acid</td>
</tr>
<tr>
<td valign="middle" align="left">71312557</td>
<td valign="middle" align="left">Eleutheroside E</td>
</tr>
<tr>
<td valign="middle" align="left">72307</td>
<td valign="middle" align="left">Sesamin</td>
</tr>
<tr>
<td valign="middle" align="left">9859136</td>
<td valign="middle" align="left">Eleutheroside C</td>
</tr>
</tbody>
</table>
</table-wrap>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Target information and network topology analysis results of <italic>Acanthopanax senticosus</italic> (AS) and Alzheimer&#x2019;s disease. <bold>(A)</bold> Venn diagram. <bold>(B)</bold> &#x201c;Compound&#x2013;target&#x201d; network (CTN) of common targets and compounds in AS. Pink rhombus, compounds; green polygons, targets. <bold>(C)</bold> Kyoto Encyclopedia of Genes and Genomes pathways enrichment analysis. The bluer the color, the larger the <italic>P</italic> value. The size of each bubble reflects the number of genes enriched in the terms. <bold>(D)</bold> Gene Ontology enrichment analysis.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1383464-g002.tif"/>
</fig>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Analysis of core targets and biological functions of AS in treating AD</title>
<p>Protein interaction pairs (PPI pairs) of the abovementioned 245 targets screened in IntAct (<ext-link ext-link-type="uri" xlink:href="https://www.ebi.ac.uk/intact/">https://www.ebi.ac.uk/intact/</ext-link>), BioGrid (<ext-link ext-link-type="uri" xlink:href="https://thebiogrid.org/">https://thebiogrid.org/</ext-link>), and STRING databases were transferred to Cytoscape software to construct the protein&#x2013;protein interaction (PPI) network for AS of AD. The topological parameters of each node in the PPI network were calculated using the MCODE algorithm, and a total of 19 core protein interaction cluster networks were screened, of which 85 targets related to AS for AD were identified in these 19 core protein interaction clusters. The core nodes were screened by the mean values of degree, degree centrality (DC), closeness centrality (CC), betweenness centrality (BC) and other parameters, and finally nine key targets were obtained, including APP, NTRK1, ESR1, CFTR, CSNK2A1, EGFR, ESR2, GSK3B, and PAK1, which suggest that these targets play an important role in AS for AD.</p>
<p>The results of the GO enrichment analysis of these nine key targets showed that (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>) the biological process (BP) of AS treatment of AD was highlighted in the processes of protein phosphorylation, protein autophosphorylation, positive regulation of protein phosphorylation, cellular response to estradiol stimulation, and learning or memory; cellular composition (CC) was mainly in the processes of macromolecular complexes, axons, plasma membrane, cell surface, early endosomal membranes and receptor complexes, etc.; and molecular function (MF) focuses on the role of enzyme binding, protein serine/threonine/tyrosine kinase activity, ATP binding, binding of the same proteins, estrogen receptor activity, and nitric oxide synthase regulatory activity.</p>
<p>The KEGG pathway analysis identified 22 relevant biological pathways that may be significantly affected by AS in the treatment of AD (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>). AS was found to play a role in some cancer pathways, such as breast and endometrial cancer as well as in Alzheimer&#x2019;s disease pathways and pathways associated with neurodegenerative diseases. Others play important roles in the ErbB signaling pathway, the Ras signaling pathway, the MAPK signaling pathway, the PI3K-Akt signaling pathway, and so on.</p>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>Molecular docking</title>
<p>To further explore the potential mechanism of AS for the treatment of AD, these nine key targets and their corresponding 16 compounds in AS were subjected to molecular docking operations. The results (<xref ref-type="table" rid="T3">
<bold>Table&#xa0;3</bold>
</xref>) showed that the binding free energies of each compound docked to the proteins were all less than -5.0 kJ/mol, and the lower the free binding energy, the higher the affinity between the protein receptor and the small molecule ligand, and the more likely the interaction would occur. This indicates that the compounds in AS have high affinity with all relevant proteins. Docking results below -7.5 kJ/mol were visualized using Pymol software (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>).</p>
<table-wrap id="T3" position="float">
<label>Table&#xa0;3</label>
<caption>
<p>Binding ability of key targets and corresponding compounds.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">Target</th>
<th valign="middle" align="left">PDB ID</th>
<th valign="middle" align="left">Ligands</th>
<th valign="middle" align="left">deltaG (kcal/mol)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">CSNK2A1</td>
<td valign="middle" align="left">1NA7</td>
<td valign="middle" align="left">Quercetin</td>
<td valign="middle" align="left">-8.7</td>
</tr>
<tr>
<td valign="middle" align="left">GSK3B</td>
<td valign="middle" align="left">1Q5K</td>
<td valign="middle" align="left">Quercetin</td>
<td valign="middle" align="left">-8.6</td>
</tr>
<tr>
<td valign="middle" align="left">EGFR</td>
<td valign="middle" align="left">1IVO</td>
<td valign="middle" align="left">Quercetin</td>
<td valign="middle" align="left">-8.2</td>
</tr>
<tr>
<td valign="middle" align="left">GSK3B</td>
<td valign="middle" align="left">1Q5K</td>
<td valign="middle" align="left">(+)-Eudesmin</td>
<td valign="middle" align="left">-7.7</td>
</tr>
<tr>
<td valign="middle" align="left">ESR2</td>
<td valign="middle" align="left">4J26</td>
<td valign="middle" align="left">Quercetin</td>
<td valign="middle" align="left">-7.7</td>
</tr>
<tr>
<td valign="middle" align="left">GSK3B</td>
<td valign="middle" align="left">1Q5K</td>
<td valign="middle" align="left">Coniferin</td>
<td valign="middle" align="left">-7.6</td>
</tr>
<tr>
<td valign="middle" align="left">APP</td>
<td valign="middle" align="left">1AAP</td>
<td valign="middle" align="left">Quercetin</td>
<td valign="middle" align="left">-7.5</td>
</tr>
<tr>
<td valign="middle" align="left">GSK3B</td>
<td valign="middle" align="left">1Q5K</td>
<td valign="middle" align="left">Clausarin</td>
<td valign="middle" align="left">-7.4</td>
</tr>
<tr>
<td valign="middle" align="left">ESR1</td>
<td valign="middle" align="left">1A52</td>
<td valign="middle" align="left">(9Z,12E)-12-Nitrooctadeca-9,12-dienoic acid</td>
<td valign="middle" align="left">-7.4</td>
</tr>
<tr>
<td valign="middle" align="left">EGFR</td>
<td valign="middle" align="left">1IVO</td>
<td valign="middle" align="left">Coniferaldehyde glucoside</td>
<td valign="middle" align="left">-7.4</td>
</tr>
<tr>
<td valign="middle" align="left">CSNK2A1</td>
<td valign="middle" align="left">1NA7</td>
<td valign="middle" align="left">(9Z,12E)-12-nitrooctadeca-9,12-dienoic acid</td>
<td valign="middle" align="left">-7.2</td>
</tr>
<tr>
<td valign="middle" align="left">APP</td>
<td valign="middle" align="left">1AAP</td>
<td valign="middle" align="left">Caffeic acid</td>
<td valign="middle" align="left">-6.8</td>
</tr>
<tr>
<td valign="middle" align="left">ESR2</td>
<td valign="middle" align="left">4J26</td>
<td valign="middle" align="left">Caffeic acid</td>
<td valign="middle" align="left">-6.4</td>
</tr>
<tr>
<td valign="middle" align="left">GSK3B</td>
<td valign="middle" align="left">1Q5K</td>
<td valign="middle" align="left">Isofraxidin</td>
<td valign="middle" align="left">-6.4</td>
</tr>
<tr>
<td valign="middle" align="left">ESR1</td>
<td valign="middle" align="left">1A52</td>
<td valign="middle" align="left">Caffeic acid</td>
<td valign="middle" align="left">-6.3</td>
</tr>
<tr>
<td valign="middle" align="left">EGFR</td>
<td valign="middle" align="left">1IVO</td>
<td valign="middle" align="left">Isofraxidin</td>
<td valign="middle" align="left">-6.3</td>
</tr>
<tr>
<td valign="middle" align="left">ESR2</td>
<td valign="middle" align="left">4J26</td>
<td valign="middle" align="left">4-Hydroxycinnamic acid</td>
<td valign="middle" align="left">-6.3</td>
</tr>
<tr>
<td valign="middle" align="left">PAK1</td>
<td valign="middle" align="left">3FXZ</td>
<td valign="middle" align="left">Ciwujiatone</td>
<td valign="middle" align="left">-6.2</td>
</tr>
<tr>
<td valign="middle" align="left">ESR2</td>
<td valign="middle" align="left">4J26</td>
<td valign="middle" align="left">Ferulic acid</td>
<td valign="middle" align="left">-6.2</td>
</tr>
<tr>
<td valign="middle" align="left">ESR1</td>
<td valign="middle" align="left">1A52</td>
<td valign="middle" align="left">4-Hydroxy-3-methoxycinnamaldehyde</td>
<td valign="middle" align="left">-6.1</td>
</tr>
<tr>
<td valign="middle" align="left">ESR1</td>
<td valign="middle" align="left">1A52</td>
<td valign="middle" align="left">4-Hydroxycinnamic acid</td>
<td valign="middle" align="left">-6.1</td>
</tr>
<tr>
<td valign="middle" align="left">CFTR</td>
<td valign="middle" align="left">1XMI</td>
<td valign="middle" align="left">Ciwujiatone</td>
<td valign="middle" align="left">-6.1</td>
</tr>
<tr>
<td valign="middle" align="left">EGFR</td>
<td valign="middle" align="left">1IVO</td>
<td valign="middle" align="left">Caffeic acid</td>
<td valign="middle" align="left">-6.1</td>
</tr>
<tr>
<td valign="middle" align="left">ESR2</td>
<td valign="middle" align="left">4J26</td>
<td valign="middle" align="left">4-Hydroxy-3-methoxycinnamaldehyde</td>
<td valign="middle" align="left">-6.1</td>
</tr>
<tr>
<td valign="middle" align="left">ESR2</td>
<td valign="middle" align="left">4J26</td>
<td valign="middle" align="left">Ethyl gallate</td>
<td valign="middle" align="left">-6.1</td>
</tr>
<tr>
<td valign="middle" align="left">ESR2</td>
<td valign="middle" align="left">4J26</td>
<td valign="middle" align="left">Salicylic acid</td>
<td valign="middle" align="left">-6.1</td>
</tr>
<tr>
<td valign="middle" align="left">ESR2</td>
<td valign="middle" align="left">4J26</td>
<td valign="middle" align="left">3,4-Dihydroxybenzoic acid</td>
<td valign="middle" align="left">-6.0</td>
</tr>
<tr>
<td valign="middle" align="left">GSK3B</td>
<td valign="middle" align="left">1Q5K</td>
<td valign="middle" align="left">4-Hydroxy-3-methoxycinnamaldehyde</td>
<td valign="middle" align="left">-6.0</td>
</tr>
<tr>
<td valign="middle" align="left">APP</td>
<td valign="middle" align="left">1AAP</td>
<td valign="middle" align="left">Ferulic acid</td>
<td valign="middle" align="left">-5.9</td>
</tr>
<tr>
<td valign="middle" align="left">NTRK1</td>
<td valign="middle" align="left">1HE7</td>
<td valign="middle" align="left">Ciwujiatone</td>
<td valign="middle" align="left">-5.9</td>
</tr>
<tr>
<td valign="middle" align="left">EGFR</td>
<td valign="middle" align="left">1IVO</td>
<td valign="middle" align="left">(9Z,12E)-12-Nitrooctadeca-9,12-dienoic acid</td>
<td valign="middle" align="left">-5.9</td>
</tr>
<tr>
<td valign="middle" align="left">EGFR</td>
<td valign="middle" align="left">1IVO</td>
<td valign="middle" align="left">4-Hydroxy-3-methoxycinnamaldehyde</td>
<td valign="middle" align="left">-5.8</td>
</tr>
<tr>
<td valign="middle" align="left">EGFR</td>
<td valign="middle" align="left">1IVO</td>
<td valign="middle" align="left">Ferulic acid</td>
<td valign="middle" align="left">-5.7</td>
</tr>
<tr>
<td valign="middle" align="left">APP</td>
<td valign="middle" align="left">1AAP</td>
<td valign="middle" align="left">4-Hydroxy-3-methoxycinnamaldehyde</td>
<td valign="middle" align="left">-5.4</td>
</tr>
<tr>
<td valign="middle" align="left">EGFR</td>
<td valign="middle" align="left">1IVO</td>
<td valign="middle" align="left">Sesamol</td>
<td valign="middle" align="left">-5.4</td>
</tr>
</tbody>
</table>
</table-wrap>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Molecular docking diagram of quercetin, (+)-eudesmin, and coniferin with related key targets.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1383464-g003.tif"/>
</fig>
</sec>
<sec id="s3_5">
<label>3.5</label>
<title>mRNA expression of key genes in mouse cerebral cortex</title>
<p>According to the statistical results of qRT-PCR (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>), the mRNA content expression of APP, NTRK1, ESR1, CFTR, CSNK2A1, EGFR, ESR2, GSK3B, and PAK1 in the hippocampus of the brains of mice in the AD group was significantly elevated compared with those of mice in the WT group (<italic>P</italic>&lt; 0.01, <italic>P</italic>&lt; 0.001, <italic>P</italic>&lt; 0.0001). The mRNA expression of APP, NTRK1, ESR1, CFTR, CSNK2A1, EGFR, ESR2, GSK3B, and PAK1 in the AS group showed a significant decrease compared with that of the AD group (<italic>P</italic>&lt; 0.001, <italic>P</italic>&lt; 0.0001). It was demonstrated that the key targets of AS for the treatment of AD derived from network pharmacology were plausible and effective.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Results of qRT-PCR and Western blot (WB) about proteins related to the treatment of Alzheimer&#x2019;s disease by <italic>Acanthopanax senticosus</italic>. <bold>(A)</bold> mRNA level of key targets on each group. <bold>(B)</bold> Results of WB (<italic>n</italic> = 3). <sup>*</sup>
<italic>P</italic> &lt; 0.05, <sup>**</sup>
<italic>P</italic> &lt; 0.01, <italic>
<sup>***</sup>P</italic>&lt; 0.001, <sup>****</sup>
<italic>P</italic>&lt; 0.0001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1383464-g004.tif"/>
</fig>
</sec>
<sec id="s3_6">
<label>3.6</label>
<title>Western blot analysis of key pathways in the treatment of AD by AS</title>
<p>According to the results of the KEGG biological function analysis, the most relevant pathway for AS treatment of AD is involved in the MAPK pathway. The TRAF6, MAP3K7, p-MAP3K7, P38, p-P38, and HSP27 proteins in this pathway were selected for western blot analysis. The analysis showed that the expression level of TRAF6 protein in the hippocampal tissue of the AD group was significantly increased compared to that of the WT group, while the relative protein levels of p-MAP3K7/MAP3K7, the relative protein levels of p-P38/P38, and the expression of HSP27 protein were decreased. In contrast, in the hippocampus of mice after therapeutic intervention with AS, it can be found that mice in the AS group have a significant decrease in the expression level of TRAF6 protein and a notable increase in the expression level of MAPK phosphorylation and the HSP27 protein compared with the AD group; all the results were significant (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>). This suggests that AS may treat AD by regulating the phosphorylation process of the MAPK signaling pathway.</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>It is established that the accumulation of extracellular amyloid &#x3b2; and neurofibrillary tangles in the brain contributes to the onset of Alzheimer&#x2019;s disease; however, the current study suggests that AD is significantly linked to inflammatory processes within the central nervous system (CNS) (<xref ref-type="bibr" rid="B16">16</xref>). Flavonoid compounds have demonstrated the ability to inhibit neuroinflammatory processes and enhance memory recognition in mice with AD (<xref ref-type="bibr" rid="B17">17</xref>). According to the findings of clinical trials conducted by Tohda et&#xa0;al., the extract of AS is safe for augmentation in cognitive function, and it effectively alleviates anxiety in healthy individuals (<xref ref-type="bibr" rid="B18">18</xref>). In our study, we can see that AS has some efficacy in alleviating cognitive impairment caused by AD from the results of the behavioral experiments. In the open-field experiment, although there was no statistically significant difference between the groups of mice in terms of the distance traveled and the average speed of movement, the number of times the mice in the AS group crossed the central zone was significantly higher, which means that the mice showed good autonomous exploratory behavior and the negative emotional responses such as anxiety and nervousness were significantly alleviated by the administration of AS. According to the novelty recognition experiment, compared with the AD group, the percentage of time spent curiously exploring Z and the percentage of frequency of curious exploration increased in the AS group, while the percentage of number of times exploring Z was significantly higher in the donepezil group. Taken in combination, this suggests that both AS and donepezil can improve transient memory impairment in AD model mice.</p>
<p>To elucidate the potential therapeutic targets and mechanisms of action for AS in the treatment of AD, a comprehensive analysis of 245 candidate targets was conducted using network pharmacology techniques. A topological algorithm was employed to establish a protein&#x2013;interaction network (PPI), which identified nine key targets for AS in AD treatment: amyloid-beta precursor protein (APP), neurotrophic receptor tyrosine kinase 1 (NTRK1), estrogen receptor alpha (ESR1), cystic fibrosis transmembrane conductance regulator (CFTR), casein kinase 2 alpha 1 (CSNK2A1), epidermal growth factor receptor (EGFR), estrogen receptor 2 (ESR2), glycogen synthase kinase 3 beta (GSK3B), and P21 activated kinase 1 (PAK1). The quantitative real-time PCR (qRT-PCR) data revealed that the mRNA expression levels of these targets in the hippocampus of AS-treated mice significantly decreased compared to that of the AD group. Several studies have shown that in addition to amyloid deposition and tau protein hyperphosphorylation leading to AD, mice carrying mutants of the human APP gene and lacking the apoE gene also exhibit memory deficits (<xref ref-type="bibr" rid="B19">19</xref>). It also promotes synapse formation, dendrite sprouting, and neuronal migration (<xref ref-type="bibr" rid="B20">20</xref>). Chronic intracerebroventricular injection of sAPP&#x3b1; in mice mitigated cognitive and synaptic deficits (<xref ref-type="bibr" rid="B21">21</xref>). NTRK1 (TrkA), a receptor for nerve growth factor (NGF), regulates neuronal growth, differentiation, and apoptosis in the CNS (<xref ref-type="bibr" rid="B22">22</xref>). Inflammatory mediators, including IL-1&#x3b2;, TNF-&#x3b1;, and IL-6, stimulate the synthesis of nerve growth factor (NGF) in both neurons and glial cells, concurrently increasing the expression of the TrkA receptor. Upon Toll-like receptor (TLR) activation, NGF binds to TrkA, triggering a cascade that involves the activation of Ras, PI3K, phospholipase C&#x3b3;1, and downstream signaling pathways, such as the MAPK pathway. This cascade interferes with intracellular TLR signaling, thereby augmenting the endogenous negative feedback mechanisms that modulate excessive inflammation (<xref ref-type="bibr" rid="B23">23</xref>&#x2013;<xref ref-type="bibr" rid="B25">25</xref>). R Romano et&#xa0;al. showed that EGFR, part of the receptor tyrosine kinase superfamily, is crucial for neural stem cell maintenance, astrocyte maturation, and neurite outgrowth in the CNS (<xref ref-type="bibr" rid="B26">26</xref>). Its inhibition improves astrocyte proliferation after injury, enhances autophagy, and reduces A&#x3b2; toxicity and neuroinflammation (<xref ref-type="bibr" rid="B27">27</xref>), correlating with a reduced risk of associated dementia (ADD) (<xref ref-type="bibr" rid="B28">28</xref>). ESR1 and ESR2, estrogen receptor-related genes, are implicated in neuronal degeneration due to estrogen decline, leading to cognitive difficulties (<xref ref-type="bibr" rid="B29">29</xref>). ER&#x3b1; and ER&#x3b2; expression in neurons and astrocytes is associated with cognitive function maintenance in older women (<xref ref-type="bibr" rid="B30">30</xref>, <xref ref-type="bibr" rid="B31">31</xref>). CFTR, expressed in neurons and other cell types, is linked to improved cognitive performance with physical activity in CF patients (<xref ref-type="bibr" rid="B32">32</xref>, <xref ref-type="bibr" rid="B33">33</xref>). GSK3, a ubiquitous serine&#x2013;threonine kinase with two isoforms (GSK3&#x3b1; and GSK3&#x3b2;), is widely found in the CNS (<xref ref-type="bibr" rid="B34">34</xref>). GSK3&#x3b2; overexpression promotes the BACE1 cleavage of APP, favoring A&#x3b2; plaque formation, which disrupts the Wnt pathway, leading to tau phosphorylation and accelerating AD progression (<xref ref-type="bibr" rid="B34">34</xref>, <xref ref-type="bibr" rid="B35">35</xref>).</p>
<p>According to the CTN graph, it is evident that the expression of key targets is associated with several anti-inflammatory and antioxidant properties in AS, including quercetin, (+)-eudesmin, 12-nitrooctadeca-9,12-dienoic acid, coniferaldehyde glucoside, caffeic acid, and isofraxidin, which has been shown to decrease A&#x3b2; production by inhibiting BACE1 and acetylcholinesterase (AChE), regulate the NF-&#x3ba;B pathway to reduce COX-2 levels, and mediate the inhibition of neuroinflammatory responses <italic>via</italic> the Nrf2/HO1 pathway, thereby intervening in AD (<xref ref-type="bibr" rid="B36">36</xref>&#x2013;<xref ref-type="bibr" rid="B38">38</xref>).</p>
<p>The analysis of functional enrichment can facilitate a more comprehensive understanding of the interactions among gene products. According to the results of the KEGG analysis, the MAPK signaling pathway appears to be the most promising treatment avenue for Alzheimer&#x2019;s disease (AD). Mitogen-activated protein kinases (MAPK) represent a group of serine&#x2013;threonine kinases, comprising extracellular signal-regulated kinases (ERK), p38, and c-Jun NH2-terminal kinases (JNK) (<xref ref-type="bibr" rid="B39">39</xref>). Each MAPK signaling axis contains at least three components: MAPK kinase kinase kinase (MAP3K), MAPK kinase kinase (MAP2K), and MAPK kinase (<xref ref-type="bibr" rid="B40">40</xref>). Notably, the MAPK signaling pathway, which has been found to be significantly associated with AD development, can be triggered by inflammatory factors such as TNF&#x3b1; or IL-1&#x3b2; or in response to cellular stress (<xref ref-type="bibr" rid="B41">41</xref>, <xref ref-type="bibr" rid="B42">42</xref>). Relevant studies have demonstrated that inhibiting the MAPK signaling pathway can effectively mitigate the inflammatory response, thereby alleviating the symptoms of AD (<xref ref-type="bibr" rid="B43">43</xref>, <xref ref-type="bibr" rid="B44">44</xref>). The results of the Western blot analysis demonstrate that, compared with the AD group, the AS group exhibited a significant decrease in TRAF6 protein expression and an increase in p-MAP3K7/MAP3K7 relative protein content, p-P38/P38 relative protein content, and HSP27 protein expression levels. These findings suggest that AS may control the inflammatory response and improve cognitive dysfunction by inhibiting the expression of the TRAF6 protein, increasing the phosphorylation of the MAPK pathway and inhibiting the activation of pro-inflammatory factors.</p>
<p>In conclusion, AS can enhance short-term learning memory and effectively alleviate anxiety in 5xFAD mice. The mechanism of action is related to the activation of phosphorylation of the MAPK pathway and inhibition of the production of inflammatory factors. AS contains active compounds including quercetin, caffeic acid, and isofraxidin, with its main targets being APP, NTRK1, EGFR, GSK3B, and other genes. This study analyzes the feasibility and mechanism of action of AS in the treatment of AD, providing a novel approach to finding effective solutions for AD treatment in clinical settings.</p>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/supplementary materials, further inquiries can be directed to the corresponding author/s.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The animal study was approved by Animal Management and Use Committee of Shanghai University of Traditional Chinese Medicine. The study was conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>ZZ: Data curation, Validation, Writing &#x2013; original draft, Investigation, Visualization. YW: Data curation, Visualization, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing. DS: Conceptualization, Resources, Writing &#x2013; original draft, Funding acquisition, Writing &#x2013; review &amp; editing. CJ: Validation, Writing &#x2013; original draft. HC: Data curation, Writing &#x2013; original draft. FJ: Software, Writing &#x2013; original draft. XB: Investigation, Writing &#x2013; original draft. YS: Writing &#x2013; review &amp; editing. XS: Funding acquisition, Supervision, Writing &#x2013; review &amp; editing.</p>
</sec>
</body>
<back>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare financial support was received for the research, authorship, and/or publication of this article. The research funds of this experiment were from the special scientific research funds of Shanghai Hospital Traditional Chinese Medicine Preparation Industry Transformation Collaborative Innovation Center and Shanghai Association for the Integration of Traditional Chinese and Western Medicine.</p>
</sec>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<article-title>2023 Alzheimer's disease facts and figures</article-title>. <source>Alzheimers Dement</source>. (<year>2023</year>) <volume>19</volume>:<page-range>1598&#x2013;695</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/alz.13016</pub-id>
</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crump</surname> <given-names>C</given-names>
</name>
<name>
<surname>Sundquist</surname> <given-names>J</given-names>
</name>
<name>
<surname>Sieh</surname> <given-names>W</given-names>
</name>
<name>
<surname>Sundquist</surname> <given-names>K</given-names>
</name>
</person-group>. <article-title>Risk of alzheimer's disease and related dementias in persons with glaucoma: A national cohort study</article-title>. <source>Ophthalmology</source>. (<year>2023</year>) <volume>17</volume>(<issue>1</issue>):<fpage>19</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ophtha.2023.10.014</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khan</surname> <given-names>S</given-names>
</name>
<name>
<surname>Barve</surname> <given-names>KH</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>MS</given-names>
</name>
</person-group>. <article-title>Recent advancements in pathogenesis, diagnostics and treatment of alzheimer's disease</article-title>. <source>Curr Neuropharmacol</source>. (<year>2020</year>) <volume>18</volume>:<page-range>1106&#x2013;25</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.2174/1570159X18666200528142429</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cummings</surname> <given-names>JL</given-names>
</name>
<name>
<surname>Tong</surname> <given-names>G</given-names>
</name>
<name>
<surname>Ballard</surname> <given-names>C</given-names>
</name>
</person-group>. <article-title>Treatment combinations for alzheimer's disease: current and future pharmacotherapy options</article-title>. <source>J Alzheimers Dis</source>. (<year>2019</year>) <volume>67</volume>:<page-range>779&#x2013;94</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.3233/JAD-180766</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bairamian</surname> <given-names>D</given-names>
</name>
<name>
<surname>Sha</surname> <given-names>S</given-names>
</name>
<name>
<surname>Rolhion</surname> <given-names>N</given-names>
</name>
<name>
<surname>Sokol</surname> <given-names>H</given-names>
</name>
<name>
<surname>Dorothee</surname> <given-names>G</given-names>
</name>
<name>
<surname>Lemere</surname> <given-names>CA</given-names>
</name>
<etal/>
</person-group>. <article-title>Microbiota in neuroinflammation and synaptic dysfunction: a focus on Alzheimer's disease</article-title>. <source>Mol Neurodegener</source>. (<year>2022</year>) <volume>17</volume>:<fpage>19</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s13024-022-00522-2</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Parhizkar</surname> <given-names>S</given-names>
</name>
<name>
<surname>Holtzman</surname> <given-names>DM</given-names>
</name>
</person-group>. <article-title>APOE mediated neuroinflammation and neurodegeneration in Alzheimer's disease</article-title>. <source>Semin Immunol</source>. (<year>2022</year>) <volume>59</volume>:<fpage>101594</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.smim.2022.101594</pub-id>
</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lyketsos</surname> <given-names>CG</given-names>
</name>
<name>
<surname>Carrillo</surname> <given-names>MC</given-names>
</name>
<name>
<surname>Ryan</surname> <given-names>JM</given-names>
</name>
<name>
<surname>Khachaturian</surname> <given-names>AS</given-names>
</name>
<name>
<surname>Trzepacz</surname> <given-names>P</given-names>
</name>
<name>
<surname>Amatniek</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Neuropsychiatric symptoms in Alzheimer's disease</article-title>. <source>Alzheimers Dement</source>. (<year>2011</year>) <volume>7</volume>:<page-range>532&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jalz.2011.05.2410</pub-id>
</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>X</given-names>
</name>
<name>
<surname>Xiao</surname> <given-names>KW</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>YQ</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>K</given-names>
</name>
<name>
<surname>Xue</surname> <given-names>XC</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>CJ</given-names>
</name>
<etal/>
</person-group>. <article-title>Visual analysis of research on traditional Chinese medicine treatment of Alzheimer's disease in recent ten years Alzheimer's disease in recent ten years</article-title>. <source>China J Chin Materia Med</source>. (<year>2023</year>) <volume>48</volume>:<page-range>1673&#x2013;81</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.19540/j.cnki.cjcmm.20221206.501</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ma</surname> <given-names>ZY</given-names>
</name>
<name>
<surname>Su</surname> <given-names>XM</given-names>
</name>
</person-group>. <article-title>Thoughts and methods of traditional chineThoughts and methods of traditional chinese medicine in treating alzheimer diseaseAlzheimer disease</article-title>. <source>Chin Med Modern Distance Educ China</source>. (<year>2022</year>) <volume>20</volume>:<page-range>201&#x2013;3</page-range>.</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname> <given-names>J</given-names>
</name>
<name>
<surname>Kwon</surname> <given-names>S</given-names>
</name>
<name>
<surname>Jin</surname> <given-names>C</given-names>
</name>
<name>
<surname>Cho</surname> <given-names>SY</given-names>
</name>
<name>
<surname>Park</surname> <given-names>SU</given-names>
</name>
<name>
<surname>Jung</surname> <given-names>WS</given-names>
</name>
<etal/>
</person-group>. <article-title>Traditional east asian herbal medicine treatment for alzheimer's disease: A systematic review and meta-analysis</article-title>. <source>Pharm (Basel)</source>. (<year>2022</year>) <volume>15</volume>:<fpage>174</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ph15020174</pub-id>
</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>XT</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>JC</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Ren</surname> <given-names>YS</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>YH</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>SM</given-names>
</name>
<etal/>
</person-group>. <article-title>Pharmacological effects of Eleutherococcus senticosus on the neurological disorders</article-title>. <source>Phytother Res</source>. (<year>2022</year>) <volume>36</volume>:<page-range>3490&#x2013;504</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/ptr.7555</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yamauchi</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Ge</surname> <given-names>YW</given-names>
</name>
<name>
<surname>Yoshimatsu</surname> <given-names>K</given-names>
</name>
<name>
<surname>Komastu</surname> <given-names>K</given-names>
</name>
<name>
<surname>Kuboyama</surname> <given-names>T</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>X</given-names>
</name>
<etal/>
</person-group>. <article-title>Memory enhancement by oral administration of extract of eleutherococcus senticosus leaves and active compounds transferred in the brain</article-title>. <source>Nutrients</source>. (<year>2019</year>) <volume>11</volume>:<fpage>1142</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/nu11051142</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname> <given-names>S</given-names>
</name>
<name>
<surname>Park</surname> <given-names>HJ</given-names>
</name>
<name>
<surname>Jeon</surname> <given-names>SJ</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>E</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>HE</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>Cognitive ameliorating effect of acanthopanax koreanum against scopolamine-induced memory impairment in mice</article-title>. <source>Phytother Res</source>. (<year>2017</year>) <volume>31</volume>:<page-range>425&#x2013;32</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/ptr.v31.3</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jin</surname> <given-names>ML</given-names>
</name>
<name>
<surname>Park</surname> <given-names>SY</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>YH</given-names>
</name>
<name>
<surname>Park</surname> <given-names>G</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>SJ</given-names>
</name>
</person-group>. <article-title>Acanthopanax senticosus exerts neuroprotective effects through HO-1 signaling in hippocampal and microglial cells</article-title>. <source>Environ Toxicol Pharmacol</source>. (<year>2013</year>) <volume>35</volume>:<page-range>335&#x2013;46</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.etap.2013.01.004</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Commission</surname> <given-names>CP</given-names>
</name>
</person-group>. <source>Pharmacopoeia of the people&#x2019;s republic of China. Vol. 1</source>. <publisher-loc>BeiJing</publisher-loc>: <publisher-name>China Medical Science &amp; Technology Press</publisher-name> (<year>2020</year>) p. <page-range>215&#x2013;6</page-range>.</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Calsolaro</surname> <given-names>V</given-names>
</name>
<name>
<surname>Edison</surname> <given-names>P</given-names>
</name>
</person-group>. <article-title>Neuroinflammation in Alzheimer's disease: Current evidence and future directions</article-title>. <source>Alzheimers Dement</source>. (<year>2016</year>) <volume>12</volume>:<page-range>719&#x2013;32</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jalz.2016.02.010</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khan</surname> <given-names>H</given-names>
</name>
<name>
<surname>Ullah</surname> <given-names>H</given-names>
</name>
<name>
<surname>Aschner</surname> <given-names>M</given-names>
</name>
<name>
<surname>Cheang</surname> <given-names>WS</given-names>
</name>
<name>
<surname>Akkol</surname> <given-names>EK</given-names>
</name>
</person-group>. <article-title>Neuroprotective effects of quercetin in alzheimer's disease</article-title>. <source>Biomolecules</source>. (<year>2019</year>) <volume>10</volume>:<fpage>59</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/biom10010059</pub-id>
</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tohda</surname> <given-names>C</given-names>
</name>
<name>
<surname>Matsui</surname> <given-names>M</given-names>
</name>
<name>
<surname>Inada</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Kuboyama</surname> <given-names>T</given-names>
</name>
<name>
<surname>Kimbara</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>Combined Treatment with Two Water Extracts of Eleutherococcus senticosus Leaf and Rhizome of Drynaria fortunei Enhances Cognitive Function: A Placebo-Controlled, Randomized, Double-Blind Study in Healthy Adults</article-title>. <source>Nutrients</source>. (<year>2020</year>) <volume>12</volume>:<fpage>303</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/nu12020303</pub-id>
</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dodart</surname> <given-names>JC</given-names>
</name>
<name>
<surname>Mathis</surname> <given-names>C</given-names>
</name>
<name>
<surname>Bales</surname> <given-names>KR</given-names>
</name>
<name>
<surname>Paul</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Ungerer</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>Behavioral deficits in APP(V717F) transgenic mice deficient for the apolipoprotein E gene</article-title>. <source>Neuroreport</source>. (<year>2000</year>) <volume>11</volume>:<page-range>603&#x2013;7</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1097/00001756-200002280-00034</pub-id>
</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Muller</surname> <given-names>UC</given-names>
</name>
<name>
<surname>Deller</surname> <given-names>T</given-names>
</name>
<name>
<surname>Korte</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Not just amyloid: physiological functions of the amyloid precursor protein family</article-title>. <source>Nat Rev Neurosci</source>. (<year>2017</year>) <volume>18</volume>:<page-range>281&#x2013;98</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nrn.2017.29</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tan</surname> <given-names>VTY</given-names>
</name>
<name>
<surname>Mockett</surname> <given-names>BG</given-names>
</name>
<name>
<surname>Ohline</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Parfitt</surname> <given-names>KD</given-names>
</name>
<name>
<surname>Wicky</surname> <given-names>HE</given-names>
</name>
<name>
<surname>Peppercorn</surname> <given-names>K</given-names>
</name>
<etal/>
</person-group>. <article-title>Lentivirus-mediated expression of human secreted amyloid precursor protein-alpha prevents development of memory and plasticity deficits in a mouse model of Alzheimer's disease</article-title>. <source>Mol Brain</source>. (<year>2018</year>) <volume>11</volume>:<fpage>7</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s13041-018-0348-9</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alberti</surname> <given-names>L</given-names>
</name>
<name>
<surname>Carniti</surname> <given-names>C</given-names>
</name>
<name>
<surname>Miranda</surname> <given-names>C</given-names>
</name>
<name>
<surname>Roccato</surname> <given-names>E</given-names>
</name>
<name>
<surname>Pierotti</surname> <given-names>MA</given-names>
</name>
</person-group>. <article-title>RET and NTRK1 proto-oncogenes in human diseases</article-title>. <source>J Cell Physiol</source>. (<year>2003</year>) <volume>195</volume>:<page-range>168&#x2013;86</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/jcp.10252</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Prencipe</surname> <given-names>G</given-names>
</name>
<name>
<surname>Minnone</surname> <given-names>G</given-names>
</name>
<name>
<surname>Strippoli</surname> <given-names>R</given-names>
</name>
<name>
<surname>De Pasquale</surname> <given-names>L</given-names>
</name>
<name>
<surname>Petrini</surname> <given-names>S</given-names>
</name>
<name>
<surname>Caiello</surname> <given-names>I</given-names>
</name>
<etal/>
</person-group>. <article-title>Nerve growth factor downregulates inflammatory response in human monocytes through TrkA</article-title>. <source>J Immunol</source>. (<year>2014</year>) <volume>192</volume>:<page-range>3345&#x2013;54</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.4049/jimmunol.1300825</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Minnone</surname> <given-names>G</given-names>
</name>
<name>
<surname>De Benedetti</surname> <given-names>F</given-names>
</name>
<name>
<surname>Bracci-Laudiero</surname> <given-names>L</given-names>
</name>
</person-group>. <article-title>NGF and its receptors in the regulation of inflammatory response</article-title>. <source>Int J Mol Sci</source>. (<year>2017</year>) <volume>18</volume>:<fpage>1028</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms18051028</pub-id>
</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Reichardt</surname> <given-names>LF</given-names>
</name>
</person-group>. <article-title>Neurotrophin-regulated signalling pathways</article-title>. <source>Philos Trans R Soc Lond B Biol Sci</source>. (<year>2006</year>) <volume>361</volume>:<page-range>1545&#x2013;64</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1098/rstb.2006.1894</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Romano</surname> <given-names>R</given-names>
</name>
<name>
<surname>Bucci</surname> <given-names>C</given-names>
</name>
</person-group>. <article-title>Role of EGFR in the nervous system</article-title>. <source>Cells</source>. (<year>2020</year>) <volume>9</volume>:<fpage>1887</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/cells9081887</pub-id>
</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mansour</surname> <given-names>HM</given-names>
</name>
<name>
<surname>Fawzy</surname> <given-names>HM</given-names>
</name>
<name>
<surname>El-Khatib</surname> <given-names>AS</given-names>
</name>
<name>
<surname>Khattab</surname> <given-names>MM</given-names>
</name>
</person-group>. <article-title>Repurposed anti-cancer epidermal growth factor receptor inhibitors: mechanisms of neuroprotective effects in Alzheimer's disease</article-title>. <source>Neural Regener Res</source>. (<year>2022</year>) <volume>17</volume>:<page-range>1913&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.4103/1673-5374.332132</pub-id>
</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bellenguez</surname> <given-names>C</given-names>
</name>
<name>
<surname>Kucukali</surname> <given-names>F</given-names>
</name>
<name>
<surname>Jansen</surname> <given-names>IE</given-names>
</name>
<name>
<surname>Kleineidam</surname> <given-names>L</given-names>
</name>
<name>
<surname>Moreno-Grau</surname> <given-names>S</given-names>
</name>
<name>
<surname>Amin</surname> <given-names>N</given-names>
</name>
<etal/>
</person-group>. <article-title>New insights into the genetic etiology of Alzheimer's disease and related dementias</article-title>. <source>Nat Genet</source>. (<year>2022</year>) <volume>54</volume>:<page-range>412&#x2013;36</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41588-022-01024-z</pub-id>
</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pinkas</surname> <given-names>J</given-names>
</name>
<name>
<surname>Bojar</surname> <given-names>I</given-names>
</name>
<name>
<surname>Gujski</surname> <given-names>M</given-names>
</name>
<name>
<surname>Sarecka-Hujar</surname> <given-names>B</given-names>
</name>
<name>
<surname>Owoc</surname> <given-names>A</given-names>
</name>
<name>
<surname>Raczkiewicz</surname> <given-names>D</given-names>
</name>
</person-group>. <article-title>Effect of interactions between APOE and ESR1 polymorphisms on cognitive functions in postmenopausal women</article-title>. <source>Arch Med Sci</source>. (<year>2021</year>) <volume>17</volume>:<page-range>31&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.5114/aoms.2018.72972</pub-id>
</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>S</given-names>
</name>
<name>
<surname>Niu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Kelleher</surname> <given-names>R</given-names>
</name>
<name>
<surname>Sheridan</surname> <given-names>H</given-names>
</name>
</person-group>. <article-title>ESR1 dysfunction triggers neuroinflammation as a critical upstream causative factor of the Alzheimer's disease process</article-title>. <source>Aging (Albany NY)</source>. (<year>2022</year>) <volume>14</volume>:<page-range>8595&#x2013;614</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.18632/aging.v14i21</pub-id>
</citation>
</ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Baumgartner</surname> <given-names>NE</given-names>
</name>
<name>
<surname>Daniel</surname> <given-names>JM</given-names>
</name>
</person-group>. <article-title>Estrogen receptor alpha: a critical role in successful female cognitive aging</article-title>. <source>Climacteric</source>. (<year>2021</year>) <volume>24</volume>:<page-range>333&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/13697137.2021.1875426</pub-id>
</citation>
</ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gambazza</surname> <given-names>S</given-names>
</name>
<name>
<surname>Nobili</surname> <given-names>RM</given-names>
</name>
<name>
<surname>Biffi</surname> <given-names>R</given-names>
</name>
<name>
<surname>Summers</surname> <given-names>PE</given-names>
</name>
<name>
<surname>Colombo</surname> <given-names>C</given-names>
</name>
<name>
<surname>Costa</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>Cystic Fibrosis, New Frontier: Exploring the Functional Connectivity of the Brain Default Mode Network. Comment on Elce et&#xa0;al. Impact of Physical Activity on Cognitive Functions: A New Field for Research and Management of Cystic Fibrosis</article-title>. <source>Diagnostics</source>. (<year>2020</year>) <volume>10</volume>:<fpage>489</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/diagnostics11061001</pub-id>
</citation>
</ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Elce</surname> <given-names>V</given-names>
</name>
<name>
<surname>Del Pizzo</surname> <given-names>A</given-names>
</name>
<name>
<surname>Nigro</surname> <given-names>E</given-names>
</name>
<name>
<surname>Frisso</surname> <given-names>G</given-names>
</name>
<name>
<surname>Martiniello</surname> <given-names>L</given-names>
</name>
<name>
<surname>Daniele</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>Impact of physical activity on cognitive functions: A new field for research and management of cystic fibrosis</article-title>. <source>Diagnostics (Basel)</source>. (<year>2020</year>) <volume>10</volume>:<fpage>489</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/diagnostics10070489</pub-id>
</citation>
</ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lauretti</surname> <given-names>E</given-names>
</name>
<name>
<surname>Dincer</surname> <given-names>O</given-names>
</name>
<name>
<surname>Pratico</surname> <given-names>D</given-names>
</name>
</person-group>. <article-title>Glycogen synthase kinase-3 signaling in Alzheimer's disease</article-title>. <source>Biochim Biophys Acta Mol Cell Res</source>. (<year>2020</year>) <volume>1867</volume>:<fpage>118664</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bbamcr.2020.118664</pub-id>
</citation>
</ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Balaraman</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Limaye</surname> <given-names>AR</given-names>
</name>
<name>
<surname>Levey</surname> <given-names>AI</given-names>
</name>
<name>
<surname>Srinivasan</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Glycogen synthase kinase 3beta and Alzheimer's disease: pathophysiological and therapeutic significance</article-title>. <source>Cell Mol Life Sci</source>. (<year>2006</year>) <volume>63</volume>:<page-range>1226&#x2013;35</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00018-005-5597-y</pub-id>
</citation>
</ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bayazid</surname> <given-names>AB</given-names>
</name>
<name>
<surname>Lim</surname> <given-names>BO</given-names>
</name>
</person-group>. <article-title>Quercetin Is An Active Agent in Berries against Neurodegenerative Diseases Progression through Modulation of Nrf2/HO1</article-title>. <source>Nutrients</source>. (<year>2022</year>) <volume>14</volume>:<fpage>5132</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/nu14235132</pub-id>
</citation>
</ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Grewal</surname> <given-names>AK</given-names>
</name>
<name>
<surname>Singh</surname> <given-names>TG</given-names>
</name>
<name>
<surname>Sharma</surname> <given-names>D</given-names>
</name>
<name>
<surname>Sharma</surname> <given-names>V</given-names>
</name>
<name>
<surname>Singh</surname> <given-names>M</given-names>
</name>
<name>
<surname>Rahman</surname> <given-names>MH</given-names>
</name>
<etal/>
</person-group>. <article-title>Mechanistic insights and perspectives involved in neuroprotective action of quercetin</article-title>. <source>BioMed Pharmacother</source>. (<year>2021</year>) <volume>140</volume>:<fpage>111729</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.biopha.2021.111729</pub-id>
</citation>
</ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zaplatic</surname> <given-names>E</given-names>
</name>
<name>
<surname>Bule</surname> <given-names>M</given-names>
</name>
<name>
<surname>Shah</surname> <given-names>SZA</given-names>
</name>
<name>
<surname>Uddin</surname> <given-names>MS</given-names>
</name>
<name>
<surname>Niaz</surname> <given-names>K</given-names>
</name>
</person-group>. <article-title>Molecular mechanisms underlying protective role of quercetin in attenuating Alzheimer's disease</article-title>. <source>Life Sci</source>. (<year>2019</year>) <volume>224</volume>:<page-range>109&#x2013;19</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.lfs.2019.03.055</pub-id>
</citation>
</ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Falcicchia</surname> <given-names>C</given-names>
</name>
<name>
<surname>Tozzi</surname> <given-names>F</given-names>
</name>
<name>
<surname>Arancio</surname> <given-names>O</given-names>
</name>
<name>
<surname>Watterson</surname> <given-names>DM</given-names>
</name>
<name>
<surname>Origlia</surname> <given-names>N</given-names>
</name>
</person-group>. <article-title>Involvement of p38 MAPK in synaptic function and dysfunction</article-title>. <source>Int J Mol Sci</source>. (<year>2020</year>) <volume>21</volume>:<fpage>5624</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms21165624</pub-id>
</citation>
</ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kheiri</surname> <given-names>G</given-names>
</name>
<name>
<surname>Dolatshahi</surname> <given-names>M</given-names>
</name>
<name>
<surname>Rahmani</surname> <given-names>F</given-names>
</name>
<name>
<surname>Rezaei</surname> <given-names>N</given-names>
</name>
</person-group>. <article-title>Role of p38/MAPKs in Alzheimer's disease: implications for amyloid beta toxicity targeted therapy</article-title>. <source>Rev Neurosci</source>. (<year>2018</year>) <volume>30</volume>:<fpage>9</fpage>&#x2013;<lpage>30</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1515/revneuro-2018-0008</pub-id>
</citation>
</ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Thakur</surname> <given-names>S</given-names>
</name>
<name>
<surname>Dhapola</surname> <given-names>R</given-names>
</name>
<name>
<surname>Sarma</surname> <given-names>P</given-names>
</name>
<name>
<surname>Medhi</surname> <given-names>B</given-names>
</name>
<name>
<surname>Reddy</surname> <given-names>DH</given-names>
</name>
</person-group>. <article-title>Neuroinflammation in alzheimer's disease: current progress in molecular signaling and therapeutics</article-title>. <source>Inflammation</source>. (<year>2023</year>) <volume>46</volume>:<fpage>1</fpage>&#x2013;<lpage>17</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10753-022-01721-1</pub-id>
</citation>
</ref>
<ref id="B42">
<label>42</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>L</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Z</given-names>
</name>
<etal/>
</person-group>. <article-title>Asiaticoside mitigates alzheimer's disease pathology by attenuating inflammation and enhancing synaptic function</article-title>. <source>Int J Mol Sci</source>. (<year>2023</year>) <volume>24</volume>:<fpage>11976</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms241511976</pub-id>
</citation>
</ref>
<ref id="B43">
<label>43</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname> <given-names>JK</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>NJ</given-names>
</name>
</person-group>. <article-title>Recent advances in the inhibition of p38 MAPK as a potential strategy for the treatment of alzheimer's disease</article-title>. <source>Molecules</source>. (<year>2017</year>) <volume>22</volume>:<fpage>1287</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/molecules22081287</pub-id>
</citation>
</ref>
<ref id="B44">
<label>44</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Beamer</surname> <given-names>E</given-names>
</name>
<name>
<surname>Correa</surname> <given-names>SAL</given-names>
</name>
</person-group>. <article-title>The p38(MAPK)-MK2 signaling axis as a critical link between inflammation and synaptic transmission</article-title>. <source>Front Cell Dev Biol</source>. (<year>2021</year>) <volume>9</volume>:<elocation-id>635636</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fcell.2021.635636</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>