<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2024.1379175</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Immunology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Characterization of latently infected EBV+ antibody-secreting B cells isolated from ovarian tumors and malignant ascites</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Zhang</surname>
<given-names>Lixin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2643728"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Strange</surname>
<given-names>Mary</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2644851"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Elishaev</surname>
<given-names>Esther</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zaidi</surname>
<given-names>Syed</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2644809"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Modugno</surname>
<given-names>Francesmary</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Radolec</surname>
<given-names>Mackenzy</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Edwards</surname>
<given-names>Robert P.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Finn</surname>
<given-names>Olivera J.</given-names>
</name>
<xref ref-type="aff" rid="aff5">
<sup>5</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/114429"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Vlad</surname>
<given-names>Anda M.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/127129"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Department of Obstetrics, Gynecology and Reproductive Sciences, University of Pittsburgh School of Medicine</institution>, <addr-line>Pittsburgh, PA</addr-line>, <country>United States</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Magee-Womens Research Institute</institution>, <addr-line>Pittsburgh, PA</addr-line>, <country>United States</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Department of Pathology, University of Pittsburgh School of Medicine</institution>, <addr-line>Pittsburgh, PA</addr-line>, <country>United States</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>Magee-Womens Hospital of University of Pittsburgh Medical Center (UPMC)</institution>, <addr-line>Pittsburgh, PA</addr-line>, <country>United States</country>
</aff>
<aff id="aff5">
<sup>5</sup>
<institution>Department of Immunology, University of Pittsburgh School of Medicine</institution>, <addr-line>Pittsburgh, PA</addr-line>, <country>United States</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Fabio Nicolini, Scientific Institute of Romagna for the Study and Treatment of Tumors (IRCCS), Italy</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Rafael Gongora, University of Salamanca, Spain</p>
<p>Vijayendra Dasari, The University of Queensland, Australia</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Anda M. Vlad, <email xlink:href="mailto:vladam@upmc.edu">vladam@upmc.edu</email>; Lixin Zhang, <email xlink:href="mailto:liz36@pitt.edu">liz36@pitt.edu</email>
</p>
</fn>
<fn fn-type="present-address" id="fn003">
<p>&#x2020;Present address: Anda M. Vlad, Division of Cancer Prevention, National Cancer Institute, National Institutes of Health, Rockville, MD, United States</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>17</day>
<month>07</month>
<year>2024</year>
</pub-date>
<pub-date pub-type="collection">
<year>2024</year>
</pub-date>
<volume>15</volume>
<elocation-id>1379175</elocation-id>
<history>
<date date-type="received">
<day>30</day>
<month>01</month>
<year>2024</year>
</date>
<date date-type="accepted">
<day>24</day>
<month>06</month>
<year>2024</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2024 Zhang, Strange, Elishaev, Zaidi, Modugno, Radolec, Edwards, Finn and Vlad</copyright-statement>
<copyright-year>2024</copyright-year>
<copyright-holder>Zhang, Strange, Elishaev, Zaidi, Modugno, Radolec, Edwards, Finn and Vlad</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Introduction</title>
<p>Intra-tumoral B cells mediate a plethora of immune effector mechanisms with key roles in anti-tumor immunity and serve as positive prognostic indicators in a variety of solid tumor types, including epithelial ovarian cancer (EOC). Several aspects of intra-tumoral B cells remain unclear, such as their state of activation, antigenic repertoires, and capacity to mature into plasma cells.</p>
</sec>
<sec>
<title>Methods</title>
<p>B lymphocytes were isolated from primary EOC tissue and malignant ascites and were maintained in cell culture medium. The stably maintained cell lines were profiled with flow cytometry and B cell receptor sequencing. Secreted antibodies were tested with a human proteome array comprising more than 21,000 proteins, followed by ELISA for validation. Originating tumor samples were used for spatial profiling with chip cytometry.</p>
</sec>
<sec>
<title>Results</title>
<p>Antibody-secreting B lymphocytes were isolated from the ovarian tumor microenvironment (TME) of four different EOC patients. The highly clonal cell populations underwent spontaneous immortalization <italic>in vitro</italic>, were stably maintained in an antibody-secreting state, and showed presence of Epstein-Barr viral (EBV) proteins. All originating tumors had high frequency of tumor-infiltrating B cells, present as lymphoid aggregates, or tertiary lymphoid structures. The antigens recognized by three of the four cell lines are coil-coil domain containing protein 155 (CCDC155), growth factor receptor-bound protein 2 (GRB2), and pyruvate dehydrogenase phosphatase2 (PDP2), respectively. Anti-CCDC155 circulating IgG antibodies were detected in 9 of 20 (45%) of EOC patients&#x2019; sera. Tissue analyses with multiparameter chip cytometry shows that the antibodies secreted by these novel human B cell lines engage their cognate antigens on tumor cells.</p>
</sec>
<sec>
<title>Discussion</title>
<p>These studies demonstrate that within the tumor-infiltrating lymphocyte population in EOC resides a low frequency population of antibody-secreting B cells that have been naturally exposed to EBV. Once stably maintained, these novel cell lines offer unique opportunities for future studies on intratumor B cell biology and new target antigen recognition, and for studies on EBV latency and/or viral reactivation in the TME of non-EBV related solid tumors such as the EOC.</p>
</sec>
</abstract>
<kwd-group>
<kwd>tumor infiltrating B cells</kwd>
<kwd>ovarian cancer</kwd>
<kwd>Epstein-Barr virus (EBV)</kwd>
<kwd>B lymphoblastoid cell lines</kwd>
<kwd>antibody-secreting cells</kwd>
<kwd>CCDC155</kwd>
<kwd>GRB2</kwd>
<kwd>PDP2</kwd>
</kwd-group>
<counts>
<fig-count count="7"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="91"/>
<page-count count="19"/>
<word-count count="10441"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Cancer Immunity and Immunotherapy</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>Epithelial ovarian cancer (EOC), the most common type of ovarian cancer, is an aggressive disease, and the eighth leading cause of death among women worldwide (<xref ref-type="bibr" rid="B1">1</xref>). Diagnosis typically occurs late, when the lesions have spread beyond the ovaries, and into the peritoneal cavity. Histologically, EOC is highly heterogeneous, with the tumor microenvironment (TME) displaying a mixture of several cell types (epithelial tumor cells, innate and adaptive immune cells, stromal cells etc.), with different roles and prognostic values (<xref ref-type="bibr" rid="B2">2</xref>). A variety of immune cells can be found inside the tumor mass, including CD8+ tumor infiltrating T lymphocytes (TILs), which contribute positively to antitumor immunity and are correlates of improved prognosis (<xref ref-type="bibr" rid="B3">3</xref>&#x2013;<xref ref-type="bibr" rid="B5">5</xref>). To enhance the number and cytolytic function of CD8 TILs, several immune therapeutic approaches have been tested to date, including immune checkpoint blockade, albeit with low clinical efficacy (<xref ref-type="bibr" rid="B6">6</xref>, <xref ref-type="bibr" rid="B7">7</xref>). Advancing successful immunotherapies for EOC depends in part on the detailed profiling of the cellular composition of the immune TME and of the numerous tumor-immune cell interactions (<xref ref-type="bibr" rid="B8">8</xref>).</p>
<p>In addition to cytotoxic NK and CD8 TILs, tumor infiltrating B lymphocytes (B TILs) are also essential players in the anti-tumor response, and several recent studies have provided high resolution characterizations of the tumor ecosystem, at single cell level (<xref ref-type="bibr" rid="B9">9</xref>, <xref ref-type="bibr" rid="B10">10</xref>). Although the antigen specificity and functionality of tumor-resident B cells have not been well characterized, the presence of plasma cells among the TILs seems to offer superior prognosis in EOC (<xref ref-type="bibr" rid="B11">11</xref>). Additionally, B TILs are often described in the context of intratumor tertiary lymphoid structures (TLS), and their coexistence with CD8+ TILs improves EOC clinical outcome (<xref ref-type="bibr" rid="B11">11</xref>&#x2013;<xref ref-type="bibr" rid="B14">14</xref>).</p>
<p>Among the main attributes of B cells is the fact that they are highly efficient antigen presenting cells, especially when presenting low-abundance antigens to T cells (<xref ref-type="bibr" rid="B15">15</xref>, <xref ref-type="bibr" rid="B16">16</xref>). They also play important roles in immune regulation, by secreting cytokines and chemokines (such as IFN&#x3b3;, CXCL10, GM-CSF, IL-12, IL-7, CCL3-5) which can stimulate T cell chemoattraction, T and NK cell cytotoxic function and macrophage activity (<xref ref-type="bibr" rid="B10">10</xref>, <xref ref-type="bibr" rid="B17">17</xref>, <xref ref-type="bibr" rid="B18">18</xref>). In contrast, regulatory B cells, often in positive correlation with Tregs, have also been reported in various cancer types (<xref ref-type="bibr" rid="B19">19</xref>) and can exert immune inhibitory functions, often via IL-10 and IL-35 secretion (<xref ref-type="bibr" rid="B20">20</xref>, <xref ref-type="bibr" rid="B21">21</xref>).</p>
<p>The overall fitness of memory T and B TILs depends on the inflammatory milieu and may also be influenced by earlier encounters that have impacted their genome. As the main target of the Epstein-Barr Virus (EBV, also known as the human herpes virus 4), human B cells can harbor this ubiquitous virus early and carry it in a latent phase throughout the lifetime of the host. More than 90% of the globe&#x2019;s population (<xref ref-type="bibr" rid="B22">22</xref>) has been exposed to EBV, and B cells express CD21 and CD35, the major receptors for viral entry (<xref ref-type="bibr" rid="B23">23</xref>). Children exposed to EBV develop no or mild symptoms, whereas infection of adolescents can result in infectious mononucleosis (<xref ref-type="bibr" rid="B24">24</xref>). While EBV can infect both na&#xef;ve and memory B cells, its prolonged persistence is through survival in a latent state in a subset of long-lived, memory B cells (<xref ref-type="bibr" rid="B25">25</xref>) that can evade immune surveillance. Since its first identification as an oncogenic virus that triggers transformation in Burkitt&#x2019;s lymphoma (<xref ref-type="bibr" rid="B26">26</xref>), accumulating evidence points to EBV as the potential cause of several types of blood cancers and solid tumors (<xref ref-type="bibr" rid="B27">27</xref>, <xref ref-type="bibr" rid="B28">28</xref>), and of autoimmune diseases such as multiple sclerosis and systemic lupus erythematosus (<xref ref-type="bibr" rid="B24">24</xref>).</p>
<p>Demonstrating EBV&#x2019;s oncogenic potential, B lymphoblastoid cell lines have been previously established either spontaneously from the blood or lymphoid tissue of infected patients, or via <italic>in vitro</italic> EBV infection of blood circulating B cells (<xref ref-type="bibr" rid="B29">29</xref>). Collectively, these cell lines have been widely used for lymphomagenesis research models, or for mechanistic studies on the EBV-induced dynamic changes in B cell phenotypes (<xref ref-type="bibr" rid="B30">30</xref>). Similarly, <italic>in vitro</italic> exposure of tumor-isolated B cells to EBV has been used for the establishment of antibody-secreting lymphoblastoid cell lines (<xref ref-type="bibr" rid="B31">31</xref>&#x2013;<xref ref-type="bibr" rid="B33">33</xref>), albeit with a low yield (<xref ref-type="bibr" rid="B32">32</xref>).</p>
<p>The quality and quantity of B TILs and their spatial distribution in the immune TME are important factors that influence tumor biology, and a better understanding of these factors may provide new opportunities for therapeutic interventions. Several aspects of intratumoral B cells remain unclear, such as their state of activation, antigenic repertoires, and capacity to mature into plasma cells. We report here that some of the tumor-resident memory B cells isolated from inflamed EOC cases (i.e. cases with high frequency of T and B TILs) are EBV positive, and that upon ex vivo culture, these EBV viral protein-expressing lymphoblastoid B cells become immortalized in an antibody-secreting state. Using protein arrays, we identified and validated the potential targets of the secreted antibodies. The newly described antigens are the coil-coil domain containing protein 155 (CCDC155), growth factor receptor-bound protein 2 (GRB2), and pyruvate dehydrogenase phosphatase2 (PDP2), respectively. The antibodies recognize their targets in the tumor microenvironment, raising new venues of exploration of their antigenic and immunogenic potential in EOC. These studies provide new insights on EBV status in B TILs and supply a platform for immortalization of tumor resident, naturally infected B cells, isolation and characterization of their secreted antibodies and antigen identification.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and methods</title>
<sec id="s2_1">
<title>Primary tumor tissue, ascites, PBMCs and ovarian cancer cell lines</title>
<p>All patient samples were obtained deidentified, according to approved institutional IRB protocol, and after patient consent. Sample processing occurred within 2-3 hours from collection time. Fresh tumor tissue was washed with DPBS (Corning), cut into 1 to 2 mm<sup>3</sup> pieces and put into a T75 flask (Corning) with 15 ml complete RPMI-1640 (RPMI supplemented with 10% fetal bovine serum (FBS, Gibco), 10,000 U/L penicillin (Sigma), 10,000 U/L streptomycin (Sigma), and 2 mmol/L L-glutamine (Gibco). Cells were maintained at 37&#xb0;C, 5% CO<sub>2</sub>, and fresh culture medium was added every 3-5 days. Cells were trypsinized at confluency, using TrypLE&#x2122; Express (Gibco), and the tissue organoids and 1/5 of the cells were replated. For B lymphoblastoid cell lines, after about six weeks, the lymphocyte-like cells were collected by pipetting and moving to a new flask and cultured with complete RPMI. For human ovarian cancer cell lines, attached stromal cells were removed by short period trypsinization (2-3 mins) while the epithelial tumor cells were still attached to the flask, followed by trypsinization for another 5 to 10 minutes to recover the tumor cells, 1/5 of which were replated. Cells were propagated for 15 to 20 passages to form cell lines.</p>
<p>Ascites fluid was centrifuged at 400 g, 10 minutes. Pelleted cells were placed in a T75 flask in 20 ml complete RPMI-1640 and cultured long term.</p>
<p>Peripheral blood mononuclear cells (PBMCs) from female healthy donors were purchased from STEMCELL technologies and cultured in the same conditions.</p>
<p>All EOC cell lines and the human EBV-related Burkitt lymphoma cell line Raji were obtained from ATCC, except for UP04, UP13 and UP14 cell lines, which were derived in house from primary tissue. All cancer cells were cultured in complete RPMI-1640.</p>
</sec>
<sec id="s2_2">
<title>Antibody purification, isotype determination and PE/R-Phycoerythrin conjugation</title>
<p>The B cells derived from ovarian cancer (BOC cell lines) were transferred to serum-free AIM-V medium (Gibco) for a minimum of 5 days (and up to three weeks) prior to antibody purification, so only the BOC- secreted immunoglobulins would be pulled down by the protein A/G beads (<xref ref-type="bibr" rid="B34">34</xref>). Cell free culture supernatants were co-incubated with protein A/G Plus agarose (Pierce) or PureProteome&#x2122; Kappa Ig Binder Magnetic Beads (Millipore) at room temperature (RT) for 60 minutes. After three washes in PBS, antibodies were eluted with 0.2 M glycine-HCl, pH2.2 followed by neutralizing 1M Tris-HCl solution, pH8.9. A fraction of isolated IgG (5&#x3bc;g) was loaded onto 4-20% SDS-PAGE to check for purity. Purified antibodies were conjugated with PE (Ab36, Ab73) or PerCP-Cy5.5 (Ab89) using PE/R-Phycoerythrin or PerCP-Cy5.5 Conjugation Kit - Lightning-Link<sup>&#xae;</sup> (Abcam). Isotypes of purified antibodies were determined using Pro-Detect Rapid Antibody Isotyping Assay Kit-Human (ThermoScientific) according to the provided protocol. Serum IgG fraction was purified using caprylic acid (<xref ref-type="bibr" rid="B35">35</xref>) and sodium sulfate precipitation, as previously described (<xref ref-type="bibr" rid="B36">36</xref>).</p>
</sec>
<sec id="s2_3">
<title>Flow cytometry</title>
<p>Cells were stained with fluorescent labeled primary antibodies or isotype control in 1% bovine serum albumin (BSA, Fisher Bioreagents) in DPBS, on ice, for 30-40 min, and the data were acquired with LSR II and analyzed with FACSDiva or FlowJo (all from BD). The following anti-human antibodies were used: FITC-CD19 1:5, FITC-CD20 1:5, APC-CD27 1:5, BV421-anti-human IgD 1:100, PE-Cy7-CD28 1:100, PE-anti-human IgG 1:5 (all from BD), PE-CD138 1:100 and PerCP-Cy5.5-CD45 1:100 (both from BioLegend).</p>
</sec>
<sec id="s2_4">
<title>Chip cytometry</title>
<p>Cells (1x10<sup>6</sup>) suspended in 100 &#x3bc;l DPBS were loaded onto cell chips (ZellSafe, Canopy Biosciences) and allowed to settle for 5-10 minutes at RT. The cell chips were washed with 1 ml DPBS, fixed with fixation buffer (Canopy Biosciences) for 45 minutes at 4&#xb0;C, and washed with 1 ml DPBS followed by 1 ml ZELLKRAFTWERK storage buffer (Canopy Biosciences). Cells were stained with PE-anti-human Ig, kappa 1:100 BV421-anti-human Ig, lambda 1:100, PE-anti-human IgG1 1:100, BUV395-anti-human IgG3 1:100 (all from BD), PE-Ab36 1:100. All antibodies were titrated in 300 &#x3bc;l of ZELLKRAFTWERK storage buffer and incubated at RT for 5 minutes. After washing the cell chips with 5 ml DPBS two times at a 2-minute interval, images were acquired with ZellScanner ONE or CellScape&#x2122; and analyzed with ZKWapp DataWizard (Canopy Biosciences). Tissue chips were mounted with 4 &#x3bc;m sections from formalin fixed and paraffin embedded (FFPE) tissue blocks following the protocol provided by Canopy Biosciences and stained with AF488-anti-CA125 1:100 (R&amp;D systems), PE-anti-Vimentin 1:500 (BD), PerCP-Anti-CD3 1:100, PerCP-anti-EpCAM 1:100 (Canopy Biosciences Spatial Immune Profiling Kit), PE-Ab36 1:100, PE-Ab73 1:100 and PerCP-Cy5.5-Ab89 1:300 (labeled in house with PE, or PerCP-Cy5.5 according to manufacturer&#x2019;s instructions and as described above), at room temperature, for one hour.</p>
</sec>
<sec id="s2_5">
<title>Immunohistochemistry</title>
<p>Sectioning of formalin-fixed, paraffin embedded tumor blocks into four-micron sections, and hematoxylin/eosin (H&amp;E) staining were performed at the Magee-Womens Research Institute Pathology Core. Histopathology examination was performed by a trained pathologist (EE). Blank slides were used in house for IHC. Slides were left at 56&#xb0;C overnight and rehydrated with xylene, 100% ethanol, 95% ethanol, 70% ethanol and water. Peroxidase blocking with 3% H<sub>2</sub>O<sub>2</sub>/methanol (Fisher Chemical) and antigen retrieval was performed by boiling the slides for 20 minutes in pH 9 Tris-EDTA buffer. The slides were blocked with 1% BSA in DPBS, 30 min at RT. The positive signal was detected using the ImmPACT DAB EqV Substrate Kit (Vector Laboratories, Burlingame, CA) and the slides were counterstained with hematoxylin. To ensure specificity of staining, control sections were stained with HRP-conjugated human IgG isotype control.</p>
<p>Single stain for PNAd (BioLegend, clone MECA-79, 1:50) was performed using Tris-EDTA (pH 9, 20 min). Biotin mouse anti-rat IgM Antibody (BioLegend, clone MRM-47, 1:100) was used as secondary antibody, followed by Pierce&#x2122; High Sensitivity Streptavidin-HRP (Thermo Scientific, 1:500). Agilent Liquid DAB+ Substrate Chromogen System was used as chromogen. For CD3/CD20 dual IHC, the protocol provided with Vector ImmPRESS Duet Double Staining Polymer Kit was used to carry out the staining. Mouse anti-human CD3 (Agilent, Clone F7.2.38, 1:100) and rabbit anti-human CD20 (Abcam, Clone EP459Y, 1:200) were used as the primary antibodies. Images were captured with Axiocam 105 color camera on ZEISS Light Microscope.</p>
</sec>
<sec id="s2_6">
<title>Western blot</title>
<p>Cell pellets were washed with cold DPBS and lysed with RIPA (Pierce, Rockford, IL, USA) supplemented with Halt protease inhibitor cocktail, Halt phosphatase inhibitor cocktail and 0.05 M ethylenediaminetetraacetic acid (Thermo Scientific, Rockford, IL, USA). Protein lysates (10&#x2013;20 &#x3bc;g) were loaded onto 4&#x2013;20% Mini-Protean precast gel (Bio-Rad Laboratories) and run at 150V for 1h and transferred at 120 mA for 90 minutes to nitro-cellulose membranes (Bio-Rad Laboratories). Membranes were incubated in blocking buffer -2% BSA (Fisher Scientific), at RT for 1h and then blotted with primary antibodies in blocking buffer with 0.05% Tween-20 (Fisher Bioreagents), at 4&#xb0;C overnight. Primary antibodies to the following antigens were used: EBV latent membrane protein 1 (Abcam, [CS 1-4], ab78113, 1:2000), &#x3b2;-actin (Sigma, A1978, 1:5000). CCDC155 (polyclonal antibody (Sigma-Aldrich, HPA019940, 200 mg/ml, 1:1000), human Ig kappa light chain (R&amp;D Systems, Cat. # MAB10050-100, 1:2000), human Ig, lambda light chain (clone 1000040, R&amp;D Systems&#x2122;, 1:2000), mouse-anti-GST (Abcam, ab92, 3G10/1B3, 1:5000).</p>
<p>Goat-anti-mouse (170&#x2013;6516) or goat-anti-rabbit (170-6515) IgG-HRP (both from Bio-Rad), or rabbit-anti-human IgG-HRP (Dako, 1.34 g/L) were diluted 1:6000 in blocking buffer. SuperSignal West Femto kit (Thermo Scientific) was used to develop the membranes. Images were taken with Chemidoc XRS darkroom system (Bio-Rad).</p>
</sec>
<sec id="s2_7">
<title>PCR</title>
<p>Primers (IDT) used for all PCR protocols are listed in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>. Two EBV genes - <italic>LMP1</italic> (<xref ref-type="bibr" rid="B37">37</xref>) and <italic>EBNA3C</italic> (<xref ref-type="bibr" rid="B38">38</xref>)- were detected using two sets of primers, respectively. Wild type <italic>LMP1</italic> shows up as a band of 316 bp, while <italic>LMP1-Del30</italic> has a band of 286 bp. Type I virus shows a <italic>EBV3C</italic> band of 153 bp and type II of 246 bp. PCR conditions: 95&#xb0;C, 3 min; (95&#xb0;C, 30s; 58&#xb0;C, 30s; 72&#xb0;C, 1 min) x 40; 72&#xb0;C, 5 min; 12&#xb0;C hold. 1.5% TAE gel, 120v, 40 min.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>PCR primers.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Name</th>
<th valign="middle" align="center">Sequence*</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">
<italic>LMP1</italic>-Forward</td>
<td valign="middle" align="left">5&#x2032;&#x2010;AGCGACTCTGCTGGAAATGAT&#x2010;3&#x2032;</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>LMP1</italic>-Reverse</td>
<td valign="middle" align="left">5&#x2032;&#x2010;TGATTAGCTAAGGCATTCCCA&#x2010;3&#x2032;</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>EBV3C</italic>-Forward</td>
<td valign="middle" align="left">5&#x2019;-AGAAGGGGAGCGTGTGTTGT-3&#x2019;</td>
</tr>
<tr>
<td valign="middle" align="left">EBV3C-Reverse</td>
<td valign="middle" align="left">5&#x2019;-GGCTCGTTTTTGACGTCGGC-3&#x2019;</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>CCDC155</italic> Forward</td>
<td valign="middle" align="left">5&#x2019;-CAGCCTAGCCAGTGACATCC-3&#x2019;</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>CCDC155</italic> Reverse</td>
<td valign="middle" align="left">5&#x2019;-TGGGGACTCACCCATGTAGT-3&#x2019;</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>CCDC155</italic> F1</td>
<td valign="middle" align="left">5&#x2019;-GTTCCG<underline>
<italic>GGATCC</italic>
</underline>ATGGACCTGCCCGAG-3&#x2019;</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>CCDC155</italic> R1</td>
<td valign="middle" align="left">5&#x2019;-CACGAT<underline>
<italic>GCGGCCG C</italic>
</underline>CAGAGCCAAGATCTC-3&#x2019;</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>CCDC155</italic> F2</td>
<td valign="middle" align="left">5&#x2019;-GTTCCG<underline>
<italic>GGATCC</italic>
</underline>TTGCAGCGGAGCATG-3&#x2019;</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>CCDC155</italic> R2</td>
<td valign="middle" align="left">5&#x2019;-CACGAT<underline>
<italic>GCGGCCGC</italic>
</underline>TTTCTGTCGAATGGC-3&#x2019;</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>CCDC155</italic> F3</td>
<td valign="middle" align="left">5&#x2019;-GTTCCG<underline>
<italic>GGATCC</italic>
</underline> CAGCTGAGAAGAGTG-3&#x2019;</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>CCDC155</italic> R3</td>
<td valign="middle" align="left">5&#x2019;-CACGAT<underline>
<italic>GCGGCCGC</italic>
</underline>CTCTCACACTGGAGG-3&#x2019;</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>CCDC155</italic> F4</td>
<td valign="middle" align="left">5&#x2019;-GTTCCG<underline>
<italic>GGATCC</italic>
</underline>GAGATCTTGGCTCTG-3&#x2019;</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>CCDC155</italic> R4</td>
<td valign="middle" align="left">5&#x2019;-CACGAT<underline>
<italic>GCGGCCG C</italic>
</underline>CAGATGCTGCTGCTC-3&#x2019;</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>CCDC155</italic> F5</td>
<td valign="middle" align="left">5&#x2019;-GTTCCG<underline>
<italic>GGATCC</italic>
</underline>GAACAGAATCGCAGC-3&#x2019;</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>CCDC155</italic> R5</td>
<td valign="middle" align="left">5&#x2019;-CACGAT<underline>
<italic>GCGGCCGC</italic>
</underline>AGTGCGCTCAGAGAG-3&#x2019;</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>CCDC155</italic> F6</td>
<td valign="middle" align="left">5&#x2019;-GTTCCG<underline>
<italic>GGAT CC</italic>
</underline>TTGAAGCGGCAGCTC-3&#x2019;</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>CCDC155</italic> R6</td>
<td valign="middle" align="left">5&#x2019;-CACGAT<underline>
<italic>GCGGCCGC</italic>
</underline>TCTTCTCAGCTGGGC-3&#x2019;</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>*Italicized sequences mark the BamHI and NotI restriction enzyme cut sites.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<p>PCR conditions for <italic>CCDC155</italic>: ~90ng DNA templates; 94&#xb0;C 3min; (94&#xb0;C, 30s;58&#xb0;C,30s;72&#xb0;C, 1min) x40; 72&#xb0;C, 5min; 12&#xb0;C. 1.0% TAE gel, 120v, 40 min. Wild type gene appears as a single band. Upon knock-out, multiple bands or smears will appear due to the DNA repair attempts.</p>
<p>A total of six pair of primers (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>) were used for antibody epitope mapping. BamHI and NotI restriction enzymes cut sites (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>, <italic>italic</italic>) were inserted into forward and reverse primers, respectively, for cloning purposes.</p>
<p>Templates for <italic>CCDC155</italic> F1/R1, F2/R2 and F3/R3: 1ng pcDNA3.1-CCDC155 (GeneScript, OHu32184), 94&#xb0;C 3min; (94&#xb0;C, 30s;65&#xb0;C,30s;72&#xb0;C, 1min) x35; 72&#xb0;C, 5min; 12&#xb0;C. 1.0% TAE gel, 120v, 33 min. 10 &#x3bc;l loaded.</p>
<p>Templates for <italic>CCDC155</italic> F4/R4 and F5/R5: 10ng pcDNA3.1-CCDC155 in 200&#x3bc;l total reaction volume. 94&#xb0;C 3min; (94&#xb0;C, 30s;67&#xb0;C,30s;72&#xb0;C, 1min) x 37; 72&#xb0;C, 5min; 12&#xb0;C. 1.5% TAE gel, 120v, 32min, 8 &#x3bc;l loaded.</p>
</sec>
<sec id="s2_8">
<title>BCR sequencing</title>
<p>Genomic DNA was extracted using Qiagen AllPrep DNA/RNA Micro Kit and sent to Adaptive Biotechnologies for BCR sequencing. Sequencing data were analyzed using immunoSEQ Analyzer 3.0.</p>
</sec>
<sec id="s2_9">
<title>Proteomics array for target identification</title>
<p>Purified antibodies were shipped to CDI LABS, to be analyzed with the High-Spec<sup>&#xae;</sup> cross-reactivity assay on the HuProt&#x2122; human proteome array, which contains &gt;21,000 unique, full&#x2010;length, individually purified human proteins on a single microscope slide. According to the manufacturer&#x2019;s description, the full&#x2010;length recombinant proteins are expressed in the yeast S. cerevisiae, purified, and printed on glass slides in duplicate, along with a set of control proteins (GST, BSA, histones, IgG, etc.). The HuProt&#x2122; expression library was created by inserting full-length human open reading frames (ORFs) into a yeast high-copy expression vector that produces GST-His6 fusion proteins when induced in yeast (<xref ref-type="bibr" rid="B39">39</xref>, <xref ref-type="bibr" rid="B40">40</xref>). The company-provided protocol describes that the arrays were incubated with blocking buffer (1xTBS/0.1% Tween 20/5% BSA) at room temperature for 1 hr, with gentle shaking. Antibodies were diluted to 1 &#x3bc;g/mL in blocking buffer and probed on the arrays for 1 hour. After probing, the arrays were washed three times with TBST (1xTBS/0.1% Tween 20) for 10 min, and then exposed to Alexa647-anti-mouse IgG Fc secondary antibody (0.25 &#x3bc;g/mL) for 1 hour in a light-proof box with gentle shaking, followed by 3 washes with TBST for 10 min each and 3 rinses with ddH<sub>2</sub>O. The arrays were then dried with an air duster and scanned using a GenePix 4000B scanner for data collection. Non-specific hits (due to binding to the secondary antibody) were eliminated from the analysis. CDI software was used to quantify binding to specific proteins on the array, based on Z Scores, as described in the statistical analysis section.</p>
</sec>
<sec id="s2_10">
<title>Ab36 epitope mapping</title>
<p>Six pair of primers were designed to amplify CCDC155 cDNA fragments (further detailed in the &#x201c;PCR&#x201d; section). The full CCDC155 protein contains 562 amino acids (aa). The first three pairs of primers were used to amplify fragments F1, F2, and F3, encoding aa 1 to 204, aa 182 to 383, and aa 358-562, respectively, with a 22 aa overlap between F1 and F2, 25 aa overlap between F2 and F3. The amplified fragments were digested with BamHI and Not I (Thermo Fisher), at RT for 10 minutes, and linked into BamHI and Not I digested pGEX-4T-1 (Cytiva, Product No. 28954549) vector, respectively, using the Rapid DNA Ligation Kit (Thermo Fisher). The constructed vectors (5 &#x3bc;l) were transformed into 50 &#x3bc;l BL21 (DE3) competent cells (Thermo Fisher) at 42&#xb0;C for 30 seconds, followed by incubation on ice, for 2 minutes. After adding 250 &#x3bc;l of S.O.C. Medium (Thermo Fisher), the transformed <italic>E. coli</italic> BL21 (DE3) cells were placed on a shaker, at 200 rpm, 37&#xb0;C for 1 hour. The <italic>E. coli</italic> cells from each transformation reaction were spread on separate LB plates containing 100 &#x3bc;g/ml ampicillin (Thermo Fisher) and incubated overnight at 37&#xb0;C. Colony PCR was performed using the same primers and conditions for amplification of the corresponding fragments, as described in the PCR section. Three positive colonies from each transformation were picked, placed in 3 ml LB medium with 100 ug/ml ampicillin at 200 rpm, 37&#xb0;C overnight and 1:100 diluted in 3 ml fresh LB medium with 100 ug/ml ampicillin and 0.5M IPTG (Thermo Fisher), 200 rpm, 37&#xb0;C for 4 hours. Cell pellets from 1.5 ml were resuspended in 500 ul 1x SDS-PAGE loading buffer (Bio-Rad), ultrasonic treatment (Sonics GEX130 Ultrasonic Processor) for 30 seconds and heated at 95&#xb0;C for 5 minutes. SDS-PAGE and Western blot were used to confirm the expression of the protein fragments.</p>
</sec>
<sec id="s2_11">
<title>ELISA</title>
<p>Immulon 4 HBX ELISA plates (Thermo Fisher) were coated with one of the following proteins: CCDC155-GST, CPNE1-GST, PDP2-GST, NO66-GST, GMPS-GST, PTPN2-GST (all from CDI). Recombinant S. japonicum GST protein (Abcam) was used as control. All proteins were diluted in DPBS at 4 &#x3bc;g/ml, 100 &#x3bc;l/well in duplicates, incubated at 4&#xb0;C overnight. Excess protein was washed four times with PBS-T (with 0.05% Tween-20) and blocking buffer (1% BSA in PBS) was added for one hour at RT. Purified antibody was added at 2 &#x3bc;g/ml, 100 &#x3bc;l/well. Human serum/plasma were 1:50 diluted with blocking buffer and added at 100 &#x3bc;l/well. Both were incubated for one hour at RT. HRP-rabbit-anti-human IgG, 1:5000 (Dako), HRP-mouse anti-human IgG3 (hinge) 1:1000, HRP-goat anti-human IgG1 (heavy chain) 1:1000, HRP- goat anti-human lambda light chain (1:2000), HRP- goat anti-human kappa light chain (1:2000), (all four from Invitrogen), or AP-goat-anti-human IgG (1:5000, Sigma) were added at 100 &#x3bc;l/well for one hour at RT. Reaction was developed using TMB (BD) at RT for 12 to 15 minutes or p-Nitrophenyl phosphate (Sigma) at RT for 20 minutes, and plates were read at 450 nm or 405 nm, respectively with Infinite 200 Pro ELISA plate reader (Tecan). The reported values represent optical density units at 450nm (OD450) and were calculated after subtraction of the anti-GST background, as follows: CCDC155 (OD450) = CCDC155-GST (OD450) - GST (OD450). The same formula was applied to samples read at 405nm wavelength.</p>
</sec>
<sec id="s2_12">
<title>CRISPR-mediated deletion of <italic>CCDC155</italic>
</title>
<p>Ovarian cancer TOV21G cells (4 x 10<sup>5</sup> cells in 3 ml cRPMI/well) were seeded in 6-well tissue culture plate, without antibiotics. UltraCruz&#x2122; Transfection Reagent (Santa Cruz Biotechnology, sc-395739, 10 &#xb5;l) was diluted in 140 &#xb5;l Plasmid Transfection Medium (Santa Cruz Biotechnology, sc-108062). CCDC155 double nickase plasmids (2 &#xb5;g) (Santa Cruz Biotechnology, sc-410329-NIC) or control plasmids (2 &#xb5;g) were added into Plasmid Transfection Medium (Santa Cruz Biotechnology) to final volume of 150 &#xb5;l, mixed with the transfection solution and added dropwise to the well containing TOV21G cells in 2ml fresh antibiotic-free growth medium. After culturing for 24 hours, cells were trypsinized with 1 ml/well Gibco&#x2122; TrypLE&#x2122; Express, washed and analyzed via flow cytometry to check the transfection efficiency. GFP sorting and puromycin selection were used sequentially to achieve high yield (~90%) of <italic>CCDC155</italic> gene knockout. GFP positive cells were sorted, resuspended in 10 ml cRPMI without antibiotic and divided into four wells (3x10<sup>4</sup>/well/2.5ml) in a 12-well plate and cultured overnight, followed by adding puromycin to 400, 500, 600, 700 ng/ml cRPMI, respectively, for a 7-day selection. PCR and Western blot were used to confirm the loss of CCDC155.</p>
</sec>
<sec id="s2_13">
<title>Transfection with plasmid encoding for human CCDC155 protein</title>
<p>OVCA432 cells were seeded in a well of a 6-well plate, 1x10<sup>6</sup> cells/well in cRPMI and cultured overnight at 37&#xb0;C, 5% CO<sub>2</sub>. Cells were transfected with either CCDC155_OHu32184D_pcDNA3.1+/C-(k)-DYK (3 &#xb5;g) or control pcDNA3.1+ (3 &#xb5;g) (GenScript) using UltraCruz<sup>&#xae;</sup> Transfection Reagent (Santa Cruz Biotechnology). The transfected cells were cultured for 48 hours and CCDC155 expression was confirmed by Western blot.</p>
</sec>
<sec id="s2_14">
<title>Statistics</title>
<p>Z Score is the average Z Score of the duplicate spots of a given protein (each protein was printed in duplicate on the HuProt&#x2122; array). The Z Score of each spot on a given array is calculated with the formula Z= [F635 &#x2013; F635(avg)]/F635(std).</p>
<p>F635(avg) and F635(std) are the average and standard deviation of the F635 values of all spots on the array, respectively. F635 is the average foreground signal intensity of 2 replicate spots of a given protein in the detection channel (IgG = 635 nm). The complete statistical methodology has been previously reported (<xref ref-type="bibr" rid="B41">41</xref>).</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>Patient characteristics</title>
<p>We used clinical specimens from four different EOC cases, with disease characteristics detailed in <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>. All patients had high grade serous EOC, FIGO stage IIIc (3 patients) or IIIb (one patient). Two of the samples were chemo-na&#xef;ve and were obtained at the time of primary surgical debulking, while the other two were collected at the time of interval surgery, 27 and 16 days post completion of neoadjuvant chemotherapy, respectively, according to standard of care.</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Patient demographics.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Cell line name</th>
<th valign="top" align="left">*BOC-36</th>
<th valign="top" align="left">BOC-73</th>
<th valign="top" align="left">BOC-78</th>
<th valign="top" align="left">BOC-89</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">
<bold>Cell line originating site</bold>
</td>
<td valign="top" align="left">Tumor</td>
<td valign="top" align="left">Tumor</td>
<td valign="top" align="left">Ascites</td>
<td valign="top" align="left">Tumor</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Patient ID</bold>
</td>
<td valign="top" align="left">19-36</td>
<td valign="top" align="left">21-73</td>
<td valign="top" align="left">22-78</td>
<td valign="top" align="left">22-89</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Tumor biopsy ID</bold>
<break/>
<bold>(Collection time)</bold>
</td>
<td valign="top" align="left">19-36 Tumor<break/>(Interval, 27 days**)</td>
<td valign="top" align="left">21-73 Tumor<break/>(Primary)</td>
<td valign="top" align="left">22-78 Tumor<break/>(Primary)</td>
<td valign="top" align="left">22-89 Tumor<break/>(Interval, 16 days)</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Age range at diagnosis</bold>
</td>
<td valign="top" align="left">70-75</td>
<td valign="top" align="left">75-80</td>
<td valign="top" align="left">70-75</td>
<td valign="top" align="left">65-70</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Histology</bold>
</td>
<td valign="top" align="left">High Grade Serous</td>
<td valign="top" align="left">High Grade Serous</td>
<td valign="top" align="left">High Grade Serous</td>
<td valign="top" align="left">High Grade Serous</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Stage</bold>
</td>
<td valign="top" align="left">IIIc</td>
<td valign="top" align="left">IIIc</td>
<td valign="top" align="left">IIIb</td>
<td valign="top" align="left">IIIc</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Chemo status</bold>
</td>
<td valign="top" align="left">Post-NACT***</td>
<td valign="top" align="left">Chemo na&#xef;ve</td>
<td valign="top" align="left">Chemo na&#xef;ve</td>
<td valign="top" align="left">Post-NACT</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>*BOC, B cells derived from ovarian cancer; **Days post-NACT ***NACT- neoadjuvant chemotherapy.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s3_2">
<title>Spontaneous immortalization of B lymphoblastoid cell lines after prolonged <italic>in vitro</italic> culture of primary cells isolated from ovarian tumor tissue and malignant ascites</title>
<p>All samples (three fresh tumor tissue and one malignant ascites, <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>) were handled as described in Materials and Methods, and as outlined in the study diagram (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;1</bold>
</xref>). Following tissue processing, all cell populations exhibited the expected morphological heterogeneity, with cancer cells, fibroblasts and immune cells being visible in the cell culture flask (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;2A</bold>
</xref>). After several weeks in culture, outgrowth of a single cell phenotype was observed. The rapid expansion indicated that cells have entered the stage of exponential proliferation, and the growth pattern showing cell clumping and rosette morphology (<xref ref-type="bibr" rid="B42">42</xref>) was suggestive of a proliferating lymphocytic population (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). Cells were continuously propagated <italic>in vitro</italic> for an average of 15 weeks, until stably maintained. Multi-parameter flow cytometry and chip cytometry data (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1B, C</bold>
</xref>) revealed that the established cells are homogeneously positive for the pan-leukocyte marker CD45, negative for the CD3 T cell marker, and positive for CD19 and CD20, indicating that all four lines are lymphoblastoid B cells (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref> and <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;2B</bold>
</xref>), exhibiting the expected size, morphology, and cell surface marker distribution (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1C</bold>
</xref>). Importantly, all cells are positive for the CD27 memory marker (<xref ref-type="bibr" rid="B43">43</xref>) and express high levels of plasma cell markers CD138 (<xref ref-type="bibr" rid="B44">44</xref>) and CD28 (<xref ref-type="bibr" rid="B45">45</xref>). Three of the four cell populations (BOC-36, BOC-73, and BOC-89) are IgG positive (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>). The fourth cell line (BOC-78) is IgM positive, with most IgM+ cells co-expressing IgD, as shown by flow (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1D</bold>
</xref>) and chip cytometry (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1E</bold>
</xref>). Altogether, these phenotypic markers point to an antigen-experienced, IgG or IgM memory plasma cell phenotype.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>All four newly established cell lines show lymphoblastoid characteristics and are positive for B cell markers. <bold>(A)</bold> Visualization of stably cells in culture, cultured in T75 flasks, using a camera attached to inverted microscope (20 &#xd7; magnification); Arrows- cell clumping; asterisks- rosette shape morphology. <bold>(B)</bold> Dot plot analysis of cell surface marker distribution (indicated on x and y axes), using multicolor flow cytometry. Gates were set using isotype controls. Percent positive cells are shown. <bold>(C)</bold> Morphological characterization of BOC-36 cells and assessment of marker distribution using chip cytometry. Scale bar (white)- 50&#x3bc;m. <bold>(D, E)</bold> IgM and IgD expression on BOC-78 cells using flow <bold>(D)</bold> and chip cytometry <bold>(E)</bold>. Scale bar (white)-50&#x3bc;m.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1379175-g001.tif"/>
</fig>
</sec>
<sec id="s3_3">
<title>B cells originate in tumors with T and B cell conglomerates</title>
<p>Histopathologic examination of the originating tumor tissue reveals an immune inflammatory tumor profile, with presence of tumor infiltrating, small mononuclear cells visible on hematoxylin-eosin (HE) staining (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>). The cells are positive for T and B cell markers on dual stain IHC or tissue chip cytometry (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>). The T and B cell infiltrates resemble lymphoid aggregates (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>), the hallmark of inflamed tumor phenotypes (<xref ref-type="bibr" rid="B46">46</xref>). The starting material for cell line BOC-78 was ovarian cancer ascites fluid (sample 22-78-Ascites, <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>), consisting of mostly CD45+ inflammatory immune cells, including CD3+ T and CD19+ B lymphocytes, CD14+ monocyte/macrophages and CD56 NK cells (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>). Importantly, this patient&#x2019;s corresponding tumor tissue (sample 22-78-Tumor) also shows presence of infiltrating CD20+ B cells, mostly as T-B cell conglomerates (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>). Of the four samples, staining for peripheral lymph node addressin (PNAd), important for lymphocyte homing, was positive in tumor samples 19-36 (the source of BOC-36, <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>) and 21-73 (the source of BOC-73, <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>), suggesting possible TLS formation in these two cases (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>). For the other two PNAd negative cases (22-89 Tumor and 22-78 Tumor), we classify the T and B cell infiltrates as lymphoid aggregates. Together, these results point to the presence of a B TIL-rich environment and presence of intratumor T/B lymphoid conglomerates (either as aggregates or TLS) (<xref ref-type="bibr" rid="B11">11</xref>, <xref ref-type="bibr" rid="B47">47</xref>) in all four EOC cases.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>B cell lines originate in tumors with inflamed phenotypes. <bold>(A)</bold> Tissue histology using hematoxylin and eosin (HE) stain. Tumor areas (T) surrounded by small mononuclear cell infiltrates suggestive of TILs (arrowheads). Scale bars- 50&#x3bc;m. <bold>(B)</bold> T and B cell intratumor distribution using dual color immunohistochemistry (left two panels- CD3- brown; CD20- red) and chip cytometry (right two panels, colors as indicated), Scale bar- 50&#x3bc;m. <bold>(C)</bold> Immune phenotyping of ascites cells using flow cytometry (dot plots, upper left and lower left, and right panels). Cells were gated on CD45+ cells, percent double positive cells are shown. Gates were set using isotype controls for each marker. Chip cytometry images of ascites cells (upper right panel). Scale bar, 50 &#x3bc;m. <bold>(D)</bold> Immunohistochemistry staining for PNAd in tumor samples 19-36 (origin of BOC-36) and 21-73 (origin of BOC-73). Scale bar, 50&#x3bc;m.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1379175-g002.tif"/>
</fig>
</sec>
<sec id="s3_4">
<title>Spontaneously immortalized lymphoblastoid B cells are EBV positive</title>
<p>To identify the potential cause for the observed spontaneous immortalization, we interrogated all four B lines for the presence of EBV, an oncogenic virus with tropism for and latency in memory B cells. PCR analyses revealed the presence of LMP1 and EBV3C viral genes in all four cell lines (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>). The LMP1 PCR product from samples BOC-78 and BOC-89 had a size consistent with the wild-type sequence (316 base pairs, bp), also found in the well characterized, EBV positive RAJI B lymphoma cell line (<xref ref-type="bibr" rid="B48">48</xref>), included as positive control. The smaller size PCR products detected in BOC-36 and BOC-73 suggest that these patients had been infected with the LMP1 30-bp deletion variant (<xref ref-type="bibr" rid="B49">49</xref>). The presence of EBNA3C 153 bp product points to type-A EBV in all cell lines (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>) (<xref ref-type="bibr" rid="B49">49</xref>). Western blot results revealed viral LMP1 protein expression in all four cell lines (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>), confirming viral activity. The observed size difference may be caused by genetic variations in <italic>LMP1</italic>, such as deletions and/or different numbers of tandem repeats, as previously described (<xref ref-type="bibr" rid="B50">50</xref>).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>All four cell lines are EBV positive. <bold>(A)</bold> Detection of LMP1 (top) and EBNA3C (bottom) EBV viral genes by PCR, using DNA extracted from the four lymphoblastoid (BOC) cell lines, and the originating tumor or ascites. DNA from RAJI B lymphoma and TOV21G ovarian cancer cell line were used as positive and negative controls, respectively. Lane 1- DNA mass ladder. <bold>(B)</bold> Detection of EBV LMP1 viral protein by western blotting using cell lysates, as indicated. Raji cells were included as EBV positive control. Beta actin was used as loading control. Molecular weight size markers are shown on the left.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1379175-g003.tif"/>
</fig>
</sec>
<sec id="s3_5">
<title>Spontaneously immortalized lymphoblastoid B cells are highly clonal and secrete antibodies of different isotypes</title>
<p>To check whether these spontaneously immortalized cell lines, which express CD138 plasma cell marker, are antibody-secreting, we tested the cell culture supernatant for the presence of human immunoglobulins. Two bands, corresponding to immunoglobulin heavy (IGH) and light (IGL) chains were observed in the supernatants of all samples, confirming that all four cell lines are actively secreting antibodies (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>). A single immunoglobulin light chain lambda (IGL&#x3bb;) was detected in samples BOC-36 (Ab36) and BOC-89 (Ab89), whereas sample BOC-73 (Ab73) revealed two light chain bands. Western blot using IGL-specific antibodies confirmed that BOC-73 sample was positive for both IGL &#x3ba; and &#x3bb; (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>All four cell lines secrete immunoglobulins. <bold>(A)</bold> SDS- PAGE (4-20%) detection of purified immunoglobulins (heavy and light chains), secreted in cell culture medium by the four BOC lines. First lane, molecular weight ladder. <bold>(B)</bold> Western blot of Ab36 and Ab73, using detection antibodies specific to either IGL,&#x3bb; (left) or IGL,&#x3ba; (right). Left panel, molecular weight panel. <bold>(C)</bold> Purified antibodies from each cell line were loaded onto Ig isotype detection strips. Positive results are indicated by a red line. <bold>(D)</bold> Flow cytometry of BOC-73 cells stained for IGL, &#x3ba; (y axis) and &#x3bb; (x axis). Percent single and double positive cells are shown. Gates were set using isotype control antibody for each marker. <bold>(E)</bold> Chip cytometry of BOC-73 cells stained for IGL, &#x3ba; (red) and &#x3bb; (green). Inset (lower right), magnified details of two cells, &#x3ba; and &#x3bb; positive, respectively. Scale bar, 50&#x3bc;m. <bold>(F)</bold> Flow cytometry of BOC-89 cells stained for IgG1 (x axis) and IgG3 (y axis). Percent single positive and double positive events are shown. Gates were set using isotype control antibodies for each marker. <bold>(G)</bold> Chip cytometry of BOC-89 cells showing IgG1 and IgG3 expression. Inset (lower right), magnified details of marker co-localization (yellow is the result of green and red overlap). Scale bar, 50&#x3bc;m. <bold>(H)</bold> Pie charts showing distribution of the dominant IGH sequence in each of the four cell lines, as determined by BCR ImmunoSeq (productive frequency of top sequence ranging from 93% to 99.9%, as shown, indicating high clonality). Remaining sequences (from top 20) and their productive frequencies are listed in <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table&#xa0;1</bold>
</xref>. <bold>(I)</bold> Top IGH sequence for each BOC cell line, plotted in panel <bold>(G)</bold>. <bold>(J)</bold>. ImmunoSeq results of BOC-73 cells sorted on IGL,&#x3ba; and IGL, &#x3bb; (left and right pie charts, respectively). Parental, unsorted BOC-73 cells are shown in panel <bold>(G)</bold> (arrow). The productive frequency of top, second and third sequences are plotted in orange, yellow and green respectively, and their aa formulas are included in the list below the pie charts. All other sequences (labeled &#x201c;Remainder&#x201d;) are collectively shown in dark brown. Top sequence is the same in unsorted BOC-73, and in sorted on kappa or lambda, with frequencies of 93.23%, 99.94%, 48.6% respectively. Complete list of top sequences and their productive frequencies is shown in <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table&#xa0;1</bold>
</xref>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1379175-g004.tif"/>
</fig>
<p>In line with the flow data in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1D</bold>
</xref>, the IGH in sample BOC-78 shows a single, larger band of approximately 75kDa, typical of reduced IgM (<xref ref-type="bibr" rid="B51">51</xref>) (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>). Further analyses using isotype detection strips, identified the antibody isotypes secreted by the four cell lines as being IgG1, &#x3bb; (Ab36), mixture of IgG1,&#x3ba; and IgG1,&#x3bb; (Ab73), IgM, &#x3ba; (Ab78), and a mixture of IgG1,&#x3ba; and IgG3,&#x3ba; (Ab89) (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4C</bold>
</xref>). The presence of both light chains &#x3ba; and &#x3bb; in BOC-73 cells was confirmed by flow cytometry (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4D</bold>
</xref>) and chip cytometry (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4E</bold>
</xref>), verifying that most cells are light chain &#x3ba; positive and that &#x3ba; and &#x3bb; are separately expressed. FACS analysis of BOC-89 shows prevalence of IgG3, while also showing a dual expressing, IgG1+IgG3+ population. (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4F</bold>
</xref>). The presence of double positive cells was also captured via chip cytometry (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4G</bold>
</xref>).</p>
<p>BCR sequencing of the variable region (CDR3) of the heavy chain, an approach typically used to determine clonality (<xref ref-type="bibr" rid="B52">52</xref>), revealed that all four B lymphoblastoid lines are highly clonal, with one dominant sequence showing productive frequencies of 93.6%, 93.2%, 99.9% and 98.6% in BOC-36, BOC-73, BOC-78, and BOC-89, respectively (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4H</bold>
</xref>). The top amino-acid sequence of each BCR is listed in <xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4I</bold>
</xref>, while remainder sequences and their frequencies are listed in <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table&#xa0;1</bold>
</xref>. In samples BOC-36, BOC-78, and BOC-89, except for the dominant (top listed) sequence, all others occurred with small frequencies (0.5% or less <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table&#xa0;1</bold>
</xref>), consistent with sequencing artifacts. To further address the clonality of sample BOC-73, which shows mutual expression of immunoglobulin light chain kappa (IGL&#x3ba;) and lambda (IGL&#x3bb;), we performed BCR sequencing on the original (mixed, unsorted) population as well as on cells sorted using antibodies specific to either IGL&#x3ba; or IGL&#x3bb;. The top sequence (CARGKGQSLGQTSGYKRPFDVW) was enriched from 93.2% in unsorted cells to 99.4% in cells sorted on kappa (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table&#xa0;1</bold>
</xref>), revealing that this is the IGH sequence mostly likely pairing with IGL&#x3ba;. In cells sorted on IGL&#x3bb;, two other sequences (CARGGSYHSGTGGYYKPPTFDYW and CAREFGTVAWFDPW) showed significant (100 fold) increases in productive frequency, compared to unsorted cells, suggesting that these may represent the two other clonal candidates for lambda (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4J</bold>
</xref> and <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table&#xa0;1</bold>
</xref>). Interestingly, the top sequence in cells sorted on IGL&#x3ba; (99.4% frequency) is also the top sequence in cells sorted on IGL&#x3bb;, albeit at a lower (49.6%) productive frequency (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4J</bold>
</xref> and <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table&#xa0;1</bold>
</xref>). This suggests a potential contamination during sorting on IGL&#x3bb;, with more rapidly proliferating IGL&#x3ba; positive cells. While co-expression of kappa and lambda light chain in the same cell has been reported before and remains a possibility (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4D</bold>
</xref>, half of &#x3bb; positive cells also co-express &#x3ba; by flow cytometry), co-localization by fluorescent microscopy could not be observed in these cells (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4E</bold>
</xref>, separate expression). Together, the results indicate that BOC-73 (&#x3ba;) are monoclonal while BOC-73 (&#x3bb;) may represent a bi-/oligo-clonal population.</p>
</sec>
<sec id="s3_6">
<title>Cell line BOC-36 secretes a monoclonal antibody that recognizes CCDC155</title>
<p>For a detailed analysis of the target antigen, we focused on BOC-36 and the antibody released by this cell line, (Ab36 IgG1,&#x3bb; <xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4A, B</bold>
</xref>). BCR sequencing of this cell line shows a high frequency of the top sequence (94%, <xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4H</bold>
</xref>), with the rest being distributed among &#x201c;satellite&#x201d;, likely artifactual clones, with a low production frequency (0.4% or less, <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table&#xa0;1</bold>
</xref>). Based on this, we believe BOC-36 cells are very likely monoclonal.</p>
<p>Asking if Ab36 can recognize antigens present in EOC tumor cells, we probed Ab36 purified from cell culture supernatant against cell lysates from 17 different human ovarian cancer cell lines. Western blot results show binding in 8 of the 17 human EOC lines, to a target slightly larger than 50kDa (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>). Chip cytometry imaging shows that Ab36 binds to an intracellular protein and confirms that cell lines TOV21G, UP14-TL and OVCA429 express target antigen with high, intermediate, and low expression levels, respectively, in line with Western blot data (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>). When tested against the patient&#x2019;s own tumor, the staining pattern also showed that Ab36 binds to a target with perinuclear/cytoplasmic distribution. The staining was confined to larger, EpCAM positive, epithelial tumor cells, and was negative in non-tumor cells (such as CD3 T cells, for example) (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>).</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Antibody 36 (Ab36), secreted by BOC-36 recognizes CCDC155 protein. <bold>(A)</bold>. Western blot of cell lysates from 17 different EOC cell lines (listed across), using Ab36. Left lane, MW ladder. Red arrows point to the detected protein, slightly above the 50kDa mark. <bold>(B)</bold> Chip cytometry using Ab36. Upper left panel- staining of a 4 &#x3bc;m section of formalin fixed and paraffin embedded tumor sample 19-36 T, the originating tumor sample for BOC-36, which secretes Ab36. Three antibodies- anti-EpCAM, Ab36 and anti-CD3 are shown in blue green and red, respectively. Upper right, lower left and lower right panels show single marker staining (Ab36, red) in three different EOC cell lines, TOV21G, UP14-3TL and OVCA429, respectively. Scale bar, 50&#x3bc;m. <bold>(C)</bold> Ab36 was tested for binding to more than 21,000 full-length human proteins, using the HuProt&#x2122; Array. Secondary antibody binding was quantified using fluorescence intensity measurements. Histogram shows Z score distribution and identity of the top 20 proteins, also listed in <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table&#xa0;2</bold>
</xref>. Red arrow marks CCDC155. <bold>(D)</bold> ELISA results showing intensity (optical density, OD units) of Ab36 binding to seven different recombinant proteins. Averages of two technical replicates and standard deviations are shown. <bold>(E)</bold> ELISA results using CCDC155 recombinant protein as target. Purified Ab36 and Ab73 (included as control) were used at the same concentration. Samples were run in duplicate, averages and standard deviations are shown. <bold>(F)</bold> CCDC155 was deleted in TOV21G cells, using CRISPR/Cas9 method (CCDC155 double nickase plasmid, DNP). Panel shows PCR products obtained during clone selection at increasing concentrations of selection drug (numbers listed represent puromycin concentration in ng/ml). Cells treated with control DNP were used as reference (Ctrl). <bold>(G)</bold> Western blot using Ab36 probed on cell lysates from parental (Ctrl) cells, or from cells defective in CCDC155, isolated at various concentrations of selection drugs, as described in panel <bold>(F)</bold>. <bold>(H)</bold> Western blot using Ab36 probed on cell lysate from OVCA432 cells, before and after transfection with a CCDC155 encoding plasmid. Beta actin was used as loading control.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1379175-g005.tif"/>
</fig>
<p>For target identification, we queried the purified Ab36 on the HuProt&#x2122; human proteome arrays (CDI Labs), comprising more than 21,000 proteins. Intensity of antigen-specific binding was reported using Z score histograms and protein candidates with highest scores were further interrogated. Of the top four proteins (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>), we chose to further test the coiled-coil domain containing 155 protein (CCDC155, also known as KASH5 or Nesprin-5), which has been previously reported to be a high grade serous EOC antigen (<xref ref-type="bibr" rid="B53">53</xref>) and which, unlike the other three candidates, has a molecular weight (of 62kDa) that fits the western blot predicted size (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>). Using full length CCDC155 recombinant protein as target (and 6 additional proteins, as controls) we developed an ELISA protocol that confirmed that mAb36 specifically binds to CCDC155 (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5D</bold>
</xref>). Importantly, the patient&#x2019;s serum also showed CCDC155 reactivity, suggesting a systemic humoral response in this patient (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5E</bold>
</xref>). In validation of these results, we further demonstrated that binding of Ab36 is lost in TOV21G cells in which we deleted <italic>CCDC155</italic> (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5F, G</bold>
</xref>). Additionally, western blot using cell lysate from OVC432 cells (which naturally express undetectable levels) transfected with a plasmid encoding the full length CCDC155 shows increased Ab36 binding, compared to control transfected cells (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5H</bold>
</xref>).</p>
<p>To map the binding epitope more exactly, we amplified three DNA fragments, each encoding for approximately one third of the full-length CCDC155 protein. Fragment F1 encodes for aa 1 to 204, F2 for aa 182 to 383, and F3 for aa 358 to 562, with a 22-aa overlap between F1 and F2, and a 25-aa overlap between F2 and F3 (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>, step 1). The three PCR fragments were inserted into pGEX4T-1 expression vectors (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;3</bold>
</xref>) and <italic>E coli</italic> BL21(DE3) were transformed with vectors containing F1, F2, F3 fragments, respectively. Bacterial cell lysates show Ab36 binds exclusively to F2 while the commercially available antibody (rabbit polyclonal anti-human CCDC155), included as control, binds to F1 (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>). Fragment 2 was further divided into three smaller domains (F4, F5 and F6, with small overlaps (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref> step 2) and Ab36 was found to bind to F4 (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>). This stepwise approach allowed us to narrow down the binding domain to a stretch of 32 amino-acids (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>, step 3- underlined sequence).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Epitope mapping and CCDC155 immunogenicity. <bold>(A)</bold>. Diagram of the constructs used for epitope mapping, using three steps. Step (1)- whole protein was divided into three, partially overlapping fragments- F1: aa 1 to 204, F2: aa 182 to 383, and F3: aa 358 to 562, respectively. Step (2): F2 was further divided into three partially overlapping fragments (F4, F5 and F6). Step (3): identification of the binding sequence within F4, narrowed down to the 32 amino acids (black font, underlined). <bold>(B)</bold> Western blot of bacterial lysates. <italic>E coli</italic> BL21(DE3) were transformed with vectors containing F1, F2 and F3 (panel A- Step 1, and <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;3</bold>
</xref>). Expression was induced with IPTG. Results with and without induction are shown. Cell lysates were loaded onto 4-20% SDS-PAGE gel and transferred onto a nitrocellulose membrane which was stained, in sequence with Ab36 (human IgG1), commercially available, rabbit polyclonal anti-CCDC155 and anti-GST. The membrane was stripped after the first (Ab36) and second (anti-CCDC155) stains. <bold>(C)</bold> Western blot of bacterial lysates. E coli were transformed with vectors containing F4, F5 and F6 (each spanning one third of F2, as described in panel <bold>(A)</bold>- Step 2, and <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;3</bold>
</xref>). Results shown are after IPTG induction. Top panel, staining of membrane with Ab36. Bottom panel, membrane staining with anti-GST antibody. <bold>(D)</bold> ELISA results using recurrent EOC patient sera and plates coated with full length recombinant CCDC155 protein. Serum from patient 19-36 (whose tumor constitutes the source of BOC-36) was included as positive control (red arrow). Average of duplicates and standard deviations are shown. <bold>(E)</bold> ELISA measurement of anti-CCDC155 IgG in eleven patients (PT1-PT11) with advanced stage, high grade EOC. Sera from the same patients were collected at the time of diagnosis (primary disease, P) and disease recurrence (R). Average of duplicates are shown.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1379175-g006.tif"/>
</fig>
<p>To verify the extent to which anti-CCDC155 circulating IgG antibodies are detectable in EOC patient sera, we used a cohort of 20 advanced stage EOC patients, of which 18 had recurrent disease. ELISA results show a detectable response in 9 (45%) of patients (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6D</bold>
</xref>). A pairwise comparison in an additional cohort of seven patients with advanced stage, high grade serous EOC shows similar antibody levels in primary and recurrent disease setting (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6E</bold>
</xref>), suggesting that patients are largely maintaining the upfront level of antibodies to this antigen. Together, these results further demonstrate that CCDC155 is immunogenic and antigenic in late stage, primary and recurrent EOC, and that the antigen-specific monoclonal antibody Ab36 IgG1, &#x3bb;, secreted by the spontaneously immortalized BOC-36 cells, captures this phenomenon at a single clone level.</p>
</sec>
<sec id="s3_7">
<title>Antibodies Ab73 and Ab89 recognize PDP2 and GRB2, respectively</title>
<p>To interrogate the antigenic specificity of the other three clones, we applied the same approach, probing the purified secreted antibody fraction from each cell line, on the HuProt&#x2122; human proteome arrays. The Z score distribution of Ab73, purified from BOC-73 unsorted cells, shows three potential targets with high scores: copine 1-CPNE1, pyruvate dehydrogenase phosphatase 2- PDP2, and nucleolar protein NO66 (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7A</bold>
</xref>). To further identify which of these candidates is the specific antigen, we developed an ELISA protocol using the three recombinant proteins (and four additional proteins as controls). The results showed that Ab73 (secreted by unsorted cells) specifically binds to PDP2 (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7B</bold>
</xref>). Given that the immunoglobulin fraction secreted by unsorted cells comprises two different light chains (IGL&#x3ba; and IGL&#x3bb;) (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>), we asked which light chain is responsible for binding to PDP2, using IGL&#x3ba;&#x2212; and IGL&#x3bb; - specific secondary antibodies. Interestingly, both IgG1,&#x3ba; and IgG1,&#x3bb; bind to PDP2 and the amplitude of the response was equally high, suggesting that the less abundant IgG1,&#x3bb; may have higher avidity for PDP2 than the prevalent IgG,&#x3ba; (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7C</bold>
</xref>).</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Ab73 and Ab89 target detection using protein arrays. <bold>(A)</bold> Ab73 was tested for binding to more than 21,000 full-length human proteins, using the HuProt&#x2122; Array. Secondary antibody binding was quantified using fluorescence intensity measurements. Histogram shows Z score distribution and identity of the top 20 proteins, also listed in <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table&#xa0;2</bold>
</xref>. Red arrow marks PDP2. <bold>(B)</bold> ELISA results showing intensity (optical density, OD units) of Ab73 binding to seven different recombinant proteins. Averages of two technical replicates and standard deviations are shown. <bold>(C)</bold> ELISA testing of Ab73 binding to PDPD2 recombinant protein (blue bars), or bovine serum albumin (BSA, orange bars) as control. Secondary antibodies to whole IgG, or specific to IgG, kappa or lambda are shown, from left to right, as indicated. Average of duplicate values (OD, 450nm) and standard deviations are shown. <bold>(D)</bold> Ab89 was tested on HuProt&#x2122; as described above for Ab36 and Ab73 and as detailed in Materials and Methods. Histogram shows the Z score distribution for the top 20 proteins, listed on the x axis (and in <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table&#xa0;2</bold>
</xref>). Red arrow marks GRB2. <bold>(E)</bold> ELISA results showing intensity of Ab89 binding to seven different recombinant proteins. Averages of two technical replicates and standard deviations are shown. <bold>(F)</bold> Specific binding to recombinant GRB2 protein was tested by ELISA using purified Ab89 and serum from the same patient (Serum 89). Two controls (Ab36 and Ab73) were used as reference. Anti-human IgG was used as detection antibody. Average of duplicates and standard deviations are shown. <bold>(G)</bold> Binding of Ab89 to GRB2 recombinant protein was tested by ELISA. Secondary antibodies anti-human IgG1 and anti-human IgG3 were used for isotype subclass identification. Average of duplicates and standard deviations are shown. Results from secondary antibodies alone (no primary antibody) serve as background control. <bold>(H)</bold> Z score distribution of Ab78 binding to the HuProt&#x2122; array. <bold>(I)</bold> Chip cytometry using Ab73 and Ab89. Four &#x3bc;m section of formalin-fixed and paraffin-embedded tumor samples were used for staining. Left panel - tumor sample 21-73T, the originating tumor sample for BOC-73, which secretes Ab73, was stained with Ab73, anti-EpCAM, and anti-vimentin, shown in red, green, and white, respectively. Scale bar, 50&#x3bc;m. Right panel - tumor sample 22-89T, the originating tumor sample for BOC-89, secreting Ab89, was stained with anti-CA125, Ab89, and anti-vimentin, shown in red, green, and white, respectively. Scale bar, 40&#x3bc;m.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-15-1379175-g007.tif"/>
</fig>
<p>Protein array analysis of Ab89 revealed a single candidate -growth factor receptor-bound protein 2, GRB2- as the potential antigenic target (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7D</bold>
</xref>). GRB2 is a signaling adapter protein involved in cell signaling pathways, linking receptor tyrosine kinases to MAPK pathways (<xref ref-type="bibr" rid="B54">54</xref>). ELISA testing confirmed that Ab89 specifically binds to GRB2 and not to any of the additional 7 proteins, included as non-specific controls (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7E</bold>
</xref>). As expected, only Ab89 but not Ab36 or Ab73 (used as negative controls) specifically binds to GRB2 (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7F</bold>
</xref>). The serum from the same patient (Serum 89) also shows a positive signal, suggesting a systemic response (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7F</bold>
</xref>).</p>
<p>BOC-89 is a highly clonal population, with the top BCR sequence showing a productive frequency of almost 99% (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4H</bold>
</xref>). However, two IgG subclasses were detected in BOC-89 supernatant (IgG1 and IgG3) (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>), and some cells seemed to co-express them, with IgG3 being the more abundant fraction (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4F, G</bold>
</xref>). To verify which of the two handles binding to GRB2, we used sub-class specific secondary antibodies. The ELISA results revealed that IgG1, the less abundant secreted immunoglobulin, is the one responsible for binding to GRB2, with a much weaker signal coming from IgG3 (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7G</bold>
</xref>).</p>
<p>Using a healthy donor PBMC fraction, we similarly generated a fifth B cell line (BHD-1, <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;4A, B</bold>
</xref>), which is type I EBV positive (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;4C, D</bold>
</xref>) and is antibody secreting (AbHD1, <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;4E</bold>
</xref>). ELISA testing using the purified antibody fraction showed that AbHD1 has no significant binding to CCDC155, PDP2 or GRB2 protein (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;4E</bold>
</xref>), further demonstrating the specific binding of Ab36, Ab78 and Ab89 to their cognate antigens, respectively.</p>
<p>Compared to the other three antibodies described, the Z scores for Ab78 are much lower, and the score distribution shows no clear candidate (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7H</bold>
</xref>), raising the possibility that this antibody (of IgM isotype- <xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>), might actually bind to non-peptide epitopes, such as glycans (<xref ref-type="bibr" rid="B55">55</xref>).</p>
<p>As with Ab36 (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>), Ab73 and Ab89 also recognize their respective tumor samples (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7I</bold>
</xref>). Importantly, their target antigens seem to be expressed by the epithelial tumor cells, highlighted by either EpCAM or CA125 epithelial cell markers, and not by the vimentin-expressing tumor stroma. Together, these results provide a platform for antigenic target identification using tumor-isolated B cells and protein arrays, and reveal CCDC155, PDP2 and GRB2 as the tumor-expressed target antigens recognized by Ab36, Ab73 and Ab89, respectively.</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<p>We report here the establishment of 4 novel antibody-secreting B lymphoblastoid cell lines, following spontaneous immortalization of B cells isolated from the tumor microenvironment (tumor tissue or ascites) of high grade serous EOC. The immortalized cells are EBV positive, demonstrating that after the natural viral infection, most likely occurring early in the life of the patient, the latently infected B cells can migrate to the TME. All cells are uniformly positive for the immune memory marker CD27 (<xref ref-type="bibr" rid="B56">56</xref>), consistent with EBV latency in the memory B cell compartment. These highly clonal, stably maintained cell lines produce antibodies of either IgG or IgM isotypes. One of the secreted antibodies (Ab36) targets CCDC155, previously reported to be a EOC antigen (<xref ref-type="bibr" rid="B53">53</xref>), while two others (Ab73 and Ab89) recognize PDP2 and GRB2, respectively, both with previously unreported antigenic properties in EOC. The repertoire of B cells that infiltrate solid tumor remains largely unexplored (<xref ref-type="bibr" rid="B33">33</xref>); the cell lines reported here provide direct evidence of tumor-derived B lymphocyte cell lines that secrete antibodies specific for tumor-expressed targets, and further reinforce the concept that B-TILs, when present, are educated toward tumor-associated antigens (<xref ref-type="bibr" rid="B16">16</xref>).</p>
<p>Despite the widely studied associations with cancer pathogenesis, there is a paucity of reports describing the presence of EBV in B TILs, with only scarce evidence showing the presence of EBV-encoded small RNA -positive lymphocytes in gastric adenocarcinoma (<xref ref-type="bibr" rid="B57">57</xref>) and a small subset of seminomas (<xref ref-type="bibr" rid="B58">58</xref>). To our knowledge, there have been no studies reporting on the EBV status of tumor- or ascites-resident B cells in EOC, a non-EBV related solid tumor type. Our studies demonstrate that oncogenic viral latency could be further exploited for either mechanistic studies on B cell/plasma cell biology following spontaneous immortalization, or for new antigenic target discovery.</p>
<p>While we show the presence of viral EBV proteins after ex vivo culture of B TILs (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>), correctly assessing EBV activity inside these cells <italic>in vivo</italic> remains challenging, due to their expected low frequency in the immune TME. It is likely that EBV latency is maintained in B TILs <italic>in vivo</italic>; however, should EBV reactivation occur, this may have potentially important consequences for the antigenic repertoire of the immune TME and the ensuing anti-tumor immune response. Although the exact circumstances are yet to be completely elucidated, it has been shown that EBV reactivation <italic>in vivo</italic> can be experimentally triggered by factors commonly found in the TME, such as TGF&#x3b2; and hypoxia (<xref ref-type="bibr" rid="B59">59</xref>, <xref ref-type="bibr" rid="B60">60</xref>). Additionally, patients&#x2019; psychological stress (<xref ref-type="bibr" rid="B61">61</xref>, <xref ref-type="bibr" rid="B62">62</xref>) or exposure to certain chemotherapeutics, including cisplatin, commonly used as treatment of EOC, could also cause initiation of viral replication (<xref ref-type="bibr" rid="B63">63</xref>, <xref ref-type="bibr" rid="B64">64</xref>).</p>
<p>The quality and quantity of B TILs, and their potential to produce viral antigens should also be considered in the context of lymphocyte/myeloid aggregates and TLS formation. Unlike CD4 and CD8 T cells, which can follow various tumor infiltrating profiles, B TILs are rarely found on their own. Most often, B TILs are found in the proximity of T lymphocytes and other immune cells, contributing to an inflamed, or immunologically &#x2018;hot&#x2019; tumor phenotype (<xref ref-type="bibr" rid="B11">11</xref>, <xref ref-type="bibr" rid="B17">17</xref>, <xref ref-type="bibr" rid="B46">46</xref>, <xref ref-type="bibr" rid="B47">47</xref>). While the exact spatial location of the isolated EBV+ B cells described here could not be ascertained, all tumor samples were positive for T and B lymphoid aggregates (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). These highly dense lymphocytic infiltrates are engaged in priming and sustaining adaptive immune responses and are often considered to be precursors to TLS. Progression from aggregates to TLS requires stromal rearrangement, presence of certain cytokines or factors such as high antigen load (<xref ref-type="bibr" rid="B6">6</xref>, <xref ref-type="bibr" rid="B65">65</xref>). Considering our results, new questions arise on how EBV viral latency and potential viral reactivation in B TILs might contribute to B cell functionality, including viral antigen processing and presentation within the tumor-resident lymphocyte neighborhoods. The hypothesis that immune cell-carrying viral antigens could shape the maturation status of lymphoid aggregates, their stromal rearrangements and potential progression into TLS (<xref ref-type="bibr" rid="B66">66</xref>), and consequences on the emerging immune repertoire, is testable and warrants future studies.</p>
<p>Through detailed molecular characterization, we report that Ab36 (IgG1,&#x3bb;), secreted by monoclonal BOC-36 cells, recognizes CCDC155 (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref>), a dynein binding protein with roles in connecting the nuclear envelope with the actin cytoskeleton. As part of the nesprin family, CCDC155 is a component of the LINC (LInker of Nucleoskeleton and Cytoskeleton) complex, with important roles in nuclear movement and positioning during telomere attachment to the nuclear envelope in the prophase of meiosis in spermatocytes and oocytes. Outside of a few studies pointing to its roles in male and female gametogenesis (<xref ref-type="bibr" rid="B67">67</xref>, <xref ref-type="bibr" rid="B68">68</xref>), CCDC155 biology has been little studied. However, some of the published evidence shows that disruption of the LINC complex triggers defects in cell stability, mobility, and mechano-transduction, all of which could serve as driving forces in tumorigenesis and metastasis (<xref ref-type="bibr" rid="B69">69</xref>&#x2013;<xref ref-type="bibr" rid="B74">74</xref>). As part of the nuclear envelope, nesprins bind to lamin A/C, which has been shown to have increased expression in EOC (<xref ref-type="bibr" rid="B75">75</xref>). Further studies are needed to identify changes in expression levels and elucidate the inflammatory context in which nesprins (including CCDC155/nesprin5) might become immunogenic. Although no studies have evaluated CCDC155 functionality in ovarian cancer, Wilson et&#xa0;al. reported that circulating anti-CCDC155 IgG levels were significantly elevated in patients with early-stage ovarian cancer compared with healthy controls (<xref ref-type="bibr" rid="B53">53</xref>). By finding a tumor-resident B lymphoblastoid cell line with CCDC155 specificity, and by revealing antibodies in almost half of a small cohort of patients (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>), our results confirm CCDC155 is a tumor-associated antigen in EOC and point to its continued antigenicity into late-stage, primary and recurrent disease.</p>
<p>We also report that Ab89, secreted by BOC-89 recognizes GRB2 (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>), a key adaptor protein that plays a central role in signaling downstream of receptor tyrosine kinases. Signaling via this pathway, which is often dysregulated in EOC, due to ErbB2 and EGFR overexpression or amplification (<xref ref-type="bibr" rid="B76">76</xref>), leads to RAS/RAF/mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3-kinase (PI3K)/AKT/mTOR signaling, critically important in tumorigenesis (<xref ref-type="bibr" rid="B54">54</xref>, <xref ref-type="bibr" rid="B77">77</xref>). The high prevalence of alterations in these pathways, which are activated in 70% of EOC patients, represents an important therapeutic opportunity. Using liposomal antisense oligodeoxynucleotide, Lara et&#xa0;al. demonstrated that blocking GRB2 expression has therapeutic efficacy in preclinical models of ovarian and uterine cancer (<xref ref-type="bibr" rid="B78">78</xref>).</p>
<p>Importantly, we also note that BOC-89 cells seem to co-express IgG1 and IgG3 (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>). Challenging the &#x201c;one B cell-one antibody&#x201d; rule, single cell sequencing studies have shown that, although most B cells display single V(D)J recombination, two or more V<sub>H</sub>DJ<sub>H</sub> or V<sub>L</sub>J<sub>L</sub> recombination patterns can be observed in a single B cell (<xref ref-type="bibr" rid="B79">79</xref>). As such, the BOC-89 cell line could offer a versatile tool for gaining insight into multiple Ig expressing, single cell biology.</p>
<p>To date, no studies have reported on spontaneous antibodies to GRB2 in cancer patients. Overexpression of GRB2 can also occur in inflammatory lesions and preneoplastic foci (<xref ref-type="bibr" rid="B80">80</xref>), although the exact circumstances have yet to be explored. Similarly, PDP2 reported here as being recognized by Ab73 (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>), is an enzymatic modulator of the mitochondrial gatekeeper pyruvate dehydrogenase, with roles in early malignant transformation and a novel therapeutic target (<xref ref-type="bibr" rid="B4">4</xref>, <xref ref-type="bibr" rid="B81">81</xref>). There are no reports on PDP2 in ovarian cancer, and the scarce evidence on its roles in controlling metabolism is coming from a limited number of studies, mainly in prostate and lung cancer (<xref ref-type="bibr" rid="B82">82</xref>, <xref ref-type="bibr" rid="B83">83</xref>).</p>
<p>Having identified these three self-proteins (CCDC155, GRB2 and PDP2) as antibody targets, our results suggest that, in the right inflammatory context, a break in tolerance occurred. Given the presence of EBV genes in the antibody secreting B cells, one can speculate that this occurred early in life, and that these three proteins could be disease-associated (and later tumor-associated) antigens (<xref ref-type="bibr" rid="B84">84</xref>, <xref ref-type="bibr" rid="B85">85</xref>).</p>
<p>Most of the antigens that trigger humoral immunity in cancer patients are intracellular (<xref ref-type="bibr" rid="B86">86</xref>, <xref ref-type="bibr" rid="B87">87</xref>). Our findings are in line with this, as CCDC155, GRB2 and PDP2 are all intracellular proteins. Unlike the well-defined immune processes (such as antibody-dependent cellular cytotoxicity-ADCC, and antibody-dependent cellular phagocytosis- ADCP), triggered by antibodies targeting cell surface antigens, the mechanisms by which antibodies to intracellular targets could mediate anti-tumor responses are yet to be fully explored. Evidence shows that antibodies can be internalized by the tumor cells through AP2, important for clathrin-mediated endocytosis (<xref ref-type="bibr" rid="B88">88</xref>), and once inside the tumor cell, they can bind to the target via Fab, and to TRIM21 via the Fc receptor (<xref ref-type="bibr" rid="B89">89</xref>). Given that TRIM21 is a mediator of ubiquitination which leads to target breakdown (<xref ref-type="bibr" rid="B90">90</xref>), the AP2-TRIM21 pathway thereby provides a venue for the intracellular space to be pursued for therapy by antibodies that engage intracellular targets. However, engaging potentially shared antigens in the TME might also heighten the risk of autoimmunity. This possibility is evidenced by the occurrence of paraneoplastic syndromes and immune-related adverse events (irAEs) in patients treated with immune checkpoint inhibitors, where the immune response against the tumor also targets normal tissues (<xref ref-type="bibr" rid="B87">87</xref>, <xref ref-type="bibr" rid="B91">91</xref>). The impact of EBV presence in B TILs and its potential reactivation during cancer standard care treatments on these occurrences remains unexplored.</p>
<p>In summary, we reported here that within the TIL population in EOC resides a low frequency population of antibody-secreting B cells that have been naturally exposed to EBV and described a platform for their spontaneous immortalization into highly clonal, B lymphoblastoid cell lines. Once stably maintained, these novel cell lines offer unique opportunities for future studies on B TIL biology and new target antigen recognition, and for studies on EBV latency and/or viral reactivation in the TME of non-EBV solid tumors such as the EOC.</p>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Material</bold>
</xref>. Further inquiries can be directed to the corresponding authors.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The studies involving humans were approved by The Institutional Review Board (IRB) of the University of Pittsburgh. The studies were conducted in accordance with the local legislation and institutional requirements, and written informed consent for participation was obtained.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>LZ: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Resources, Supervision, Validation, Visualization, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing. MS: Data curation, Formal analysis, Investigation, Methodology, Project administration, Resources, Validation, Visualization, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing. EE: Formal analysis, Investigation, Methodology, Validation, Visualization, Writing &#x2013; review &amp; editing. SZ: Data curation, Investigation, Methodology, Visualization, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing. FM: Data curation, Project administration, Resources, Validation, Visualization, Writing &#x2013; review &amp; editing. MR: Data curation, Formal analysis, Methodology, Validation, Visualization, Writing &#x2013; review &amp; editing. RE: Funding acquisition, Investigation, Project administration, Resources, Supervision, Validation, Visualization, Writing &#x2013; review &amp; editing. OF: Investigation, Methodology, Supervision, Validation, Visualization, Writing &#x2013; review &amp; editing. AV: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Supervision, Validation, Visualization, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing.</p>
</sec>
</body>
<back>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare financial support was received for the research, authorship, and/or publication of this article. This work was supported by research funds from the University of Pittsburgh School of Medicine, Department of Obstetrics, Gynecology and Reproductive Sciences.</p>
</sec>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s11" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fimmu.2024.1379175/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fimmu.2024.1379175/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet_1.pdf" id="SM1" mimetype="application/pdf"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<collab>Organization WH</collab>
</person-group>. <article-title>International Agency for Research on Cancer Global Cancer Observatory&#x2014;Cancer Tomorrow. Estimated number of new cases from 2020 to 2040, both sexes, age [0-85+]</article-title>. (<year>2020</year>).</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>McCluggage</surname> <given-names>WG</given-names>
</name>
</person-group>. <article-title>Morphological subtypes of ovarian carcinoma: a review with emphasis on new developments and pathogenesis</article-title>. <source>Pathology</source>. (<year>2011</year>) <volume>43</volume>:<page-range>420&#x2013;32</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1097/PAT.0b013e328348a6e7</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Komdeur</surname> <given-names>FL</given-names>
</name>
<name>
<surname>Wouters</surname> <given-names>MC</given-names>
</name>
<name>
<surname>Workel</surname> <given-names>HH</given-names>
</name>
<name>
<surname>Tijans</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Terwindt</surname> <given-names>AL</given-names>
</name>
<name>
<surname>Brunekreeft</surname> <given-names>KL</given-names>
</name>
<etal/>
</person-group>. <article-title>CD103+ intraepithelial T cells in high-grade serous ovarian cancer are phenotypically diverse TCRalphabeta+ CD8alphabeta+ T cells that can be targeted for cancer immunotherapy</article-title>. <source>Oncotarget</source>. (<year>2016</year>) <volume>7</volume>:<page-range>75130&#x2013;44</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.18632/oncotarget.v7i46</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sato</surname> <given-names>E</given-names>
</name>
<name>
<surname>Olson</surname> <given-names>SH</given-names>
</name>
<name>
<surname>Ahn</surname> <given-names>J</given-names>
</name>
<name>
<surname>Bundy</surname> <given-names>B</given-names>
</name>
<name>
<surname>Nishikawa</surname> <given-names>H</given-names>
</name>
<name>
<surname>Qian</surname> <given-names>F</given-names>
</name>
<etal/>
</person-group>. <article-title>Intraepithelial CD8+ tumor-infiltrating lymphocytes and a high CD8+/regulatory T cell ratio are associated with favorable prognosis in ovarian cancer</article-title>. <source>Proc Natl Acad Sci U S A</source>. (<year>2005</year>) <volume>102</volume>:<page-range>18538&#x2013;43</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.0509182102</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Webb</surname> <given-names>JR</given-names>
</name>
<name>
<surname>Milne</surname> <given-names>K</given-names>
</name>
<name>
<surname>Watson</surname> <given-names>P</given-names>
</name>
<name>
<surname>Deleeuw</surname> <given-names>RJ</given-names>
</name>
<name>
<surname>Nelson</surname> <given-names>BH</given-names>
</name>
</person-group>. <article-title>Tumor-infiltrating lymphocytes expressing the tissue resident memory marker CD103 are associated with increased survival in high-grade serous ovarian cancer</article-title>. <source>Clin Cancer Res</source>. (<year>2014</year>) <volume>20</volume>:<page-range>434&#x2013;44</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/1078-0432.CCR-13-1877</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hartnett</surname> <given-names>EG</given-names>
</name>
<name>
<surname>Knight</surname> <given-names>J</given-names>
</name>
<name>
<surname>Radolec</surname> <given-names>M</given-names>
</name>
<name>
<surname>Buckanovich</surname> <given-names>RJ</given-names>
</name>
<name>
<surname>Edwards</surname> <given-names>RP</given-names>
</name>
<name>
<surname>Vlad</surname> <given-names>AM</given-names>
</name>
</person-group>. <article-title>Immunotherapy advances for epithelial ovarian cancer</article-title>. <source>Cancers (Basel)</source>. (<year>2020</year>) <volume>12</volume>:<page-range>1&#x2013;27</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/cancers12123733</pub-id>
</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Porter</surname> <given-names>R</given-names>
</name>
<name>
<surname>Matulonis</surname> <given-names>UA</given-names>
</name>
</person-group>. <article-title>Immunotherapy for ovarian cancer</article-title>. <source>Clin Adv Hematol Oncol</source>. (<year>2022</year>) <volume>20</volume>:<page-range>240&#x2013;53</page-range>.</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Damei</surname> <given-names>I</given-names>
</name>
<name>
<surname>Trickovic</surname> <given-names>T</given-names>
</name>
<name>
<surname>Mami-Chouaib</surname> <given-names>F</given-names>
</name>
<name>
<surname>Corgnac</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Tumor-resident memory T cells as a biomarker of the response to cancer immunotherapy</article-title>. <source>Front Immunol</source>. (<year>2023</year>) <volume>14</volume>:<elocation-id>1205984</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2023.1205984</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hornburg</surname> <given-names>M</given-names>
</name>
<name>
<surname>Desbois</surname> <given-names>M</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Guan</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Lo</surname> <given-names>AA</given-names>
</name>
<name>
<surname>Kaufman</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Single-cell dissection of cellular components and interactions shaping the tumor immune phenotypes in ovarian cancer</article-title>. <source>Cancer Cell</source>. (<year>2021</year>) <volume>39</volume>:<fpage>928</fpage>&#x2013;<lpage>44 e6</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ccell.2021.04.004</pub-id>
</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Olalekan</surname> <given-names>S</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>B</given-names>
</name>
<name>
<surname>Back</surname> <given-names>R</given-names>
</name>
<name>
<surname>Eckart</surname> <given-names>H</given-names>
</name>
<name>
<surname>Basu</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>Characterizing the tumor microenvironment of metastatic ovarian cancer by single-cell transcriptomics</article-title>. <source>Cell Rep</source>. (<year>2021</year>) <volume>35</volume>:<fpage>109165</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.celrep.2021.109165</pub-id>
</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kroeger</surname> <given-names>DR</given-names>
</name>
<name>
<surname>Milne</surname> <given-names>K</given-names>
</name>
<name>
<surname>Nelson</surname> <given-names>BH</given-names>
</name>
</person-group>. <article-title>Tumor-infiltrating plasma cells are associated with tertiary lymphoid structures, cytolytic T-cell responses, and superior prognosis in ovarian cancer</article-title>. <source>Clin Cancer Res</source>. (<year>2016</year>) <volume>22</volume>:<page-range>3005&#x2013;15</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/1078-0432.CCR-15-2762</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ukita</surname> <given-names>M</given-names>
</name>
<name>
<surname>Hamanishi</surname> <given-names>J</given-names>
</name>
<name>
<surname>Yoshitomi</surname> <given-names>H</given-names>
</name>
<name>
<surname>Yamanoi</surname> <given-names>K</given-names>
</name>
<name>
<surname>Takamatsu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Ueda</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>CXCL13-producing CD4+ T cells accumulate in the early phase of tertiary lymphoid structures in ovarian cancer</article-title>. <source>JCI Insight</source>. (<year>2022</year>) <volume>7</volume>:<page-range>1&#x2013;15</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1172/jci.insight.157215</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>K</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>X</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>LH</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>SQ</given-names>
</name>
</person-group>. <article-title>Tertiary lymphoid structures are associated with a favorable prognosis in high-grade serous ovarian cancer patients</article-title>. <source>Reprod Sci</source>. (<year>2023</year>) <volume>30</volume>:<page-range>2468&#x2013;80</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s43032-023-01188-x</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>C</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>The role of tertiary lymphoid structure and B cells in nasopharyngeal carcinoma: Based on bioinformatics and experimental verification</article-title>. <source>Transl Oncol</source>. (<year>2024</year>) <volume>41</volume>:<fpage>101885</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.tranon.2024.101885</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rivera</surname> <given-names>A</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>CC</given-names>
</name>
<name>
<surname>Ron</surname> <given-names>N</given-names>
</name>
<name>
<surname>Dougherty</surname> <given-names>JP</given-names>
</name>
<name>
<surname>Ron</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Role of B cells as antigen-presenting cells <italic>in vivo</italic> revisited: antigen-specific B cells are essential for T cell expansion in lymph nodes and for systemic T cell responses to low antigen concentrations</article-title>. <source>Int Immunol</source>. (<year>2001</year>) <volume>13</volume>:<page-range>1583&#x2013;93</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/intimm/13.12.1583</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fridman</surname> <given-names>WH</given-names>
</name>
<name>
<surname>Meylan</surname> <given-names>M</given-names>
</name>
<name>
<surname>Pupier</surname> <given-names>G</given-names>
</name>
<name>
<surname>Calvez</surname> <given-names>A</given-names>
</name>
<name>
<surname>Hernandez</surname> <given-names>I</given-names>
</name>
<name>
<surname>Sautes-Fridman</surname> <given-names>C</given-names>
</name>
</person-group>. <article-title>Tertiary lymphoid structures and B cells: An intratumoral immunity cycle</article-title>. <source>Immunity</source>. (<year>2023</year>) <volume>56</volume>:<page-range>2254&#x2013;69</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.immuni.2023.08.009</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Montfort</surname> <given-names>A</given-names>
</name>
<name>
<surname>Pearce</surname> <given-names>O</given-names>
</name>
<name>
<surname>Maniati</surname> <given-names>E</given-names>
</name>
<name>
<surname>Vincent</surname> <given-names>BG</given-names>
</name>
<name>
<surname>Bixby</surname> <given-names>L</given-names>
</name>
<name>
<surname>Bohm</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>A strong B-cell response is part of the immune landscape in human high-grade serous ovarian metastases</article-title>. <source>Clin Cancer Res</source>. (<year>2017</year>) <volume>23</volume>:<page-range>250&#x2013;62</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/1078-0432.CCR-16-0081</pub-id>
</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>W</given-names>
</name>
<name>
<surname>Zhong</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhuang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>J</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>C</given-names>
</name>
<etal/>
</person-group>. <article-title>Multiregion single-cell sequencing reveals the transcriptional landscape of the immune microenvironment of colorectal cancer</article-title>. <source>Clin Transl Med</source>. (<year>2021</year>) <volume>11</volume>:<elocation-id>e253</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/ctm2.253</pub-id>
</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Michaud</surname> <given-names>D</given-names>
</name>
<name>
<surname>Steward</surname> <given-names>CR</given-names>
</name>
<name>
<surname>Mirlekar</surname> <given-names>B</given-names>
</name>
<name>
<surname>Pylayeva-Gupta</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Regulatory B cells in cancer</article-title>. <source>Immunol Rev</source>. (<year>2021</year>) <volume>299</volume>:<fpage>74</fpage>&#x2013;<lpage>92</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/imr.12939</pub-id>
</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ishigami</surname> <given-names>E</given-names>
</name>
<name>
<surname>Sakakibara</surname> <given-names>M</given-names>
</name>
<name>
<surname>Sakakibara</surname> <given-names>J</given-names>
</name>
<name>
<surname>Masuda</surname> <given-names>T</given-names>
</name>
<name>
<surname>Fujimoto</surname> <given-names>H</given-names>
</name>
<name>
<surname>Hayama</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Coexistence of regulatory B cells and regulatory T cells in tumor-infiltrating lymphocyte aggregates is a prognostic factor in patients with breast cancer</article-title>. <source>Breast Cancer</source>. (<year>2019</year>) <volume>26</volume>:<page-range>180&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s12282-018-0910-4</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mirlekar</surname> <given-names>B</given-names>
</name>
<name>
<surname>Michaud</surname> <given-names>D</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>SJ</given-names>
</name>
<name>
<surname>Kren</surname> <given-names>NP</given-names>
</name>
<name>
<surname>Harris</surname> <given-names>C</given-names>
</name>
<name>
<surname>Greene</surname> <given-names>K</given-names>
</name>
<etal/>
</person-group>. <article-title>B cell-derived IL35 drives STAT3-dependent CD8(+) T-cell exclusion in pancreatic cancer</article-title>. <source>Cancer Immunol Res</source>. (<year>2020</year>) <volume>8</volume>:<fpage>292</fpage>&#x2013;<lpage>308</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/2326-6066.CIR-19-0349</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hatton</surname> <given-names>OL</given-names>
</name>
<name>
<surname>Harris-Arnold</surname> <given-names>A</given-names>
</name>
<name>
<surname>Schaffert</surname> <given-names>S</given-names>
</name>
<name>
<surname>Krams</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Martinez</surname> <given-names>OM</given-names>
</name>
</person-group>. <article-title>The interplay between Epstein-Barr virus and B lymphocytes: implications for infection, immunity, and disease</article-title>. <source>Immunol Res</source>. (<year>2014</year>) <volume>58</volume>:<page-range>268&#x2013;76</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s12026-014-8496-1</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shannon-Lowe</surname> <given-names>C</given-names>
</name>
<name>
<surname>Rowe</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Epstein-Barr virus infection of polarized epithelial cells via the basolateral surface by memory B cell-mediated transfer infection</article-title>. <source>PloS Pathog</source>. (<year>2011</year>) <volume>7</volume>:<elocation-id>e1001338</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.ppat.1001338</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Houen</surname> <given-names>G</given-names>
</name>
<name>
<surname>Trier</surname> <given-names>NH</given-names>
</name>
</person-group>. <article-title>Epstein-barr virus and systemic autoimmune diseases</article-title>. <source>Front Immunol</source>. (<year>2020</year>) <volume>11</volume>:<elocation-id>587380</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2020.587380</pub-id>
</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kurth</surname> <given-names>J</given-names>
</name>
<name>
<surname>Spieker</surname> <given-names>T</given-names>
</name>
<name>
<surname>Wustrow</surname> <given-names>J</given-names>
</name>
<name>
<surname>Strickler</surname> <given-names>GJ</given-names>
</name>
<name>
<surname>Hansmann</surname> <given-names>LM</given-names>
</name>
<name>
<surname>Rajewsky</surname> <given-names>K</given-names>
</name>
<etal/>
</person-group>. <article-title>EBV-infected B cells in infectious mononucleosis: viral strategies for spreading in the B cell compartment and establishing latency</article-title>. <source>Immunity</source>. (<year>2000</year>) <volume>13</volume>:<page-range>485&#x2013;95</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S1074-7613(00)00048-0</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Epstein</surname> <given-names>MA</given-names>
</name>
<name>
<surname>Achong</surname> <given-names>BG</given-names>
</name>
<name>
<surname>Barr</surname> <given-names>YM</given-names>
</name>
</person-group>. <article-title>Virus particles in cultured lymphoblasts from burkitt&#x2019;s lymphoma</article-title>. <source>Lancet</source>. (<year>1964</year>) <volume>1</volume>:<page-range>702&#x2013;3</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0140-6736(64)91524-7</pub-id>
</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Young</surname> <given-names>LS</given-names>
</name>
<name>
<surname>Yap</surname> <given-names>LF</given-names>
</name>
<name>
<surname>Murray</surname> <given-names>PG</given-names>
</name>
</person-group>. <article-title>Epstein-Barr virus: more than 50 years old and still providing surprises</article-title>. <source>Nat Rev Cancer</source>. (<year>2016</year>) <volume>16</volume>:<fpage>789</fpage>&#x2013;<lpage>802</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nrc.2016.92</pub-id>
</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chai</surname> <given-names>AWY</given-names>
</name>
<name>
<surname>Yee</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>HM</given-names>
</name>
<name>
<surname>Abdul Aziz</surname> <given-names>N</given-names>
</name>
<name>
<surname>Yee</surname> <given-names>PS</given-names>
</name>
<name>
<surname>Marzuki</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Establishment and characterization of an Epstein-Barr virus-positive cell line from a non-keratinizing differentiated primary nasopharyngeal carcinoma</article-title>. <source>Cancer Res Commun</source>. (<year>2024</year>) <volume>4</volume>(<issue>3</issue>): <page-range>645&#x2013;59</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/2767-9764.25338662.v1</pub-id>
</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nilsson</surname> <given-names>K</given-names>
</name>
</person-group>. <article-title>Human B-lymphoid cell lines</article-title>. <source>Hum Cell</source>. (<year>1992</year>) <volume>5</volume>:<fpage>25</fpage>&#x2013;<lpage>41</lpage>.</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>SoRelle</surname> <given-names>ED</given-names>
</name>
<name>
<surname>Reinoso-Vizcaino</surname> <given-names>NM</given-names>
</name>
<name>
<surname>Horn</surname> <given-names>GQ</given-names>
</name>
<name>
<surname>Luftig</surname> <given-names>MA</given-names>
</name>
</person-group>. <article-title>Epstein-Barr virus perpetuates B cell germinal center dynamics and generation of autoimmune-associated phenotypes <italic>in vitro</italic>
</article-title>. <source>Front Immunol</source>. (<year>2022</year>) <volume>13</volume>:<elocation-id>1001145</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2022.1001145</pub-id>
</citation>
</ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Watson</surname> <given-names>DB</given-names>
</name>
<name>
<surname>Burns</surname> <given-names>GF</given-names>
</name>
<name>
<surname>Mackay</surname> <given-names>IR</given-names>
</name>
</person-group>. <article-title>
<italic>In vitro</italic> growth of B lymphocytes infiltrating human melanoma tissue by transformation with EBV: evidence for secretion of anti-melanoma antibodies by some transformed cells</article-title>. <source>J Immunol</source>. (<year>1983</year>) <volume>130</volume>:<page-range>2442&#x2013;7</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.4049/jimmunol.130.5.2442</pub-id>
</citation>
</ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Biswas</surname> <given-names>S</given-names>
</name>
<name>
<surname>Mandal</surname> <given-names>G</given-names>
</name>
<name>
<surname>Payne</surname> <given-names>KK</given-names>
</name>
<name>
<surname>Anadon</surname> <given-names>CM</given-names>
</name>
<name>
<surname>Gatenbee</surname> <given-names>CD</given-names>
</name>
<name>
<surname>Chaurio</surname> <given-names>RA</given-names>
</name>
<etal/>
</person-group>. <article-title>IgA transcytosis and antigen recognition govern ovarian cancer immunity</article-title>. <source>Nature</source>. (<year>2021</year>) <volume>591</volume>:<page-range>464&#x2013;70</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41586-020-03144-0</pub-id>
</citation>
</ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Handley</surname> <given-names>KF</given-names>
</name>
<name>
<surname>Mehta</surname> <given-names>S</given-names>
</name>
<name>
<surname>Martin</surname> <given-names>AL</given-names>
</name>
<name>
<surname>Biswas</surname> <given-names>S</given-names>
</name>
<name>
<surname>Maharaj</surname> <given-names>K</given-names>
</name>
<name>
<surname>Nagy</surname> <given-names>MZ</given-names>
</name>
<etal/>
</person-group>. <article-title>Actionable spontaneous antibody responses antagonize Malignant progression in ovarian carcinoma</article-title>. <source>Gynecol Oncol</source>. (<year>2023</year>) <volume>173</volume>:<page-range>114&#x2013;21</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ygyno.2023.03.020</pub-id>
</citation>
</ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ansari</surname> <given-names>A</given-names>
</name>
<name>
<surname>Sachan</surname> <given-names>S</given-names>
</name>
<name>
<surname>Jit</surname> <given-names>BP</given-names>
</name>
<name>
<surname>Sharma</surname> <given-names>A</given-names>
</name>
<name>
<surname>Coshic</surname> <given-names>P</given-names>
</name>
<name>
<surname>Sette</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>An efficient immunoassay for the B cell help function of SARS-CoV-2-specific memory CD4(+) T cells</article-title>. <source>Cell Rep Methods</source>. (<year>2022</year>) <volume>2</volume>:<fpage>100224</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.crmeth.2022.100224</pub-id>
</citation>
</ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Steinbuch</surname> <given-names>M</given-names>
</name>
<name>
<surname>Audran</surname> <given-names>R</given-names>
</name>
</person-group>. <article-title>The isolation of IgG from mammalian sera with the aid of caprylic acid</article-title>. <source>Arch Biochem Biophys</source>. (<year>1969</year>) <volume>134</volume>:<page-range>279&#x2013;84</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/0003-9861(69)90285-9</pub-id>
</citation>
</ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Neoh</surname> <given-names>SH</given-names>
</name>
<name>
<surname>Gordon</surname> <given-names>C</given-names>
</name>
<name>
<surname>Potter</surname> <given-names>A</given-names>
</name>
<name>
<surname>Zola</surname> <given-names>H</given-names>
</name>
</person-group>. <article-title>The purification of mouse monoclonal antibodies from ascitic fluid</article-title>. <source>J Immunol Methods</source>. (<year>1986</year>) <volume>91</volume>:<page-range>231&#x2013;5</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/0022-1759(86)90483-7</pub-id>
</citation>
</ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jeon</surname> <given-names>YK</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>BY</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>JE</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>SS</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>CW</given-names>
</name>
</person-group>. <article-title>Molecular characterization of Epstein-Barr virus and oncoprotein expression in nasopharyngeal carcinoma in Korea</article-title>. <source>Head Neck</source>. (<year>2004</year>) <volume>26</volume>:<page-range>573&#x2013;83</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/hed.10370</pub-id>
</citation>
</ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sample</surname> <given-names>J</given-names>
</name>
<name>
<surname>Young</surname> <given-names>L</given-names>
</name>
<name>
<surname>Martin</surname> <given-names>B</given-names>
</name>
<name>
<surname>Chatman</surname> <given-names>T</given-names>
</name>
<name>
<surname>Kieff</surname> <given-names>E</given-names>
</name>
<name>
<surname>Rickinson</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>Epstein-Barr virus types 1 and 2 differ in their EBNA-3A, EBNA-3B, and EBNA-3C genes</article-title>. <source>J Virol</source>. (<year>1990</year>) <volume>64</volume>:<page-range>4084&#x2013;92</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/jvi.64.9.4084-4092.1990</pub-id>
</citation>
</ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Onishi</surname> <given-names>A</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Profiling the human protein-DNA interactome reveals ERK2 as a transcriptional repressor of interferon signaling</article-title>. <source>Cell</source>. (<year>2009</year>) <volume>139</volume>:<page-range>610&#x2013;22</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cell.2009.08.037</pub-id>
</citation>
</ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jeong</surname> <given-names>JS</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Albino</surname> <given-names>E</given-names>
</name>
<name>
<surname>Marrero</surname> <given-names>J</given-names>
</name>
<name>
<surname>Rho</surname> <given-names>HS</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Rapid identification of monospecific monoclonal antibodies using a human proteome microarray</article-title>. <source>Mol Cell Proteomics</source>. (<year>2012</year>) <volume>11</volume>:<fpage>O111 016253</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1074/mcp.O111.016253</pub-id>
</citation>
</ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Venkataraman</surname> <given-names>A</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>K</given-names>
</name>
<name>
<surname>Irizarry</surname> <given-names>J</given-names>
</name>
<name>
<surname>Mackiewicz</surname> <given-names>M</given-names>
</name>
<name>
<surname>Mita</surname> <given-names>P</given-names>
</name>
<name>
<surname>Kuang</surname> <given-names>Z</given-names>
</name>
<etal/>
</person-group>. <article-title>A toolbox of immunoprecipitation-grade monoclonal antibodies to human transcription factors</article-title>. <source>Nat Methods</source>. (<year>2018</year>) <volume>15</volume>:<page-range>330&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nmeth.4632</pub-id>
</citation>
</ref>
<ref id="B42">
<label>42</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yap</surname> <given-names>HY</given-names>
</name>
<name>
<surname>Siow</surname> <given-names>TS</given-names>
</name>
<name>
<surname>Chow</surname> <given-names>SK</given-names>
</name>
<name>
<surname>Teow</surname> <given-names>SY</given-names>
</name>
</person-group>. <article-title>Epstein-barr virus- (EBV-) immortalized lymphoblastoid cell lines (LCLs) express high level of CD23 but low CD27 to support their growth</article-title>. <source>Adv Virol</source>. (<year>2019</year>) <volume>2019</volume>:<fpage>6464521</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1155/2019/6464521</pub-id>
</citation>
</ref>
<ref id="B43">
<label>43</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Agematsu</surname> <given-names>K</given-names>
</name>
</person-group>. <article-title>Memory B cells and CD27</article-title>. <source>Histol Histopathol</source>. (<year>2000</year>) <volume>15</volume>:<page-range>573&#x2013;6</page-range>.</citation>
</ref>
<ref id="B44">
<label>44</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Akhmetzyanova</surname> <given-names>I</given-names>
</name>
<name>
<surname>McCarron</surname> <given-names>MJ</given-names>
</name>
<name>
<surname>Parekh</surname> <given-names>S</given-names>
</name>
<name>
<surname>Chesi</surname> <given-names>M</given-names>
</name>
<name>
<surname>Bergsagel</surname> <given-names>PL</given-names>
</name>
<name>
<surname>Fooksman</surname> <given-names>DR</given-names>
</name>
</person-group>. <article-title>Dynamic CD138 surface expression regulates switch between myeloma growth and dissemination</article-title>. <source>Leukemia</source>. (<year>2020</year>) <volume>34</volume>:<page-range>245&#x2013;56</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41375-019-0519-4</pub-id>
</citation>
</ref>
<ref id="B45">
<label>45</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pellat-Deceunynck</surname> <given-names>C</given-names>
</name>
<name>
<surname>Bataille</surname> <given-names>R</given-names>
</name>
<name>
<surname>Robillard</surname> <given-names>N</given-names>
</name>
<name>
<surname>Harousseau</surname> <given-names>JL</given-names>
</name>
<name>
<surname>Rapp</surname> <given-names>MJ</given-names>
</name>
<name>
<surname>Juge-Morineau</surname> <given-names>N</given-names>
</name>
<etal/>
</person-group>. <article-title>Expression of CD28 and CD40 in human myeloma cells: a comparative study with normal plasma cells</article-title>. <source>Blood</source>. (<year>1994</year>) <volume>84</volume>:<page-range>2597&#x2013;603</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1182/blood.V84.8.2597.2597</pub-id>
</citation>
</ref>
<ref id="B46">
<label>46</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Laumont</surname> <given-names>CM</given-names>
</name>
<name>
<surname>Banville</surname> <given-names>AC</given-names>
</name>
<name>
<surname>Gilardi</surname> <given-names>M</given-names>
</name>
<name>
<surname>Hollern</surname> <given-names>DP</given-names>
</name>
<name>
<surname>Nelson</surname> <given-names>BH</given-names>
</name>
</person-group>. <article-title>Tumour-infiltrating B cells: immunological mechanisms, clinical impact and therapeutic opportunities</article-title>. <source>Nat Rev Cancer</source>. (<year>2022</year>) <volume>22</volume>:<page-range>414&#x2013;30</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41568-022-00466-1</pub-id>
</citation>
</ref>
<ref id="B47">
<label>47</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Milne</surname> <given-names>K</given-names>
</name>
<name>
<surname>Kobel</surname> <given-names>M</given-names>
</name>
<name>
<surname>Kalloger</surname> <given-names>SE</given-names>
</name>
<name>
<surname>Barnes</surname> <given-names>RO</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>D</given-names>
</name>
<name>
<surname>Gilks</surname> <given-names>CB</given-names>
</name>
<etal/>
</person-group>. <article-title>Systematic analysis of immune infiltrates in high-grade serous ovarian cancer reveals CD20, FoxP3 and TIA-1 as positive prognostic factors</article-title>. <source>PloS One</source>. (<year>2009</year>) <volume>4</volume>:<elocation-id>e6412</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0006412</pub-id>
</citation>
</ref>
<ref id="B48">
<label>48</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yajima</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Marczynska</surname> <given-names>B</given-names>
</name>
<name>
<surname>Nonoyama</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Transforming activity of Epstein-Barr virus obtained by superinfection of Raji cells</article-title>. <source>Proc Natl Acad Sci U S A</source>. (<year>1978</year>) <volume>75</volume>:<page-range>2008&#x2013;10</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.75.4.2008</pub-id>
</citation>
</ref>
<ref id="B49">
<label>49</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ho</surname> <given-names>JWY</given-names>
</name>
<name>
<surname>Li</surname> <given-names>L</given-names>
</name>
<name>
<surname>Wong</surname> <given-names>KY</given-names>
</name>
<name>
<surname>Srivastava</surname> <given-names>G</given-names>
</name>
<name>
<surname>Tao</surname> <given-names>Q</given-names>
</name>
</person-group>. <article-title>Comprehensive profiling of EBV gene expression and promoter methylation reveals latency II viral infection and sporadic abortive lytic activation in peripheral T-cell lymphomas</article-title>. <source>Viruses</source>. (<year>2023</year>) <volume>15</volume>:<page-range>1&#x2013;14</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/v15020423</pub-id>
</citation>
</ref>
<ref id="B50">
<label>50</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tabata</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Hibi</surname> <given-names>S</given-names>
</name>
<name>
<surname>Teramura</surname> <given-names>T</given-names>
</name>
<name>
<surname>Kuriyama</surname> <given-names>K</given-names>
</name>
<name>
<surname>Yagi</surname> <given-names>T</given-names>
</name>
<name>
<surname>Todo</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Molecular analysis of latent membrane protein 1 in patients with epstein-barr virus-associated hemophagocytic lymphohistiocytosis in Japan</article-title>. <source>Leuk Lymph</source>. (<year>2000</year>) <volume>38</volume>:<page-range>373&#x2013;80</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.3109/10428190009087028</pub-id>
</citation>
</ref>
<ref id="B51">
<label>51</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rizner</surname> <given-names>TL</given-names>
</name>
</person-group>. <article-title>Teaching the structure of immunoglobulins by molecular visualization and SDS-PAGE analysis</article-title>. <source>Biochem Mol Biol Educ</source>. (<year>2014</year>) <volume>42</volume>:<page-range>152&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/bmb.20764</pub-id>
</citation>
</ref>
<ref id="B52">
<label>52</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname> <given-names>JQ</given-names>
</name>
<name>
<surname>Kleinstein</surname> <given-names>SH</given-names>
</name>
</person-group>. <article-title>Cutting edge: ig H chains are sufficient to determine most B cell clonal relationships</article-title>. <source>J Immunol</source>. (<year>2019</year>) <volume>203</volume>:<page-range>1687&#x2013;92</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.4049/jimmunol.1900666</pub-id>
</citation>
</ref>
<ref id="B53">
<label>53</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wilson</surname> <given-names>AL</given-names>
</name>
<name>
<surname>Moffitt</surname> <given-names>LR</given-names>
</name>
<name>
<surname>Duffield</surname> <given-names>N</given-names>
</name>
<name>
<surname>Rainczuk</surname> <given-names>A</given-names>
</name>
<name>
<surname>Jobling</surname> <given-names>TW</given-names>
</name>
<name>
<surname>Plebanski</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Autoantibodies against HSF1 and CCDC155 as biomarkers of early-stage, high-grade serous ovarian cancer</article-title>. <source>Cancer Epidemiol Biomarkers Prev</source>. (<year>2018</year>) <volume>27</volume>:<page-range>183&#x2013;92</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/1055-9965.EPI-17-0752</pub-id>
</citation>
</ref>
<ref id="B54">
<label>54</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lowenstein</surname> <given-names>EJ</given-names>
</name>
<name>
<surname>Daly</surname> <given-names>RJ</given-names>
</name>
<name>
<surname>Batzer</surname> <given-names>AG</given-names>
</name>
<name>
<surname>Li</surname> <given-names>W</given-names>
</name>
<name>
<surname>Margolis</surname> <given-names>B</given-names>
</name>
<name>
<surname>Lammers</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>The SH2 and SH3 domain-containing protein GRB2 links receptor tyrosine kinases to ras signaling</article-title>. <source>Cell</source>. (<year>1992</year>) <volume>70</volume>:<page-range>431&#x2013;42</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/0092-8674(92)90167-B</pub-id>
</citation>
</ref>
<ref id="B55">
<label>55</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Foote</surname> <given-names>JB</given-names>
</name>
<name>
<surname>Mahmoud</surname> <given-names>TI</given-names>
</name>
<name>
<surname>Vale</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Kearney</surname> <given-names>JF</given-names>
</name>
</person-group>. <article-title>Long-term maintenance of polysaccharide-specific antibodies by IgM-secreting cells</article-title>. <source>J Immunol</source>. (<year>2012</year>) <volume>188</volume>:<fpage>57</fpage>&#x2013;<lpage>67</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.4049/jimmunol.1100783</pub-id>
</citation>
</ref>
<ref id="B56">
<label>56</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Grimsholm</surname> <given-names>O</given-names>
</name>
</person-group>. <article-title>CD27 on human memory B cells - more than just a surface marker</article-title>. <source>Clin Exp Immunol</source>. (<year>2022</year>) <volume>213</volume>:<page-range>164&#x2013;72</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/cei/uxac114</pub-id>
</citation>
</ref>
<ref id="B57">
<label>57</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sasaki</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Hayashi</surname> <given-names>K</given-names>
</name>
<name>
<surname>Suzuki</surname> <given-names>T</given-names>
</name>
<name>
<surname>Toyoshima</surname> <given-names>A</given-names>
</name>
<name>
<surname>Teragawa</surname> <given-names>M</given-names>
</name>
<name>
<surname>Gouda</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>[<italic>In situ</italic> detection of Epstein-Barr virus in the non-neoplastic gastric glands and infiltrated lymphocytes]</article-title>. <source>Rinsho Byori</source>. (<year>1996</year>) <volume>44</volume>:<page-range>1196&#x2013;200</page-range>.</citation>
</ref>
<ref id="B58">
<label>58</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fend</surname> <given-names>F</given-names>
</name>
<name>
<surname>Hittmair</surname> <given-names>A</given-names>
</name>
<name>
<surname>Rogatsch</surname> <given-names>H</given-names>
</name>
<name>
<surname>Gredler</surname> <given-names>E</given-names>
</name>
<name>
<surname>Obrist</surname> <given-names>P</given-names>
</name>
<name>
<surname>Mikuz</surname> <given-names>G</given-names>
</name>
</person-group>. <article-title>Seminomas positive for Epstein-Barr virus by the polymerase chain reaction: viral RNA transcripts (Epstein-Barr-encoded small RNAs) are present in intratumoral lymphocytes but absent from the neoplastic cells</article-title>. <source>Mod Pathol</source>. (<year>1995</year>) <volume>8</volume>:<page-range>622&#x2013;5</page-range>.</citation>
</ref>
<ref id="B59">
<label>59</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Murata</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>Regulation of Epstein-Barr virus reactivation from latency</article-title>. <source>Microbiol Immunol</source>. (<year>2014</year>) <volume>58</volume>:<page-range>307&#x2013;17</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/1348-0421.12155</pub-id>
</citation>
</ref>
<ref id="B60">
<label>60</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Indari</surname> <given-names>O</given-names>
</name>
<name>
<surname>Ghosh</surname> <given-names>S</given-names>
</name>
<name>
<surname>Bal</surname> <given-names>AS</given-names>
</name>
<name>
<surname>James</surname> <given-names>A</given-names>
</name>
<name>
<surname>Garg</surname> <given-names>M</given-names>
</name>
<name>
<surname>Mishra</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>Awakening the sleeping giant: Epstein-Barr virus reactivation by biological agents</article-title>. <source>Pathog Dis</source>. (<year>2024</year>) <volume>82</volume>:<page-range>1&#x2013;15</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/femspd/ftae002</pub-id>
</citation>
</ref>
<ref id="B61">
<label>61</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Glaser</surname> <given-names>R</given-names>
</name>
<name>
<surname>Kiecolt-Glaser</surname> <given-names>JK</given-names>
</name>
<name>
<surname>Speicher</surname> <given-names>CE</given-names>
</name>
<name>
<surname>Holliday</surname> <given-names>JE</given-names>
</name>
</person-group>. <article-title>Stress, loneliness, and changes in herpesvirus latency</article-title>. <source>J Behav Med</source>. (<year>1985</year>) <volume>8</volume>:<page-range>249&#x2013;60</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/BF00870312</pub-id>
</citation>
</ref>
<ref id="B62">
<label>62</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Libert</surname> <given-names>N</given-names>
</name>
<name>
<surname>Bigaillon</surname> <given-names>C</given-names>
</name>
<name>
<surname>Chargari</surname> <given-names>C</given-names>
</name>
<name>
<surname>Bensalah</surname> <given-names>M</given-names>
</name>
<name>
<surname>Muller</surname> <given-names>V</given-names>
</name>
<name>
<surname>Merat</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Epstein-Barr virus reactivation in critically ill immunocompetent patients</article-title>. <source>BioMed J</source>. (<year>2015</year>) <volume>38</volume>:<page-range>70&#x2013;6</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.4103/2319-4170.132905</pub-id>
</citation>
</ref>
<ref id="B63">
<label>63</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hsu</surname> <given-names>CH</given-names>
</name>
<name>
<surname>Hergenhahn</surname> <given-names>M</given-names>
</name>
<name>
<surname>Chuang</surname> <given-names>SE</given-names>
</name>
<name>
<surname>Yeh</surname> <given-names>PY</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>TC</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Induction of Epstein-Barr virus (EBV) reactivation in Raji cells by doxorubicin and cisplatin</article-title>. <source>Anticancer Res</source>. (<year>2002</year>) <volume>22</volume>:<page-range>4065&#x2013;71</page-range>.</citation>
</ref>
<ref id="B64">
<label>64</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Adamson</surname> <given-names>AL</given-names>
</name>
<name>
<surname>Darr</surname> <given-names>D</given-names>
</name>
<name>
<surname>Holley-Guthrie</surname> <given-names>E</given-names>
</name>
<name>
<surname>Johnson</surname> <given-names>RA</given-names>
</name>
<name>
<surname>Mauser</surname> <given-names>A</given-names>
</name>
<name>
<surname>Swenson</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Epstein-Barr virus immediate-early proteins BZLF1 and BRLF1 activate the ATF2 transcription factor by increasing the levels of phosphorylated p38 and c-Jun N-terminal kinases</article-title>. <source>J Virol</source>. (<year>2000</year>) <volume>74</volume>:<page-range>1224&#x2013;33</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JVI.74.3.1224-1233.2000</pub-id>
</citation>
</ref>
<ref id="B65">
<label>65</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Domblides</surname> <given-names>C</given-names>
</name>
<name>
<surname>Rochefort</surname> <given-names>J</given-names>
</name>
<name>
<surname>Riffard</surname> <given-names>C</given-names>
</name>
<name>
<surname>Panouillot</surname> <given-names>M</given-names>
</name>
<name>
<surname>Lescaille</surname> <given-names>G</given-names>
</name>
<name>
<surname>Teillaud</surname> <given-names>JL</given-names>
</name>
<etal/>
</person-group>. <article-title>Tumor-associated tertiary lymphoid structures: from basic and clinical knowledge to therapeutic manipulation</article-title>. <source>Front Immunol</source>. (<year>2021</year>) <volume>12</volume>:<elocation-id>698604</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2021.698604</pub-id>
</citation>
</ref>
<ref id="B66">
<label>66</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dai</surname> <given-names>J</given-names>
</name>
<name>
<surname>SoRelle</surname> <given-names>ED</given-names>
</name>
<name>
<surname>Heckenberg</surname> <given-names>E</given-names>
</name>
<name>
<surname>Song</surname> <given-names>L</given-names>
</name>
<name>
<surname>Cable</surname> <given-names>JM</given-names>
</name>
<name>
<surname>Crawford</surname> <given-names>GE</given-names>
</name>
<etal/>
</person-group>. <article-title>Epstein-Barr virus induces germinal center light zone chromatin architecture and promotes survival through enhancer looping at the BCL2A1 locus</article-title>. <source>mBio</source>. (<year>2024</year>) <volume>15</volume>:<elocation-id>e0244423</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/mbio.02444-23</pub-id>
</citation>
</ref>
<ref id="B67">
<label>67</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>C</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>X</given-names>
</name>
<name>
<surname>Ji</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Novel bi-allelic variants in KASH5 are associated with meiotic arrest and non-obstructive azoospermia</article-title>. <source>Mol Hum Reprod</source>. (<year>2022</year>) <volume>28</volume>(<issue>7</issue>):<page-range>1&#x2013;15</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/molehr/gaac021</pub-id>
</citation>
</ref>
<ref id="B68">
<label>68</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>H</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Hua</surname> <given-names>R</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Cheng</surname> <given-names>L</given-names>
</name>
<name>
<surname>Li</surname> <given-names>K</given-names>
</name>
<etal/>
</person-group>. <article-title>Homozygous missense mutation in CCDC155 disrupts the transmembrane distribution of CCDC155 and SUN1, resulting in non-obstructive azoospermia and premature ovarian insufficiency in humans</article-title>. <source>Hum Genet</source>. (<year>2022</year>) <volume>141</volume>:<page-range>1795&#x2013;809</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00439-022-02459-4</pub-id>
</citation>
</ref>
<ref id="B69">
<label>69</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>de Las Heras</surname> <given-names>JI</given-names>
</name>
<name>
<surname>Batrakou</surname> <given-names>DG</given-names>
</name>
<name>
<surname>Schirmer</surname> <given-names>EC</given-names>
</name>
</person-group>. <article-title>Cancer biology and the nuclear envelope: a convoluted relationship</article-title>. <source>Semin Cancer Biol</source>. (<year>2013</year>) <volume>23</volume>:<page-range>125&#x2013;37</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.semcancer.2012.01.008</pub-id>
</citation>
</ref>
<ref id="B70">
<label>70</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lombardi</surname> <given-names>ML</given-names>
</name>
<name>
<surname>Jaalouk</surname> <given-names>DE</given-names>
</name>
<name>
<surname>Shanahan</surname> <given-names>CM</given-names>
</name>
<name>
<surname>Burke</surname> <given-names>B</given-names>
</name>
<name>
<surname>Roux</surname> <given-names>KJ</given-names>
</name>
<name>
<surname>Lammerding</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>The interaction between nesprins and sun proteins at the nuclear envelope is critical for force transmission between the nucleus and cytoskeleton</article-title>. <source>J Biol Chem</source>. (<year>2011</year>) <volume>286</volume>:<page-range>26743&#x2013;53</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1074/jbc.M111.233700</pub-id>
</citation>
</ref>
<ref id="B71">
<label>71</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>N</given-names>
</name>
<name>
<surname>Tytell</surname> <given-names>JD</given-names>
</name>
<name>
<surname>Ingber</surname> <given-names>DE</given-names>
</name>
</person-group>. <article-title>Mechanotransduction at a distance: mechanically coupling the extracellular matrix with the nucleus</article-title>. <source>Nat Rev Mol Cell Biol</source>. (<year>2009</year>) <volume>10</volume>:<fpage>75</fpage>&#x2013;<lpage>82</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nrm2594</pub-id>
</citation>
</ref>
<ref id="B72">
<label>72</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jaalouk</surname> <given-names>DE</given-names>
</name>
<name>
<surname>Lammerding</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Mechanotransduction gone awry</article-title>. <source>Nat Rev Mol Cell Biol</source>. (<year>2009</year>) <volume>10</volume>:<fpage>63</fpage>&#x2013;<lpage>73</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nrm2597</pub-id>
</citation>
</ref>
<ref id="B73">
<label>73</label>
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Neumann</surname> <given-names>S</given-names>
</name>
<name>
<surname>Noegel</surname> <given-names>AA</given-names>
</name>
</person-group>. <article-title>Nesprins in Cell Stability and Migration</article-title>. In: <person-group person-group-type="editor">
<name>
<surname>Schirmer</surname> <given-names>EC</given-names>
</name>
<name>
<surname>de las Heras</surname> <given-names>JI</given-names>
</name>
</person-group>, editors. <source>Cancer Biology and the Nuclear Envelope: Recent Advances May Elucidate Past Paradoxes</source>. <publisher-name>Springer New York</publisher-name>, <publisher-loc>New York, NY</publisher-loc> (<year>2014</year>). p. <fpage>491</fpage>&#x2013;<lpage>504</lpage>.</citation>
</ref>
<ref id="B74">
<label>74</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li Mow Chee</surname> <given-names>F</given-names>
</name>
<name>
<surname>Beernaert</surname> <given-names>B</given-names>
</name>
<name>
<surname>Griffith</surname> <given-names>BGC</given-names>
</name>
<name>
<surname>Loftus</surname> <given-names>AEP</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wills</surname> <given-names>JC</given-names>
</name>
<etal/>
</person-group>. <article-title>Mena regulates nesprin-2 to control actin-nuclear lamina associations, trans-nuclear membrane signalling and gene expression</article-title>. <source>Nat Commun</source>. (<year>2023</year>) <volume>14</volume>:<fpage>1602</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-023-37021-x</pub-id>
</citation>
</ref>
<ref id="B75">
<label>75</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hudson</surname> <given-names>ME</given-names>
</name>
<name>
<surname>Pozdnyakova</surname> <given-names>I</given-names>
</name>
<name>
<surname>Haines</surname> <given-names>K</given-names>
</name>
<name>
<surname>Mor</surname> <given-names>G</given-names>
</name>
<name>
<surname>Snyder</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Identification of differentially expressed proteins in ovarian cancer using high-density protein microarrays</article-title>. <source>Proc Natl Acad Sci U S A</source>. (<year>2007</year>) <volume>104</volume>:<page-range>17494&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.0708572104</pub-id>
</citation>
</ref>
<ref id="B76">
<label>76</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zanini</surname> <given-names>E</given-names>
</name>
<name>
<surname>Louis</surname> <given-names>LS</given-names>
</name>
<name>
<surname>Antony</surname> <given-names>J</given-names>
</name>
<name>
<surname>Karali</surname> <given-names>E</given-names>
</name>
<name>
<surname>Okon</surname> <given-names>IS</given-names>
</name>
<name>
<surname>McKie</surname> <given-names>AB</given-names>
</name>
<etal/>
</person-group>. <article-title>The tumor-suppressor protein OPCML potentiates anti-EGFR- and anti-HER2-targeted therapy in HER2-positive ovarian and breast cancer</article-title>. <source>Mol Cancer Ther</source>. (<year>2017</year>) <volume>16</volume>:<page-range>2246&#x2013;56</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/1535-7163.MCT-17-0081</pub-id>
</citation>
</ref>
<ref id="B77">
<label>77</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Auger</surname> <given-names>KR</given-names>
</name>
<name>
<surname>Jarvis</surname> <given-names>L</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Roberts</surname> <given-names>TM</given-names>
</name>
</person-group>. <article-title>Direct association of Grb2 with the p85 subunit of phosphatidylinositol 3-kinase</article-title>. <source>J Biol Chem</source>. (<year>1995</year>) <volume>270</volume>:<page-range>12774&#x2013;80</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1074/jbc.270.21.12774</pub-id>
</citation>
</ref>
<ref id="B78">
<label>78</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lara</surname> <given-names>OD</given-names>
</name>
<name>
<surname>Bayraktar</surname> <given-names>E</given-names>
</name>
<name>
<surname>Amero</surname> <given-names>P</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>S</given-names>
</name>
<name>
<surname>Ivan</surname> <given-names>C</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>W</given-names>
</name>
<etal/>
</person-group>. <article-title>Therapeutic efficacy of liposomal Grb2 antisense oligodeoxynucleotide (L-Grb2) in preclinical models of ovarian and uterine cancer</article-title>. <source>Oncotarget</source>. (<year>2020</year>) <volume>11</volume>:<page-range>2819&#x2013;33</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.18632/oncotarget.v11i29</pub-id>
</citation>
</ref>
<ref id="B79">
<label>79</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shi</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>H</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>P</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>More than one antibody of individual B cells revealed by single-cell immune profiling</article-title>. <source>Cell Discov</source>. (<year>2019</year>) <volume>5</volume>:<fpage>64</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41421-019-0137-3</pub-id>
</citation>
</ref>
<ref id="B80">
<label>80</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Diwan</surname> <given-names>BA</given-names>
</name>
<name>
<surname>Ramakrishna</surname> <given-names>G</given-names>
</name>
<name>
<surname>Anderson</surname> <given-names>LM</given-names>
</name>
<name>
<surname>Ramljak</surname> <given-names>D</given-names>
</name>
</person-group>. <article-title>Overexpression of Grb2 in inflammatory lesions and preneoplastic foci and tumors induced by N-nitrosodimethylamine in Helicobacter hepaticus-infected and -noninfected A/J mice</article-title>. <source>Toxicol Pathol</source>. (<year>2000</year>) <volume>28</volume>:<page-range>548&#x2013;54</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1177/019262330002800407</pub-id>
</citation>
</ref>
<ref id="B81">
<label>81</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sutendra</surname> <given-names>G</given-names>
</name>
<name>
<surname>Michelakis</surname> <given-names>ED</given-names>
</name>
</person-group>. <article-title>Pyruvate dehydrogenase kinase as a novel therapeutic target in oncology</article-title>. <source>Front Oncol</source>. (<year>2013</year>) <volume>3</volume>:<elocation-id>38</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fonc.2013.00038</pub-id>
</citation>
</ref>
<ref id="B82">
<label>82</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nunes-Xavier</surname> <given-names>CE</given-names>
</name>
<name>
<surname>Mingo</surname> <given-names>J</given-names>
</name>
<name>
<surname>Emaldi</surname> <given-names>M</given-names>
</name>
<name>
<surname>Flem-Karlsen</surname> <given-names>K</given-names>
</name>
<name>
<surname>Maelandsmo</surname> <given-names>GM</given-names>
</name>
<name>
<surname>Fodstad</surname> <given-names>O</given-names>
</name>
<etal/>
</person-group>. <article-title>Heterogeneous expression and subcellular localization of pyruvate dehydrogenase complex in prostate cancer</article-title>. <source>Front Oncol</source>. (<year>2022</year>) <volume>12</volume>:<elocation-id>873516</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fonc.2022.873516</pub-id>
</citation>
</ref>
<ref id="B83">
<label>83</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Maiuthed</surname> <given-names>A</given-names>
</name>
<name>
<surname>Prakhongcheep</surname> <given-names>O</given-names>
</name>
<name>
<surname>Chanvorachote</surname> <given-names>P</given-names>
</name>
</person-group>. <article-title>Microarray-based analysis of genes, transcription factors, and epigenetic modifications in lung cancer exposed to nitric oxide</article-title>. <source>Cancer Genomics Proteom</source>. (<year>2020</year>) <volume>17</volume>:<page-range>401&#x2013;15</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.21873/cgp.20199</pub-id>
</citation>
</ref>
<ref id="B84">
<label>84</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jacqueline</surname> <given-names>C</given-names>
</name>
<name>
<surname>Finn</surname> <given-names>OJ</given-names>
</name>
</person-group>. <article-title>Antibodies specific for disease-associated antigens (DAA) expressed in non-malignant diseases reveal potential new tumor-associated antigens (TAA) for immunotherapy or immunoprevention</article-title>. <source>Semin Immunol</source>. (<year>2020</year>) <volume>47</volume>:<fpage>101394</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.smim.2020.101394</pub-id>
</citation>
</ref>
<ref id="B85">
<label>85</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Iheagwara</surname> <given-names>UK</given-names>
</name>
<name>
<surname>Beatty</surname> <given-names>PL</given-names>
</name>
<name>
<surname>Van</surname> <given-names>PT</given-names>
</name>
<name>
<surname>Ross</surname> <given-names>TM</given-names>
</name>
<name>
<surname>Minden</surname> <given-names>JS</given-names>
</name>
<name>
<surname>Finn</surname> <given-names>OJ</given-names>
</name>
</person-group>. <article-title>Influenza virus infection elicits protective antibodies and T cells specific for host cell antigens also expressed as tumor-associated antigens: a new view of cancer immunosurveillance</article-title>. <source>Cancer Immunol Res</source>. (<year>2014</year>) <volume>2</volume>:<page-range>263&#x2013;73</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/2326-6066.CIR-13-0125</pub-id>
</citation>
</ref>
<ref id="B86">
<label>86</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zaenker</surname> <given-names>P</given-names>
</name>
<name>
<surname>Gray</surname> <given-names>ES</given-names>
</name>
<name>
<surname>Ziman</surname> <given-names>MR</given-names>
</name>
</person-group>. <article-title>Autoantibody production in cancer&#x2014;The humoral immune response toward autologous antigens in cancer patients</article-title>. <source>Autoimmun Rev</source>. (<year>2016</year>) <volume>15</volume>:<page-range>477&#x2013;83</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.autrev.2016.01.017</pub-id>
</citation>
</ref>
<ref id="B87">
<label>87</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Soussan</surname> <given-names>S</given-names>
</name>
<name>
<surname>Pupier</surname> <given-names>G</given-names>
</name>
<name>
<surname>Cremer</surname> <given-names>I</given-names>
</name>
<name>
<surname>Joubert</surname> <given-names>PE</given-names>
</name>
<name>
<surname>Sautes-Fridman</surname> <given-names>C</given-names>
</name>
<name>
<surname>Fridman</surname> <given-names>WH</given-names>
</name>
<etal/>
</person-group>. <article-title>Unraveling the complex interplay between anti-tumor immune response and autoimmunity mediated by B cells and autoantibodies in the era of anti-checkpoint monoclonal antibody therapies</article-title>. <source>Front Immunol</source>. (<year>2024</year>) <volume>15</volume>:<elocation-id>1343020</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2024.1343020</pub-id>
</citation>
</ref>
<ref id="B88">
<label>88</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kelly</surname> <given-names>BT</given-names>
</name>
<name>
<surname>Graham</surname> <given-names>SC</given-names>
</name>
<name>
<surname>Liska</surname> <given-names>N</given-names>
</name>
<name>
<surname>Dannhauser</surname> <given-names>PN</given-names>
</name>
<name>
<surname>H&#xf6;ning</surname> <given-names>S</given-names>
</name>
<name>
<surname>Ungewickell</surname> <given-names>EJ</given-names>
</name>
<etal/>
</person-group>. <article-title>Clathrin adaptors. AP2 controls clathrin polymerization with a membrane-activated switch</article-title>. <source>Science</source>. (<year>2014</year>) <volume>345</volume>:<page-range>459&#x2013;63</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/science.1254836</pub-id>
</citation>
</ref>
<ref id="B89">
<label>89</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rhodes</surname> <given-names>DA</given-names>
</name>
<name>
<surname>Isenberg</surname> <given-names>DA</given-names>
</name>
</person-group>. <article-title>TRIM21 and the function of antibodies inside cells</article-title>. <source>Trends Immunol</source>. (<year>2017</year>) <volume>38</volume>:<page-range>916&#x2013;26</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.it.2017.07.005</pub-id>
</citation>
</ref>
<ref id="B90">
<label>90</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Clift</surname> <given-names>D</given-names>
</name>
<name>
<surname>So</surname> <given-names>C</given-names>
</name>
<name>
<surname>McEwan</surname> <given-names>WA</given-names>
</name>
<name>
<surname>James</surname> <given-names>LC</given-names>
</name>
<name>
<surname>Schuh</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Acute and rapid degradation of endogenous proteins by Trim-Away</article-title>. <source>Nat Protoc</source>. (<year>2018</year>) <volume>13</volume>:<page-range>2149&#x2013;75</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41596-018-0028-3</pub-id>
</citation>
</ref>
<ref id="B91">
<label>91</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rosenberg</surname> <given-names>MI</given-names>
</name>
<name>
<surname>Greenstein</surname> <given-names>E</given-names>
</name>
<name>
<surname>Buchkovich</surname> <given-names>M</given-names>
</name>
<name>
<surname>Peres</surname> <given-names>A</given-names>
</name>
<name>
<surname>Santoni-Rugiu</surname> <given-names>E</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>Polyclonal lymphoid expansion drives paraneoplastic autoimmunity in neuroblastoma</article-title>. <source>Cell Rep</source>. (<year>2023</year>) <volume>42</volume>:<fpage>112879</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.celrep.2023.112879</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>