Amino acid sequences of BmSPP and its homologs in other insects of different orders as well as in various model organisms were retrieved from the NCBI database (https://www.ncbi.nlm.nih.gov/). These species include Bombyx mandarina, Manduca sexta, Cryptotermes secundus, Coptotermes formosanus, Ctenocephalides felis, Athalia rosae, Lamprigera yunnana, Nilaparvata lugens, Musca domestica, Daphnia pulex, Drosophila arizonae, Homo sapiens, Mus musculus, Danio rerio and Xenopus laevis. For Multiple sequence comparison and coloring, we utilized Jalview software. To compare sequences, we imported SPP sequences and selected “Web Service-Alignment-ClustalO-with Defaults” and to add a color, we selected “Colour-Clustal”. Further, we predicted the conserved motif using the MEME (https://meme-suite.org/meme/tools/meme). After importing the sequence, we adjusted the “Select number of patterns” option to 10 and click “Search”.

The Bombyx mori strain Dazao (DZ) and BmN cell line were maintained at the Integrative Science Center of Germplasm Creation in Western China (Chongqing) Science City, Biological Science Research Center (Southwest University, Chongqing, 400716, China). BmN cells were cultured at 26 °C in Grace medium supplemented with 10% fetal bovine serum (FBS; Gibco) and penicillin and streptomycin (18). The rearing temperature of silkworm larvae was 26 ± 1 °C, and the larvae fed on fresh mulberry leaves. BmNPV BVs expressing green fluorescent protein (BmNPV-GFP) were collected from the infected BmN cells (19). BmNPV (Guangdong strain) was collected from the hemolymph of infected silkworm larvae.

The eggs, L1D2, L2D0, L2D2, L3D0, L3D2, L4D0, L4D2, L5D1, L5D3, L5D5, L5D7 and pupa of DZ silkworms were used for RNA extraction. Total RNA of testis, ovary, malpighian tubule, hemolymph, fatbody, anterior silk gland, middle silk gland, posterior silk gland, head, epidermis, midgut and trachea of DZ silkworms were extracted at day-3 fifth instar larvae. RNA was extracted from the fatbody of L4D3, L5D1, L5D3, L5D5, L5D7 and from the midgut of L4D1, L4D3, L5D1, L5D3, L5D5, L5D7 of DZ silkworms. BmN cells were treated with BmNPV-GFP and collected at 3, 6, 12, 24, 48, and 72 hours post infection (hpi) for RNA extraction. Total RNA was extracted with TRIzol reagent (Invitrogen) and cDNA was synthesized with M-MLV reverse transcriptase (Promega). Translation initiation factor 4a (TIF-4A) is considered a housekeeping gene in silkworms (20), as its expression remains unaffected by experiments, making it commonly used in gene expression analysis. The cDNA from these samples was used for qPCR analysis of BmSPP, while control TIF-4A was used as a reference. Primer sequences were: BmSPP (F: GCTCTGTCTTGGAGCTTGGT, R: GTCCGCAGAGTAGGATGCAG) and TIF-4A (F: TTCGTACTGGCTCTTCTCGT, R: CAAAGTTGATAGCAATTCCCT). BmN cells were treated with BmNPV-GFP and collected at 3, 6, 12, 24, 48, and 72 hpi for total DNA extraction. Total DNA was extracted post-infection with a tissue DNA kit (Omega). Additionally, we using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal reference gene, since its expression is not influenced by BmNPV attack, qPCR was performed to investigate the changes in the expression of BmNPV genes, GP64. Primer sequences were: GAPDH (F: CATTCCGCGTCCCTGTTGCTAAT, R: GCTGCCTCCTTGACCTTTTGC) and GP64 (F: CCATCGTGGAGACGGACTA, R: CTCGCACTGCTGCCTGA). Fluorescence real time PCR analysis was performed using the SYBR Premix Ex Taq II (Takara) on a, 7500 rapid real-time PCR system (Applied Biosystems) at 95 °C for 30 s, 40 cycles at 95 °C for 5 s and 60 °C for 30 s.

The exon sequence of BmSPP was selected as the target region for gene knockdown. The sgRNA primers were designed on first exon using CCTop (https://cctop.cos.uni-heidelberg.de:8043/), and the sgRNA primer sequence with the highest score was chosen: SPP-sgRNA (F: AAGTGATGTTTATAGGTATTTCTG, R: AAACCAGAAATACCTATAAACATC). The synthesized sequence was annealed to produce double-stranded gRNA, which was then ligated to pBac[3×P3-EGFP-SV40-U6-TTTTTT] base vector (provided by the laboratory) by T4 ligase (NEB) (19). The ligated plasmid was transfected into competent cells, cultured overnight, and a single colony was picked for PCR verification. PrimeSTAR^® Max DNA polymerase (Takara) was used for PCR with the following procedure: 98 °C 2 min, 40 cycles at 98 °C for 10 s, 58 °C for 15 s, 72 °C for 30 s, and 72 °C for 5 min. These positive clones were the sequenced. Primer sequences were: U6R (AGCTGTCCAAGGAATGCG) and gRNA-F (CGACTCGGTGCCACTTT). The pBac[3×P3-EGFP-SV40-U6-gRNA-TTTTTT] knockout vector was constructed and named SPP-sgRNA. In this vector, 3×P3 represents an eye-specific expression promoter, EGFP refers to green fluorescent protein, SV40 denotes the termination sequence, U6 indicates the promoter, and TTTTTT represents the termination sequence.

The SPP inhibitor ((Z-LL)₂-ketone) (Sigma) was dissolved in DMSO. Due to the toxicity of DMSO to cells, the concentration of DMSO in all experimental groups was maintained at 2.5%, a concentration that did not affect the morphology and viability. (Z-LL)₂-ketone mixed with cell medium until the final concentration was 10 μM, 20 μM, 50 μM, 100 μM, and 200 μM, and added to BmN cells. In the control group, the medium was free of inhibitors and contained only 2.5% DMSO. 72 hours later cell morphology was observed by microscopy and 10% Cell Counting Kit-8 (Beyotime) was added and cell viability was assayed according to the manufacturer’s instructions. The appropriate concentration was selected for subsequent experiments, and after 6 h of inhibitor incubation, BmNPV-GFP was added. To analyze the proliferation of BmNPV-GFP, inverted fluorescence microscopy (Leica, DMi8) was performed after cells were infected with viruses at 0, 12, 24, and 48 hpi, and then cells were collected for total DNA extraction. Tissue DNA Kit (Omega) was used to extract total DNA. GAPDH was used as an internal control to detect DNA abundance of BmNPV through the expression of IE1, Helicase, GP64 and VP39. Primer sequences were: GAPDH (F: CATTCCGCGTCCCTGTTGCTAAT, R: GCTGCCTCCTTGACCTTTTGC); IE1 (F: CACGGTCGCTTCAACTCAA, R: TGTCGTCGAAACGCATCAA); Helicase (F: AACACATGCCAAGCCGATAT, R: TCCCGACACCGTTGACC); GP64 (F: CCATCGTGGAGACGGACTA, R: CTCGCACTGCTGCCTGA) and VP39 (F: TAATGCCCGTGGGTATGG, R: GTTTGATGAGGTGGCTGTTGC).

The nos-Cas9 vector expresses Cas9 protein throughout the growth process and tissues of silkworms (21). Transgenic knockout vector SPP-sgRNA was mixed with nos-Cas9 plasmid at 1:1 molar ratio to obtain the most effective gene knockout. X-tremeGENE HP DNA transfection reagent (Roche) was used to transfect BmN cells, with the transfection reagent serving the control. 48 hours after transfection, the exogenously introduced DNA integrated better into the genome of the cells as the cells themselves proliferated. Total DNA was extracted at 48 h, and genomic PCR was performed with PrimeSTAR ^®Max DNA polymerase (Takara). The procedure was as follows: 98 °C 2 min, 40 cycles at 98 °C for 10 s, 54 °C for 15 s, 72 °C for 30 s, and 72 °C for 5 min, then the product was ligated with pEASY^®-Blunt Zero Cloning Kit (TransGen), and after transformation, monoclonals were selected for sequencing to detect whether knock-out occurs. Primer sequences were: SPP-KO (F: ACTATCCGTAGGGGAAAGTTGTC, R: GAAACGATTCGATGCATTGA). The transfected BmN cells were infected with BmNPV-GFP after cultured 48 h. Total DNA was extracted at 0, 12, 24, 48, and 72 hpi. Tissue DNA Kit (Omega) was used to extract total DNA after infection for qPCR analysis. GAPDH was used as an internal control to detect DNA abundance of BmNPV through the expression of IE1, Helicase, GP64 and VP39.

The transgenic knockout vector SPP-sgRNA was mixed with an equal amount of A3 helper plasmid (provided by our laboratory) at 1:1 molar ratio and microinjected into fresh embryos within 2 h of egg laying of the silkworms. Surviving G0 moths were self-crossed and generate G1 broods. EGFP-labeled positive transgenic individuals were screened by fluorescence microscopy (Olympus), which named BmSPP-gRNA. BmSPP-gRNA was then crossed to Hsp90-Cas9 strain that expresses Cas9 protein in the whole body and red fluorescent protein RFP in the eyes (provided by our laboratory). Knockout individuals with both EGFP and RFP markers in the eyes were screened under fluorescence microscopy, and then fifth instar knockout larvae were selected to extract whole silkworm genomic DNA for knockout detection. Day-0 fifth instar larvae of transgenic silkworms BmSPP^KO and wild type silkworms BmSPP^WT were orally infected with BmNPV using 2×10⁶ OB/larvae. Each infected line test consisted of four replicates and each repeat included 40 larvae. Three larvae from the fourth repetition were collected as a mixed sample at 1, 2, 3, 4, 5, and 6 days post infection. Total DNA was extracted and analyzed by qPCR for the BmNPV gene, GP64 and control GAPDH to detect changes in viral DNA and calculated the mortality rate of the first three replicates.

The transgenic silkworms BmSPP^KO and wild type silkworms BmSPP^WT were reared until pupation, and male and female identification was carried out on the pupae of 5-day-old, and the full cocoon weight, cocoon layer weight and cocoon layer rate of males and females were investigated in groups.

Statistical analysis was performed with GraphPad (GraphPad Software, LaJolla, CA) using student’s t-tests. No significant difference between samples is indicated as P>0.05 and statistically significant differences are indicated as ns P>0.05, * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001.

Bioinformatics analyses showed high homology and conservation of SPP across species, and MEME analyses indicated the presence of two conserved motifs in these species ( Supplementary Figure S1 ). It is hypothesized that SPP may be involved in the same biological functions in different species.

The RT-qPCR was used to analyze the expression pattern of BmSPP at different growth stages of Bombyx mori and in different tissues of day-3 fifth instar larvae. For qPCR analysis, cDNA from different growth stages of silkworm were utilized and revealed that BmSPP was expressed in all stages, with the highest expression level observed on day-2 fourth instar larvae ( Figure 1A ). Additionally, BmSPP was expressed in all tissues of day-3 fifth instar larvae, with a higher expression level in midgut and fatbody, which are the main immune organs of silkworms ( Figure 1B ). Subsequently, the expression of BmSPP was detected in the midgut and fatbody at different growth periods, and it was found to be expressed at all periods ( Supplementary Figure S2 ). We hypothesized that BmSPP might play a role in antiviral immunity. BmN cells were infected with BmNPV-GFP and the proliferation curve of the virus was plotted ( Figure 1C ) and the changes in the expression level of BmSPP at different periods of viral infection were detected. The qPCR results showed that a decrease in the expression level of BmSPP after viral infection ( Figure 1D ).

There are many commercially available SPP inhibitors, the most widely used being (Z-LL)₂-ketone, a transition state analog that mimics the leucine-rich hydrophobic amino acid sequences found in many SPP/SPPL substrates, thereby inhibiting substrate processing (11, 22). (Z-LL)₂-ketone has not been documented for use in silkworm, we performed inhibitor toxicity assays after incubating BmN cells with different concentrations of inhibitors. The results showed that low concentrations of inhibitors (10, 20 and 50 μM) did not affect the normal cell morphology and were not toxic to the cells ( Figures 2A, B ).

BmN cells were treated with 10 μM, 20 μM, and 50 μM concentrations of the SPP inhibitor (Z-LL)₂-ketone. These cells were then infected with BmNPV-GFP labeled with green fluorescent protein. Virus proliferation was observed at 0, 12, 24, and 48 hpi using fluorescence microscopy. Cells treated with the inhibitor showed significantly reduced virus fluorescence ( Figure 2C ). The expression of BmNPV genes can be categorized into four phases: very early (0-4 hpi), late early (5-7 hpi), late (8-18 hpi), and very late (>18 hpi) (23). To analyze virus proliferation after inhibitor treatment, genomic DNA was extracted from the samples and the expression of key viral proliferation genes such as IE1 ( Figure 2D ), Helicase ( Figure 2E ), GP64 ( Figure 2F ), and VP39 ( Figure 2G ) was determined at different stages. The results showed that BmNPV proliferation was inhibited after inhibitor administration, with the degree of inhibitor becoming more prominent and higher the concentrations.

Since the inhibition of BmSPP in BmN cells results in the inhibition of BmNPV proliferation, we aimed to determine whether BmSPP has the same inhibitory effect on BmNPV proliferation at the cellular level when BmSPP is knocked out. To achieve this, we constructed a SPP-sgRNA knockout vector for the silkworm ( Figure 3A ). After transfection, genome sequencing was performed at 48 hours, which confirmed the successful mutation of the BmSPP gene ( Figure 3B ). Subsequently, transfected BmN cells were infected with BmNPV-GFP. Total DNA was extracted at 0, 12, 24, 48 and 72 hpi and qPCR analysis revealed that the down-regulation of IE1 ( Figure 3C ), Helicase ( Figure 3D ), GP64 ( Figure 3E ), and VP39 ( Figure 3F ) expression. These results suggest that the reduced expression of BmSPP can inhibit the proliferation of BmNPV.

We utilized CRISPR/Cas9 gene editing technology to knock out BmSPP in Bombyx mori. First, a gRNA positive individual expressing the green fluorescence protein (EGFP) in the eyes was obtained through microinjection. Subsequently, it was crossed with Hsp90-Cas9 strains that express the Cas9 protein at the end instar larvae of the silkworm (24), and individuals exhibiting both green and red fluorescence markers in the eyes were selected ( Figure 4A ). Analysis of genome sequencing demonstrated the mutation of BmSPP ( Figure 4B ). Individual challenge experiments showed that the BmNPV DNA content in BmSPP^KO was significantly lower than that in BmSPP^WT ( Figure 4C ). Finally, the mortality rate from BmNPV infection to pre-pupation was assessed, showing that BmSPP^KO had a mortality rate 12.4% lower than BmSPP^WT ( Figure 4D ). In conclusion, the reduction in BmSPP level enhances the disease resistance of silkworm larvae to BmNPV, indicating its negative regulatory role in silkworm resistance to BmNPV infection.

When BmSPP^WT and BmSPP^KO were fed until the fifth instar stage, there were no significant changes in body weight between BmSPP^WT and BmSPP^KO ( Figure 4E ). Furthermore, we observed pupal phenotypes and determined that there were no significant differences in cocoon size and pupal size in the BmSPP^KO compared to BmSPP^WT ( Figure 4F ). Additionally, we also assessed the economic value of females and males, and likewise found no significant changes ( Figure 4G ). These results indicate that the knockout of BmSPP, facilitated by the Hsp90-Cas9 strain, does not impact the economic value of the silkworm. This finding is critical for the development of NPV-resistant breeding.