The ASFV KP177R gene sequence used in this study was derived from ASFV strain China/2018/AnhuiXCGQ (GenBank accession no. MK128995.1), and the nucleotide fragment of the gene was synthesized by Tsingke Genomics (Tsingke, Beijing, China). The porcine reproductive and respiratory syndrome virus (PRRSV) strain CSR1801 (GenBank accession No. OM743305.1) and porcine circovirus type 2 (PCV2) strain CSR2301 (GenBank accession No. OQ865055.1) were isolated and stored in the laboratory. cDNA from the porcine epidemic diarrhea virus (PEDV) CHM2013 (GenBank accession No. KM887144.1), porcine deltacoronavirus (PDCoV) CHN-HN-1601 (GenBank accession No. MG832584.1), and the DNA from pseudorabies virus (PRV) HB1201 strains (GenBank accession No. KU057086.1) were kindly provided by the College of Veterinary Medicine of China Agricultural University, Beijing, China.

The 6His-MBP-TEV-huLbCas12a plasmid (Addgene, Watertown, MA, USA) was used as a template for designing Cas12a amplification primers with homology arms (Primer Premier v. 5.0; PREMIER Biosoft, Palo Alto, CA, USA): Cas12a-F/Cas12a-R (Table 1), carried BamHI and XhoI cleavage sites at the front and back ends, respectively. PCR amplification of Cas12a gene, in a 25 μL of reaction system, contained 2 μL of Cas12a plasmid template, 1 μL of Cas12a-F, 1 μL of Cas12a-R, 12.5 μL of 2 × Es Taq Master Mix, and 8.5 μL of ddH₂O; the reaction program was: 95°C pre-denaturation for 5 min, 95°C denaturation 30 s, and 56°C annealing for 30 s, 72°C extension for 120 s, 30 cycles of reaction, and 4°C. At the end of the PCR reaction, agarose gel electrophoresis was performed, the target genes were recovered and sequenced for identification, and the recovered target genes were stored at –20°C. The pET-28a vector (Tiangen Biotech, Beijing, China) was subjected to BamHI and XhoI double enzyme digestion, agarose gel electrophoresis recovered pET-28a target fragment, the vector fragment and Cas12a fragment with added homologous recombination site were subjected to ligation reaction under the action of T4 DNA ligase, and ligated products were transformed to the DH5α competent cells, and the monoclonal clones with kanamycin resistance were selected. The Cas12a prokaryotic expression plasmid with the correct gene sequence was obtained, named pET-28a-Cas12a, and stored at –80°C.

The recombinant plasmid pET-28a-Cas12a was transformed into BL21 (DE3) competent cells (ThermoFisher Scientific, Shanghai, China), and the monoclonal colonies were picked and inoculated with kanamycin-resistant LB liquid medium. IPTG was added to induce protein expression when the OD₆₀₀ value reached 0.6~0.8. The IPTG was set at 100, 300, 500, and 700 μM, the temperature was set at 18 and 37°C, and the incubation was performed at 5.37 g for 4, 6 and 8 h, so as to screen the optimal conditions for induced expression.

Under the optimal expression conditions described above, pET-28a-Cas12a was induced in large quantities in the liquid LB medium. The bacterial fluid was collected, centrifuged at 7,104 g for 10 min, the bacterial precipitate was collected, and the bacterial lysis solution and protease inhibitor (Beyotime, Shanghai, China) were added successively, and then the bacterial bodies were broken by ultrasonication (300 W, 3 s bursts with 6 s pauses, for 30 min on ice), the precipitate was collected by centrifugation and resuspended with 8 M urea solution, and the supernatant was centrifuged at 13,400 g for 20 min and filtered through a 0.45 μm filter to remove impurities. The Cas12a protein was purified according to Ni-agarose instructions (CWBio, Beijing, China). Briefly, the inclusion body protein solution was loaded into the sampling column, and an elution buffer was added to elute the target protein. The purified Cas12a protein was collected, and the protein concentration was determined by Micro BCA Protein Assay Kit (CWBio), stored at –80°C.

Purified Cas12a protein was separated by SDS-PAGE and identified by Western blotting. The main steps were as follows: the Cas12a protein was added to a 12% SDS-PAGE separation gel and electrophoresed for 20 min at 80 V, and the lower layer of the gel was electrophoresed for 90 min at 120 V. The protein separation gel was transferred at a current of 200 mA for 1.5 h, and the protein on the gel was transferred to a PVDF membrane. Then it was washed with phosphate buffered saline with tween-20 (PBST), blocked with 5% dry milk in PBST, and washed again before adding anti-His tag mouse monoclonal antibody (Beyotime) as primary antibody (1:3,000) and incubated at 4°C overnight. After washing, HRP-labeled goat anti-mouse IgG (Jackson ImmunoResearch, West Grove, PA, USA) was added as a secondary antibody (1:5,000) and incubated at room temperature for 2 h. After washing, an enhanced chemiluminescence detection kit (ThermoFisher Scientific) was used to blot the target protein and images were captured using a ChemiDocTM MP Imaging System (Bio-Rad Laboratories, Hercules, CA, USA).

The KP177R gene of the ASFV Anhui XCGQ strain was used as a target template to design a guide RNA (gRNA) for the Cas12a protein with the sequence UAAUUUCUACUAAGUGUAGAUUUACAUUUGCUUAUUUGCUCUUUA, which was localized at the 27th to 46th bases of the KP177R gene. The sequence specificity of this gRNA was analyzed using the NCBI online BLAST tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) to determine whether the gRNA does not bound a non-target KP177R fragment or a nucleotide paralog in the GenBank database. The gRNA was synthesized and diluted to a concentration of 10 μM and stored at –80°C. The Cas12a protein first needs to bind to a specific gRNA, and the cleavage properties of the Cas12a protein can be activated if the Cas12a protein recognizes the target DNA sequence and cleaves the single-stranded DNA. To detect the target DNA sequence, for Cas12a protein and KP177R target sequence, TTATT was used as the basic ssDNA sequence. A FAM fluorescent chromogenic element was added to the 5’ end of the ssDNA reporter, and a black hole quencher 1 (BHQ1) element was added to the 3’ end. The ssDNA reporter had a sequence of 5’-FAM-TTATT-BHQ1-3’ and this fluorescent reporter was named ssDNA-F. A FAM fluorescent chromogenic element was added to the 5’ end of the ssDNA reporter and a biotin was added to the 3’ end. The ssDNA reporter was sequenced as 5’-FAM-TTATT-Biotin-3’, and the biotin reporter was named ssDNA-B. These two reporters were synthesized using Tsingke genomics (Tsingke).

The complete KP177R gene fragment of ASFV was synthesized based on the full gene sequence of the ASFV Anhui XCGQ strain, and PCR primers KP177R-F/KP177R (Table 1) were used to amplify the gene fragments. The PCR reaction conditions were 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 45 s, and 30 cycle reactions. The PCR products were transformed into Escherichia coli competent cells DH5α, single colonies were picked for verification, and the recombinant plasmid was named pMD18-T-KP177R and stored for subsequent experiments. RPA amplification primers should be designed according to the binding site of the gRNA and must contain the target sequence to be detected. In this study, four pairs of RPA amplification primers (RPA-F1/RPA-R1, RPA-F2/RPA-R2, RPA-F3/RPA-R3, and RPA-F4/RPA-R4) were designed and synthesized (Tsingke); their sequences are shown in Table 1, which amplify 120, 428, 424 and 476 bp length fragments of the KP177R gene, respectively. Using the above RPA-F/RPA-R primers, gene amplification was performed using the pMD18-T-KP177R plasmid as a template according to the instructions of the DNA Isothermal Rapid Amplification Kit (Amp-Future, Weifang, China). The main steps were as follows: 29.4 μL Buffer A, 2 μL RPA-F (10 μM), 2 μL RPA-R (10 μM), 12.1 μL ddH₂O, 2 μL pMD18-T-KP177R (420 ng/μL), and 2.5 μL Buffer B were added to the system, which was mixed thoroughly, and reacted for 30 min at 37°C in a metal bath. At the end of the reaction, Tris-saturated phenol/chloroform/isoamyl alcohol (25:24:1) extraction solution was added, mixed thoroughly at a 1:1 ratio, and centrifuged at 13,400 g for 5 min. The supernatant of the uppermost of the three layers was collected and the RPA amplification product, was analyzed by agarose gel electrophoresis.

The KP177R RPA-CRISPR/Cas12a assay system consisted of the RPA amplification product of the target dsDNA KP177R gene, Cas12a protein, NEBuffer 2.1, ssDNA reporter, gRNA, and ddH₂O. Fluorescence intensity was measured using a 96-well microplate reader to determine whether the complete reaction system was stable. The assay system was set to 50 μL, containing 5 μL of NEBuffer 2.1, 5 μL of KP177R RPA amplification product, 5 μL of Cas12a protein (2.5 μg/μL), 2.5 μL of gRNA (10 μM), 5 μL of fluorescein-labeled ssDNA reporter (ssDNA-F, 10 μM), and 27.5 μL of ddH₂O. At the same time, four groups of independent reaction systems lacking either the KP177R RPA amplification product, Cas12a protein, gRNA or ssDNA reporter were used as controls. The prepared assay system was placed in a microplate reader, the excitation and emission wavelength were set at 485 and 521 nm, respectively, and the reaction was performed at 37°C for 1 h. Fluorescence intensity was measured every 2 min and consecutive fluorescence values were collected. The above detection reactions were independently tested thrice and the results were analyzed statistically. In order to establish a visual fluorescence detection assay that is convenient for clinical field, the detection system of the above assay was set to 20 μL, containing 2 μL NEBuffer 2.1, 3 μL KP177R RPA amplification product, 1 μL Cas12a protein (2.5 μg/μL), 2 μL gRNA (10 μM), 1 μL ssDNA-F reporter (10 μM), and 11 μL ddH₂O. The reaction system was mixed thoroughly and added into PCR tube strip (Roche, Shanghai, China). The reaction was performed in a metal bath at 37°C for 30 min, and the fluorescence status was observed and recorded with the naked eye under blue light at the end of the reaction.

Similar to the fluorescent reaction system described above, the fluorescent reporter ssDNA-F in the fluorescent reaction system was replaced with biotin-labeled reporter ssDNA (ssDNA-B), and the reaction product was blotted with the substrate on an LFD (Tiosbio, Beijing, China) to determine the target gene. With reference to the reagent ratios of the above fluorescent reaction system, a biotin reporter reaction system was prepared, containing 5 μL NEBuffer 2.1, 5 μL KP177R RPA amplification product, 5 μL Cas12a (2.5 μg/μL), 2.5 μL gRNA (10 μM), 5 μL ssDNA-B (10 μM), and 27.5 μL ddH₂O. The reaction system was performed in a metal bath at 37°C, for 0, 10, 20, 30, 40, 50 min, and 60 min. Fifty microliters of the reaction product were added dropwise to LFD and incubated for 10 min. The blot densities of the detection T- and control C-lines were determined using Image J software (National Institutes of Health (NIH), Bethesda, MD, USA), and the corresponding T/C ratios were calculated for statistical analysis.

To determine the optimal reaction temperature and time for the KP177R RPA-CRISPR/Cas12a assay, the ssDNA-F reporter was selected to formulate the 50 μL assay system in a 96-well microplate. The reaction system was placed in a microplate reader, and different reaction temperatures were set: 20, 25, 30, 35, 37, 40, and 42°C and the fluorescence intensity was measured every 2 min for a total of 1 h, and the consecutive fluorescence intensities were recorded, and then the optimal reaction temperatures and reaction times of the fluorescein-labeled reaction system were determined after statistical analysis. Meanwhile, 20 μL of the reaction system was configured in a PCR tube strip, and the reaction was performed at the temperatures of 20, 25, 30, 35, 37, 40, and 42°C for 30 min, respectively, and the optimal reaction temperature was determined according to the fluorescence intensity under blue light irradiation.

To determine the optimal concentration of Cas12a protein and gRNA, the Cas12a protein concentration was set to 400, 200, 100, 50, and 25 nM, the gRNA concentration was set to 200, 100, 50, and 25 nM, and a checkerboard test was performed. The fluorescent reporter ssDNA-F was selected to formulate the assay system, which was performed for 1 h at 37°C, and the fluorescence intensity was measured at intervals of 2 min, and a continuous report of the fluorescence value was obtained. At the end of the reaction, the Heatmap command in GraphPad software (Boston, MA, USA) was used to create graphs and for comparative analysis to determine the optimal Cas12a protein and gRNA reaction concentrations.

To determine the optimal reaction temperature of the biotin-labeled reaction system, according to the optimal reaction concentration of Cas12a protein and gRNA determined by the above test, biotin-labeled reporters were selected to formulate the CRISPR/Cas assay: 5 μL NEBuffer 2.1, 5 μL KP177R RPA amplification product, 5 μL Cas12a (100 nM), 2.5 μL gRNA (100 nM), 5 μL ssDNA-B (10 μM), and 27.5 μL ddH₂O, placed in a metal bath, and set different temperatures of 20, 25, 30, 35, 37, 40, and 42°C, and reacted for 20 min. Image J software was used to determine the color densities of the LFD detection T- and control C-lines and to calculate the corresponding T/C ratios. The biotin-labeled reaction system was configured according to the optimal reaction temperature determined from the above test to determine its optimal reaction time. The biotin-labeled reporter reaction system reacted at 40°C for 5, 10, 15, 20, and 25 min, and the color densities of the T- and C-lines were measured and the corresponding T/C ratios were calculated. To determine the optimal incubation time of the biotin-labeled reaction products with the test strips, the biotin-labeled reporter detection system was configured according to the optimal reaction temperature and reaction time determined from the above tests. The reaction products were added dropwise to the test strips after a 20 min reaction at 40°C, and the incubation times were set to 2, 4, 6, 8, and 10 min. The color densities of the T- and C-lines were determined and the corresponding T/C ratios were calculated.

To assess the specificity of the assay, nucleic acids of PRRSV, PCV2, PEDV, PDCoV, and PRV were used as controls. The nucleic acids of ASFV and the above five types of viruses were simultaneously amplified isothermally using the RPA established in this study, and then the amplified products were measured using the fluorescein- and biotin-labeled reporter reaction systems to determine the specificity of this KP177R RPA-CRISPR/Cas12a for the detection of the target gene.

The concentration of the positive plasmid pMD18-T-KP177R of the sample to be detected, KP177R, was 6.83 × 10¹⁰ copies/μL, which was tenfold diluted to 6.83 × (10⁸, 10⁷, 10⁶, 10⁵、10⁴, 10³, 10², 10¹ and 10⁰) to obtain different concentrations of the sample DNA to be detected. Different concentrations of sample DNA were used as templates for RPA amplification, and the RPA amplification products were used as target dsDNA for CRISPR/Cas12a detection. The sensitivity of this CRISPR/Cas12a assay to fluorescein- and biotin-labeled reporter reaction systems was determined by observing the fluorescence color development and the T/C ratios of the LFD, respectively.

The RPA amplification products of strongly, moderately, and weakly positive KP177R DNA, 6.83 × 10⁷, 6.83 × 10⁵, and 6.83 × 10³ copies/μL, were used as the target DNA to evaluate the CRISPR/Cas12a fluorescein- and biotin-labeled reaction systems reproducibility. Three independent runs, each with three technical replicates, were conducted under optimal conditions on the three DNA templates extracted monthly for three months.

Ten KP177R gene fragments amplified from clinical samples of suspected ASF collected in 2020-2022 by the National Reference Laboratory for ASF, China Animal Health and Epidemiology Center (Qingdao, China) were used to assess the performance of the KP177R RPA-CRISPR/Cas12a assay. KP177R RPA-CRISPR/Cas12a and RT-qPCR were used to detect these gene fragments simultaneously. The RT-qPCR assay recommended by WOAH was performed as previously described (13). The KP177R RPA-CRISPR/Cas12a detection results were compared to those acquired from the parallel RT-qPCR assay to calculate the diagnostic coincidence rates corresponding to the two assays.

The data were expressed as the mean ± standard deviation (X ± SD). Duncan’s multi-sample test was used to analyze the differences between the groups, and SPSS 19.0 was used for statistical analysis. p < 0.05 was considered statistically significant.

The Cas12a gene was amplified by PCR using the 6His-MBP-TEV-huLbCas12a plasmid as a template (Figure 1A) to construct the Cas12a expression plasmid pET-28a-Cas12a, which showed a band conforming to the molecular size of the target gene with a molecular weight of approximately 3,684 bp after double enzyme cleavage (BamH I and Xho I) reaction (Figure 1B). The recombinant plasmid pET-28a-Cas12a was transfected into BL21 (DE3) competent cells to induce Cas12a protein expression. The culture temperature, IPTG concentration, and induction time were determined at 37°C for 6 hours with a concentration of 100μM IPTG. Bacteria were collected by centrifugation, and the supernatant and precipitate were subjected to SDS-PAGE after ultrasonic crushing, which showed that the Cas12a protein existed in the supernatant and precipitate of the crushed bacteria in the form of soluble and inclusion body expression (Figure 1D). Ni-affinity chromatography was used to obtain the purified Cas12a protein (Figure 1D). Western blotting identified the protein with a distinct band at a molecular weight of approximately 143 kDa, which was consistent with the molecular weight of the Cas12a target protein (Figure 1E).

The complete fragment of the ASFV KP177R gene was synthesized as a template and amplified it to construct the recombinant plasmid pMD18-T-KP177R, which was consistent with the original sequence of the gene according to sequencing review. The KP177R gene was amplified using four primer pairs (RPA-F/R1-F/R4). The RPA-F1/R1 primer was screened according to the agarose gel electrophoresis results, which confirmed that the amplification products matched the expected size of 120 bp (Figure 1C).

To determine the specificity of the KP177R RPA-CRISPR/Cas12a assay for ASFV, RPA amplification was performed for different viruses. Under blue light irradiation, only the ASFV nucleic acid template group emitted green fluorescence, while the rest of groups were non-fluorescent (Figure 4A); the microplate reader also showed fluorescent signals only in the ASFV template group when working at 37°C for 1 h in the assay (Figure 4B). Correspondingly, only the T-line of the ASFV group showed a blot in LDF, whereas the rest of the groups showed no blots (Figures 4C, D). These results indicate that the KP177R RPA-CRISPR/Cas12a assay has good specificity.

The KP177R positive plasmid pMD18-T-KP177R was tenfold diluted, which were used as templates for RPA amplification. Reaction systems were used to perform RPA-CRISPR/Cas12a assays on the different concentrations of DNA templates mentioned above. Under blue light irradiation, a visual green fluorescent response was observed in the tube with a minimum template concentration of 6.83 × 10⁰ copies per microliter (Figure 5A). Similarly, the fluorescence signal was detected in the tube with a minimum concentration of 6.83 × 10⁰ copies per microliter in a microplate reader (Figure 5B). Correspondingly, the appearance of T-line red blot and T/C ratios were observed at a minimum of 6.83 × 10⁰ copies per microliter of template for the LFD (Figures 5C, D). These results indicate that the KP177R RPA-CRISPR/Cas12a fluorescein- and biotin-labeled reaction system is highly sensitive, with a detection limit of 6.83 × 10⁰ copies per microliter of viral nucleic acid.

RPA amplification products of 6.83 × 10⁷, 6.83 × 10⁵, and 6.83 × 10³ copies/μL of strongly, moderately, and weakly positive KP177R gene were used to determine the reproducibility of the CRISPR/Cas12a assay. The signal intensities at the T line generated by the same ASFV DNA concentration did not obviously change over the three months of sampling (Figure 6). These results showed that the KP177R RPA-CRISPR/Cas12a assay had good reproducibility.

Ten KP177R gene fragments were amplified from clinical samples and detected using fluorescein- and biotin-labeled KP177R RPA-CRISPR/Cas12a assays and RT-qPCR. The results of fluorescein-labeled KP177R RPA-CRISPR/Cas12a showed that 6 samples tested positive, while 4 samples tested negative (Figures 7A, B), and the above-mentioned six positive and four negative gene fragments in the biotin-labeled KP177R RPA-CRISPR/Cas12a assay also showed identical positive and negative results, respectively (Figures 7C, D). Fluorescein- and biotin-labeled KP177R RPA-CRISPR/Cas12a were used to test each KP177R gene fragment, and the results were compatible. Similarly, these ten samples were detected by RT-qPCR, the KP177R gene fragments could not be detected by qPCR recommended by WOAH, which target on B646L gene (p72). The diagnostic coincidence rate for both assays was 100% and the kappa value was 1.000 (p < 0.001). The viral nucleic acid contents of these six positive samples were 10^3.97, 10^3.81, 10^3.36, 10^2.93, 10^2.59, and 10^2.49 copies per microliter, respectively (Figure 7E).